SNP sites related to body color of leopard bristlenose and applications thereof

By identifying SNP sites related to the body color of the leopard-gill spiny perch and using the agonist NLRP3 agonist 1, combined with dark environment light regulation, the problem of breeding red body color in the leopard-gill spiny perch in existing technologies has been solved, and significant improvement in the red color of the leopard-gill spiny perch skin and stable genetic improvement of the trait have been achieved.

CN121896372BActive Publication Date: 2026-07-03HAINAN CHENHAI AQUATIC CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HAINAN CHENHAI AQUATIC CO LTD
Filing Date
2026-03-24
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively cultivate the red body color of the leopard gill spiny perch through molecular breeding and optimization of farming models, and lack a method that combines optimization of farming models with molecular breeding to enrich collective hues.

Method used

We identified SNP loci associated with body color in the leopard gill spiny perch, and cultured individuals with superior genotypes at SNP1, SNP2, and SNP3 loci. These individuals were then fed the agonist NLRP3 agonist 1, and their body color was regulated by dark-environment light, resulting in a significant enhancement of their red color.

Benefits of technology

It significantly improves the red color of the skin of the leopard-gill spiny perch, enhances its market value, promotes the development of marine aquaculture, and achieves stable genetic improvement of body color traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896372B_ABST
    Figure CN121896372B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of bio-aquaculture technology, specifically relating to SNP loci related to the body color of the leopard-gill spiny perch and their applications. This invention provides SNP loci (16_797851, 13_24322516, and 9_17302939) associated with the body color of the leopard-gill spiny perch. Furthermore, this invention provides a method for mining SNP loci and a method for enhancing the red color of the leopard-gill spiny perch's skin. By employing the HSV color model, the red body color is transformed from a direct sensory representation into a continuous quantitative variable, providing a data foundation for the genetic analysis of body color traits. Based on genome-wide molecular marker screening, genetic markers significantly associated with body color traits are obtained. Combined with the administration of agonists to individuals with genetic advantages, a significant enhancement of the red color of the leopard-gill spiny perch's body surface can be achieved. Therefore, the technical solution of this invention can not only directionally improve the body color trait of the leopard-gill spiny perch and cultivate high-quality new strains with stable body color inheritance, but also promote the development of marine aquaculture and the seed industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological aquaculture technology, specifically relating to SNP sites related to the body color of the leopard-gill spiny perch and their applications. Background Technology

[0002] Leopard-gill spiny perch ( Plectropomus leopardus The grouper (also known as the Eastern Star Grouper) is an important aquaculture species in my country, with an annual national production exceeding 20,000 tons. It is a star species in Hainan's specialty aquaculture industry. Thanks to its outstanding industrial advantages, Wanning City in Hainan Province has been awarded the title of "Hometown of the Eastern Star Grouper in China." This species not only has high edible value and delicious meat, but also boasts vibrant colors and strong ornamental appeal, possessing both economic and aesthetic value. The leopard-gill spiny perch is predominantly red with blue or bluish-gray spots. Body color is a crucial economic trait for the leopard-gill spiny perch, directly affecting its commercial quality and market price. Red individuals can fetch up to twice the price of black individuals.

[0003] Therefore, cultivating red-bodied leopard-gill perch has broad market value and is a research hotspot in this field. For example, Chinese patent CN 117717021 A describes a method for improving the survival rate and growth performance of leopard-gill perch by controlling background color. During the breeding process, controlling the background color not only improves the growth performance and survival rate of leopard-gill perch by more than 5%, but also helps induce the red body color, significantly improving breeding efficiency. Another example is Chinese patent CN118830503 A, which describes a method for promoting the rapid removal and growth of melanin on the body surface of leopard-gill perch. Irradiating the leopard-gill perch breeding pond with blue single-spectrum light with a wavelength of 450-425nm can rapidly change the body color of the leopard-gill perch from entirely black to entirely red within 60 days, resulting in a first-class product. It is evident that existing technologies utilize multiple physical methods to obtain fish with superior body color. Although optimizing breeding practices and molecularly selecting for dominant alleles related to body color to achieve precise control of body color is a key technical approach for cultivating new high-quality spotted grouper strains, there have been no reports of combining breeding practice optimization with molecularly selecting for dominant body color. Summary of the Invention

[0004] The purpose of this invention is to provide SNP loci associated with the body color of the leopard gill spiny perch, wherein the SNP loci include at least one of SNP1-SNP3:

[0005] The SNP1 is the 100th position of the sequence shown in SEQ ID NO:1 or SEQ ID NO:2, and it contains an A / G mutation; the SNP2 is the 100th position of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, and it contains an A / T mutation; the SNP3 is the 100th position of the sequence shown in SEQ ID NO:5 or SEQ ID NO:6, and it contains an A / G mutation.

[0006] Preferably, the proportion of red body color in individuals with the AA genotype at the SNP1 locus is significantly higher than that in individuals with the AG and GG genotypes; the proportion of red body color in individuals with the AA genotype at the SNP2 locus is significantly higher than that in individuals with the AT and GT genotypes; and the proportion of red body color in individuals with the AA genotype at the SNP3 locus is significantly higher than that in individuals with the AG and GG genotypes.

[0007] The present invention provides primers for amplifying the SNP sites, using primers with nucleotide sequences as shown in SEQ ID NO:7 and SEQ ID NO:8 to amplify SNP1; using primers with nucleotide sequences as shown in SEQ ID NO:9 and SEQ ID NO:10 to amplify SNP2; and using primers with nucleotide sequences as shown in SEQ ID NO:11 and SEQ ID NO:12 to amplify SNP3.

[0008] This invention provides a method for mining SNP sites as described in the above technical solution, comprising the following steps:

[0009] S1 involves raising leopard gill spiny perch in a dark environment and then subjecting them to deep anesthesia to obtain fish with relaxed cells.

[0010] S2 uses a hue-saturation-brightness system to analyze the body color data of fish with cell relaxation, and obtains fish with different body colors;

[0011] S3 constructed a hybrid family of leopard-gill spiny perch using fish with different body colors, and performed whole-genome analysis on the fish in the hybrid family to obtain SNP loci related to the body color of leopard-gill spiny perch.

[0012] Preferably, in step S1, the dark environment includes: light intensity ≤100 lux and spectral wavelength of 650-780 nm;

[0013] The deep anesthesia includes immersing the fish in an aqueous solution containing eugenol for 15-20 minutes;

[0014] The concentration of eugenol in the aqueous solution containing eugenol is 100-120 ppm.

[0015] Preferably, in step S2, the steps for analyzing body color data include:

[0016] Except for the spots on the back of the fish, randomly select 3-5 points as test points;

[0017] Within a space where the light source, light intensity, aperture, photosensitivity, exposure time, and focal length are all constant, the hue and saturation of the test points are analyzed separately. The mean hue and mean saturation of each test point are the hue and saturation values ​​of the fish body.

[0018] Among them, the lower the hue value, the more the fish body tends to be bright red; the higher the saturation value, the deeper the color of the fish body.

[0019] This invention provides the application of the SNP sites described in the above technical solution in screening or identifying red leopard-gill spiny perch.

[0020] This invention provides a method for enhancing the red color of the skin of the leopard-gill spiny perch, comprising the following steps:

[0021] Individuals with superior SNP loci genotypes as described in the above technical solution were selected for culture to obtain cultured fish.

[0022] The cultured fish were fed the agonist NLRP3 agonist 1 to enhance the red coloration of the skin of the leopard gill spiny perch.

[0023] Preferably, agonist NLRP3 is fed every 3-4 days; the feeding amount is 0.2mg~1mg per kilogram of fish body; the feeding cycle is ≥30 days.

[0024] Preferably, fish are cultured for ≥180 days in a dark environment with a light intensity ≤100 lux and a spectral wavelength of 650-780 nm.

[0025] Individuals with superior SNP genotypes include at least one of the following: individuals with the AA genotype at SNP1, SNP2, or SNP3.

[0026] Beneficial effects:

[0027] This invention provides SNP loci associated with the body color of the leopard-gill spiny perch, wherein the SNP locus includes at least one of SNP1-SNP3: SNP1 is position 100 of the sequence shown in SEQ ID NO:1 or SEQ ID NO:2, containing an A / G mutation; SNP2 is position 100 of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, containing an A / T mutation; and SNP3 is position 100 of the sequence shown in SEQ ID NO:5 or SEQ ID NO:6, containing an A / G mutation. These loci are associated with the body color of the leopard-gill spiny perch, wherein the proportion of red body color in individuals with the AA genotype at SNP1 is significantly higher than that in individuals with the AG and GG genotypes; the proportion of red body color in individuals with the AA genotype at SNP2 is significantly higher than that in individuals with the AT and GT genotypes; and the proportion of red body color in individuals with the AA genotype at SNP3 is significantly higher than that in individuals with the AG and GG genotypes.

[0028] This invention also provides a method for mining the aforementioned SNP loci. By employing the Hue-Saturation-Lightness (HSV) color model, the red body color is transformed from a direct sensory representation into a continuous quantitative variable, providing a data foundation for the genetic analysis of body color traits. Furthermore, based on genome-wide molecular marker screening, genetic markers significantly associated with body color traits are obtained, thereby enabling targeted improvement of the body color trait in leopard gill spiny perch and the cultivation of high-quality new strains with stable body color inheritance.

[0029] Furthermore, this invention also provides a method for enhancing the red color of the skin of the leopard-gill spiny perch. By culturing individuals with superior SNP locus genotypes and feeding them NLRP3 agonist 1, the red color of the leopard-gill spiny perch's skin is significantly improved. Thus, this invention, for the first time, combines a novel aquaculture model to significantly enhance the red color of the leopard-gill spiny perch's body surface, thereby increasing its value and promoting the development of marine aquaculture and breeding industries. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 The effects of different farming methods provided by this invention on the body color of the leopard-gill spiny perch;

[0032] Figure 2 Cellular micrographs showing the effects of different farming methods provided by this invention on the pigmentation of the leopard-gill spiny perch.

[0033] Figure 3 A schematic diagram illustrating how hue and saturation determine color, provided by the present invention;

[0034] Figure 4 The QQ-plot of genome-wide association analysis of body color provided by this invention;

[0035] Figure 5 Manhattan plot of genome-wide association analysis of body color provided by this invention;

[0036] Figure 6 The effect of different SNP loci genotypes on body color and saturation of leopard-gill spiny perch provided by this invention;

[0037] Figure 7 The effect of different concentrations of agonist on changes in fish saturation provided by this invention;

[0038] Figure 8 The effect of different concentrations of agonists provided by this invention on changes in fish body color. Detailed Implementation

[0039] This invention uses hue and saturation as phenotypic traits to perform association analysis with single nucleotide polymorphism (SNP) markers in the genome. Specifically, it includes: using the leopard-gill spiny perch as the test sample, collecting body color data and extracting and constructing a library from the sample; performing genome resequencing or simplified genome sequencing, aligning the sequencing data to the leopard-gill spiny perch genome, and identifying SNPs. During this process, low-quality SNPs are removed, and the obtained high-quality SNPs are used for genome-wide association analysis with the phenotype, using a mixed linear model (MLM) to identify SNPs significantly associated with color. Where p-value < 1 × 10⁻⁶, [the analysis is not performed on these SNPs]. -5 The points were identified as SNP loci significantly associated with color. Through the above analysis, a total of 17 SNP loci were found to be significantly associated with body surface color. After removing fully linked loci, the remaining 3 SNP loci were significantly associated with body surface color.

[0040] The three SNP loci are: the SNP at locus 797851 on chromosome 16, with the genotype of A being dominant and the genotype of G being suboptimal, explaining 9.19% of the trait, named 16_797851; the SNP at locus 24322516 on chromosome 13, with the genotype of A being dominant and the genotype of T being suboptimal, explaining 8.93% of the trait, named 13_24322516; and the SNP at locus 17302939 on chromosome 9, named 9_17302939, with the genotype of A being dominant and the genotype of G being suboptimal, explaining 6.70% of the trait.

[0041] The nucleotide sequence including the 100 bp above and below 16_797851 is shown in SEQ ID NO:1 or SEQ ID NO:2; SEQ ID NO:1 is: 5'-TGTCAAGCCTTGTCATTGACACTAAACTGACTTTACAGCAACATTTTAATGATTAAATGATATACAGCTGCATCCTGACCTGAGAGTTTCCAGTCTACA A TGAGGACTCTCCAGTCCAACCGCGAGCAGCTTCACTCCTGAATCCTGCAGGTCGTTGTTACTCAGGTCCAGGTGTCTCAGACTGGAGGACTGAGAGCTGA-3'; the SEQ ID NO:2 is: 5'-TGTCAAGCCTTGTCATTGACACTAAACTGACTTTACAGCAACATTTTAATGATTAAATGATATACAGCTGCATCCTGACCTGAGAGTTTCCAGTCTACA G TGAGGACTCTCCAGTCCAACCGCGAGCAGCTTCACTCCTGAATCCTGCAGGTCGTTGTTACTCAGGTCCAGGTGTCTCAGACTGGAGGACTGAGAGCTGA-3'; The primers used to amplify the above 16_797851 include: the forward primer (SEQ ID NO:7): 5'-TGTCAAGCCTTGTCATTGACACTA-3', and the reverse primer (SEQ ID NO:8): 5'-TCAGCTCTCAGTCCTCCAGTCTG-3'.

[0042] The nucleotide sequence including the 100 bp above and below 13_24322516 is shown in SEQ ID NO:3 or SEQ ID NO:4; SEQ ID NO:3 is: 5'-GGAAGAACTTGAATGTTACAGCCTTTGTGTTTCCTGTCAGGTGGCCATGCTCCAGAATCAAGGCAGAGAGATGATGATTGTCACCAGTGGCGCTGTGGC ATTTGGGAAGCAGAGACTGAGACATGAGATCCTGCTGTCTCAGAGCGTCAGACAAGCCCTGCATTCTGGACAGAATCAACTCAAAGAAATGGTGAGTAATT-3'; the SEQ ID NO:4 is: 5'-GGAAGAACTTGAATGTTACAGCCTTTGTGTTTCCTGTCAGGTGGCCATGCTCCAGAATCAAGGCAGAGAGATGATGATTGTCACCAGTGGCGCTGTGGC T TTTGGGAAGCAGAGACTGAGACATGAGATCCTGCTGTCTCAGAGCGTCAGACAAGCCCTGCATTCTGGACAGAATCAACTCAAAGAAATGGTGAGTAATT-3'; The primers used to amplify the above 13_24322516 include: the forward primer (SEQ ID NO:9): 5'-GGAAGAACTTGAATGTTACAGCCTT-3', and the reverse primer (SEQ ID NO:10): 5'-AATTACTCACCATTTCTTTGAGTTGATT-3';

[0043] The nucleotide sequence including the nucleotides within 100 bp above and below 9_17302939 is shown in SEQ ID NO:5 or SEQ ID NO:6; SEQ ID NO:5 is: 5'-AGGATTACAAGACATACTATAAGGACATTTACGCACTTAAAAGTGTACTATACAAGTTCACTTATGACCCACTAGAAGTGTGTGACAGTGTATTTATCC A TAGAGACCCTGCTCTCTGCCTGGATTTTCTTATTTTCTTCTCAGTTTGCAGTGTTCGGGATGTTTGTGGGGCACAGCATGTTGGTGAGTTTGGGTCTTTGC-3'; the SEQ ID NO:6 is: 5'-AGGATTACAAGACATACTATAAGGACATTTACGCACTTAAAAGTGTACTATACAAGTTCACTTATGACCCACTAGAAGTGTGTGACAGTGTATTTATCC GTAGAGACCCTGCTCTCTGCCTGGATTTTCTTATTTTCTTCTCAGTTTGCAGTGTTCGGGATGTTTGTGGGCACAGCATGTTGGTGAGTTTGGGTCTTTGC-3'; Primers used to amplify the above 9_17302939 include: forward primer (SEQ ID NO:11): 5'-AGGATTACAAGACATACTATAAGGACATTTAC-3', and reverse primer (SEQ ID NO:12): 5'-GCAAAGACCCAAACTCACCAA-3'; in sequences SEQ ID NO:1-SEQ ID NO:6, bolded and underlined letters indicate mutant bases. Screening leopard-gill spiny perch parents using the above three SNP sites significantly associated with body color is beneficial for significantly improving the skin color of their offspring.

[0044] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] Leopard gill fry, about 5 cm in length, were cultured in outdoor and indoor culture ponds. The outdoor culture ponds were under normal lighting, while the indoor culture ponds were cultured in a workshop with red light (650-780 nm) intensity of about 20 lux.

[0047] Fish from both outdoor and indoor cultured species were visually observed for body color. The results are shown below. Figure 1 (exist Figure 1 In the image, A shows the body color of leopard-gill spiny perch raised outdoors; B shows the body color of leopard-gill spiny perch raised indoors. Microscopic observation of pigment cells on the body surface of the fish was performed, and the results are shown in the image. Figure 2 (exist Figure 2 The left image shows a micrograph of pigment cells on the body surface of leopard-gill sea bass raised outdoors; the right image shows a micrograph of pigment cells on the body surface of leopard-gill sea bass raised indoors.

[0048] Combination Figure 1 , Figure 2 The results showed that the skin of the leopard gill perch in outdoor culture ponds was dark with more melanocytes, while the skin of the perch in indoor culture ponds was light red to bright red with fewer melanocytes.

[0049] Therefore, subsequent genome-wide association studies of body color must be conducted in low-light conditions to reduce the impact of melanin on sampling.

[0050] Example 2

[0051] A hybrid family of leopard-gill spiny perch was constructed using 12 male and 12 female parents with significant color differences. After fry rearing and broodstocking, the leopard-gill spiny perch were transferred to a rearing facility with a red light intensity (650-780nm) of approximately 20 lux. After 8 months, samples were taken from the hybrid family, totaling 307 individuals, for DNA sampling and color recording. During sampling, the fish were immersed in an aqueous solution containing eugenol (100 ppm) for 15 minutes. Color recording was performed using a Pentax K50 camera with constant light source, aperture F / 3.5, ISO 400, focal length 38mm, exposure time 1 / 160s, and exposure compensation 1EV. The data was saved in RAW format. Three points with uniform color on the back of the fish were selected, avoiding spots. Photoshop was used to identify HSV values ​​for sampling, and the average was used as the quantitative trait (e.g., HSV values). Figure 3 (As shown). Meanwhile, fins from each fish were cut and preserved in 75% ethanol for DNA extraction, library construction, and sequencing.

[0052] Genomic DNA (gDNA) samples were used for ddRAD-seq library preparation and sent to Novogene (Beijing) Co., Ltd. for Illumina HiSeq PE150 (150 bp paired ends) sequencing. The ddRAD library construction steps were as follows: gDNA was digested with EcoRI and HaeIII restriction endonucleases in 96-well plates; subsequently, the double-digested DNA fragments were mixed with 25 pmol of A1 and A2 adapters per well, and adapters were added to both ends of the DNA; the DNA fragments were purified by 1% agarose gel (400-600 bp) and column purified using a PCR purification kit (NEB, USA); the final product was enriched by PCR amplification and purified, and the fragment size was assessed using a Bioanalyzer 2100 (Agilent, USA). After adjusting the mixed library to 3 nmol, sequencing was performed using the Illumina HiSeq (Illumina, USA) PE150 strategy.

[0053] Raw sequencing reads were filtered and pruned according to three strict criteria to obtain high-quality clean reads: first, reads linked to adapters were removed; second, reads containing ≥10% unidentified nucleotides (N) were removed; and finally, low-quality reads with >50% bases and a Phred quality score ≤20 were removed. To obtain genetic variation, the clean reads for each sample were aligned to the leopard gill reference genome using the Bowtie2v2.4.2 program. SNPs with a minimum quality score >30 were called using the BCFtools v1.8 program (mpileup, call, and filter). SNPs with a depth <5, minor allele frequency (MAF) <0.05, deletion location <10%, and allele count >2 were removed using VCFtools.

[0054] Phenotypic data from 307 fish individuals were analyzed using a mixed linear model (MLM) in TASSEL 5.0 software. The p-values ​​for genome-wide significance were calculated as –log10(p-value), with a threshold of 5.0. (See QQ plot for details.) Figure 4 ) and Manhattan Map (see Figure 5 All plots were generated using R. The explained rate of phenotypic variation was calculated using TASSEL 5.0 software.

[0055] After removing highly linked sites, three SNPs were found to be significantly associated with body color: the SNP at locus 797851 on chromosome 16, with the genotype of A being dominant and the genotype of G being suboptimal (9.19% explained, named 16_797851); the SNP at locus 24322516 on chromosome 13, with the genotype of A being dominant and the genotype of T being suboptimal (8.93% explained, named 13_24322516); and the SNP at locus 17302939 on chromosome 9, named 9_17302939, with the genotype of A being dominant and the genotype of G being suboptimal (6.70% explained).

[0056] Example 3

[0057] Sixty individuals were randomly selected from a group of leopard gill bass raised in a workshop with a red light intensity of approximately 20 lux for validation. During sampling, the fish were immersed in an aqueous solution containing eugenol (100 ppm) for 15 minutes, followed by photography and DNA collection. The effects of three SNP loci significantly associated with body color were investigated. The method was as follows: color recording was performed using a Pentax K50 camera with constant light source, aperture F / 3.5, ISO 400, focal length 38mm, exposure time 1 / 160s, and exposure compensation 1EV. HSI values ​​were then identified using Photoshop as quantitative traits. Simultaneously, fin rays from each fish were harvested and preserved in 75% ethanol for DNA extraction, library construction, and sequencing. Resequencing was performed using the Illumina platform. Raw sequencing reads were filtered and pruned according to three strict criteria to obtain high-quality clean reads: first, reads linked to adapters were removed; second, reads containing ≥10% unidentified nucleotides (N) were removed; and finally, low-quality reads with >50% bases and a Phred quality score ≤20 were removed. To obtain genetic variation, the clean reads for each sample were aligned to the reference genome of the Leopard Gill-tailed Bass (genome version: DDBJ database accession number AP022700-AP022723) using Bowtie2 v2.4.2. SNPs with a minimum quality score >30 were retrieved using BCFtools v1.8 (mpileup, call, and filter). SNPs with a depth <5, minor allele frequency (MAF) <0.05, deletion location <10%, and allele count >2 were removed using VCFtools. Genotypes of loci significantly associated with the trait were obtained using bedtools. The effects of different genotypes at three single nucleotide polymorphism loci significantly associated with body color on body color and saturation in the leopard-gill spiny perch are shown in [link to documentation]. Figure 6 .

[0058] Combination Figure 6The results showed that at the SNP at locus 797851 on chromosome 16, the genotype with a dominant body color was AA, with hue and saturation of 11.3% and 74.3%, respectively. This genotype had a hue 14.3% lower than genotype AG and a hue 18.7% lower than genotype GG, but a saturation 5.2% higher than genotype AG and a saturation 9.8% higher than genotype GG. Individuals with the AA genotype exhibited superior body color. Similarly, at the SNP at locus 24322516 on chromosome 13, the genotype with a dominant body color was also AA, with hue and saturation of 11.4% and 74.1%, respectively. This hue was 13.0% lower than genotype AT and a hue 14.2% lower than genotype TT. The AA genotype has a saturation 4.1% higher than the AT genotype and a saturation 5.0% higher than the TT genotype, indicating that individuals with the AA genotype exhibit superior body color. The SNP at locus 17302939 on chromosome 9, named 9_17302939, has a genotype with a body color advantage of base A and a genotype with a body color disadvantage of base G. The AA genotype has a hue and saturation of 12 and 74.3% respectively, which is 9.8% lower than the AG genotype and 10.4% lower than the GG genotype. The AA genotype has a saturation 5.8% higher than the AG genotype and a saturation 8.5% higher than the GG genotype, indicating that individuals with the AA genotype exhibit superior body color.

[0059] Example 4

[0060] Leopard-gill spiny perch were grown for 8 months under a red spectrum wavelength of 680-780 nm and an illumination intensity of approximately 50 lux. After screening, 50 leopard-gill spiny perch with the AA genotype and 50 with the GG genotype at locus 16_797851 were obtained. Each genotype was randomly divided into 5 groups of 10 fish each, serving as experimental and control groups. The agonist NLRP3 agonist 1 (CAS No. 2454019-69-1) was used. NLRP3 agonist 1 was dissolved in dimethyl sulfoxide (DMSO) to a concentration of 100 mg / mL, and then diluted with ultrapure water to a final concentration of 1 mg / mL. NLRP3 agonist 1 was mixed into the feed, and fish were fed 0.1 mg, 0.2 mg, 0.5 mg, and 1 mg of NLRP3 agonist 1 per kilogram of body weight. A control group was set up for each genotype treatment. The control group was fed only an equal amount of dimethyl sulfoxide and ultrapure water as a placebo. Feeding was performed every 3 days for 30 days. The initial color saturation of fish not fed NLRP3 agonist 1 and the subsequent color saturation of each fish were recorded. The results are as follows: Figure 7 As shown; the color of the fish before and after the experiment is as follows. Figure 8 As shown.

[0061] Combination Figure 7 , Figure 8The results showed that in individuals with the AA genotype, when fed 0.2 mg, 0.5 mg, and 1 mg of NLRP3 agonist 1 per kilogram of body weight, the saturation of the body color of the leopard gill spiny perch was significantly increased, while the hue was significantly decreased, meaning the fish were more reddish. In contrast, in carriers of the GG genotype, the red coloration also increased when fed 0.2 mg, 0.5 mg, and 1 mg of NLRP3 agonist 1 per kilogram of body weight, but only at a dose of 1 mg did a significant difference emerge compared to the control group. This indicates that fish carrying the AA genotype are more sensitive to agonists than those carrying the GG genotype.

[0062] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of primers for detecting SNP locus genotypes related to body color in the screening or identification of red leopard-gill spiny perch, characterized in that, The primers are used to detect at least one of SNP1-SNP3: SNP1 is the 100th position of the sequence shown in SEQ ID NO:1 or SEQ ID NO:2, and contains an A / G mutation; SNP2 is the 100th position of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, and contains an A / T mutation; SNP3 is the 100th position of the sequence shown in SEQ ID NO:5 or SEQ ID NO:6, and contains an A / G mutation. The proportion of red body color in individuals with the AA genotype at the SNP1 locus was significantly higher than that in individuals with the AG and GG genotypes; the proportion of red body color in individuals with the AA genotype at the SNP2 locus was significantly higher than that in individuals with the AT and GT genotypes; and the proportion of red body color in individuals with the AA genotype at the SNP3 locus was significantly higher than that in individuals with the AG and GG genotypes.

2. The application according to claim 1, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO:7-SEQ ID NO:12; SNP1 is amplified using primers with nucleotide sequences shown in SEQ ID NO:7 and SEQ ID NO:8; SNP2 is amplified using primers with nucleotide sequences shown in SEQ ID NO:9 and SEQ ID NO:10; and SNP3 is amplified using primers with nucleotide sequences shown in SEQ ID NO:11 and SEQ ID NO:

12.

3. A method for enhancing the red color of the skin of the leopard-gill spiny perch, characterized in that, Includes the following steps: Individuals with superior SNP1 genotypes were selected for culturing to obtain cultured fish. The cultured fish were fed with the agonist NLRP3 agonist 1 to enhance the red color of the skin of the leopard gill spiny perch; Individuals with superior SNP1 genotypes are those with the AA genotype at the SNP1 locus. The SNP1 is the 100th position of the sequence shown in SEQ ID NO:1 or SEQ ID NO:2, and it contains an A / G mutation; the proportion of red body color in individuals with the AA genotype at the SNP1 site is significantly higher than that in individuals with the AG and GG genotypes.

4. The method according to claim 3, characterized in that, Feed the fish with agonist NLRP3 every 3-4 days at a dose of 0.2-1 mg per kilogram of body weight. The feeding cycle is ≥30 days.

5. The method according to claim 3, characterized in that, Fish were cultured for ≥180 days in a dark environment with light intensity ≤100 lux and spectral wavelength of 650-780 nm.

Citation Information

Patent Citations

  • Method for improving survival rate and growth performance of plectropomus leopardus by regulating background color

    CN117717021A

  • Method for promoting rapid removal and growth of body surface melanin of plectropomus leopardus

    CN118830503A

  • Molecular marker related to chicken skin yellowness character and application of molecular marker

    CN113913539A