Leymus mollis germination stage salt-tolerant related snp molecular marker, amplification primer and application
By developing SNP molecular markers on the 2Ns chromosome of Leymus chinensis and designing detection primers, the problems of long breeding cycle and low efficiency in Leymus chinensis breeding were solved, enabling early screening of materials with strong salt and alkali tolerance during the germination period and improving breeding efficiency.
Patent Information
- Application Number
- CN202610361287.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-24
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2046-03-24
AI Technical Summary
In existing sheepgrass breeding, the evaluation of salt and alkali tolerance mainly relies on field phenotypes, which are greatly affected by environmental factors, have long breeding cycles, low efficiency, and make it difficult to accurately screen materials with strong salt and alkali tolerance in the early germination stage.
A SNP molecular marker located at 10249086 bases on chromosome 2Ns of Leymus chinensis was developed. By designing specific detection primers and using EcoRI restriction enzyme digestion to distinguish between C and T genotypes, early genotype screening of salt and alkali tolerance in Leymus chinensis during germination can be achieved.
It significantly shortens the breeding cycle, improves selection efficiency, and enables accurate early identification of salt and alkali tolerance in Leymus chinensis during its germination period, supporting the efficient conduct of molecular breeding.
Smart Images

Figure CN121896398B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular markers, and particularly to SNP molecular markers, amplification primers, and applications related to salt and alkali tolerance during the germination period of Leymus chinensis. Background Technology
[0002] sheepgrass ( Leymus chinensis Leymus chinensis (Trin.) Tzvel., also known as alkali grass, belongs to the genus Leymus in the family Poaceae. It is a perennial rhizomatous forage grass and one of the important constituent species of meadow steppes and typical steppes in the eastern Eurasian steppe region. Leymus chinensis is characterized by high nutritional value, palatability, and strong growth stability. Its well-developed underground rhizomes have strong penetrating and spreading capabilities, effectively binding and stabilizing the soil and reducing soil erosion, playing a vital structural support role in grassland ecosystems. Furthermore, Leymus chinensis possesses excellent biological traits such as cold resistance, salt and alkali tolerance, and drought resistance, making it valuable for applications in saline-alkali land improvement, desertification control, and degraded grassland restoration. Therefore, cultivating new Leymus chinensis varieties with strong salt and alkali tolerance is of significant economic and ecological importance for improving forage production capacity in saline-alkali lands, alleviating pressure on arable land resources, and improving the grassland ecological environment.
[0003] However, in existing Leymus chinensis breeding practices, the improvement of important agronomic traits such as salt and alkali tolerance mainly relies on phenotypic evaluation in the field or in the laboratory, that is, inferring its genetic background indirectly through phenotypic traits and then making selections. This breeding method is not only greatly affected by environmental factors, but also has a long breeding cycle and low selection efficiency, which seriously restricts the breeding process of salt and alkali tolerant Leymus chinensis varieties.
[0004] Molecular marker-assisted selection (MMR) technology utilizes molecular markers closely linked to target traits to directly screen materials for genotypes, thus avoiding environmental interference. It can significantly shorten the breeding cycle and improve selection efficiency, and has been widely used in the breeding of various crops. The prerequisite for conducting MMR is obtaining molecular markers highly correlated with the target trait. Therefore, identifying molecular markers closely related to the salt tolerance of Leymus chinensis is a key foundation for achieving molecular breeding of Leymus chinensis with salt tolerance.
[0005] In the process of plant growth and development, seed germination is the starting point of its life cycle and one of the stages most sensitive to abiotic stress. Salt and alkali stress significantly affects the seed germination process by inhibiting seed respiration, disrupting cell homeostasis, and reducing metabolic activity, manifesting as delayed germination, reduced germination rate, or even germination failure. Therefore, salt and alkali tolerance during germination has become one of the important indicators for evaluating the salt and alkali tolerance of Leymus chinensis, and in actual breeding, the germination rate under salt and alkali conditions is usually used as the core evaluation parameter. However, in current breeding practices, breeders often can only obtain seeds and conduct salt and alkali tolerance evaluations after the material has completed growth, flowering, and fruiting. Due to the long growth period and relatively low fruiting rate of Leymus chinensis, the selection of salt and alkali tolerant materials during the germination period as breeding parents is significantly limited by the growth cycle, further reducing breeding efficiency.
[0006] Therefore, there is an urgent need to develop a molecular marker technology that can accurately identify the salt and alkali tolerance of Leymus chinensis during its early germination stage, so as to achieve early and efficient screening of salt and alkali tolerance traits in Leymus chinensis, thereby providing technical support for molecular breeding of Leymus chinensis with salt and alkali tolerance. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention proposes SNP molecular markers, amplification primers, and applications related to salt and alkali tolerance during the germination period of Leymus chinensis.
[0008] This invention provides a SNP molecular marker related to salt and alkali tolerance during the germination period of Leymus chinensis. The SNP molecular marker is located at the 10,249,086th base of the 2Ns chromosome of Leymus chinensis and has a polymorphism of C or T. The nucleotide sequence of the SNP molecular marker is shown in any of the following: (1) The C genotype sequence as shown in SEQ ID NO.3; (2) The sequence of the T genotype as shown in SEQ ID NO.4.
[0009] In some embodiments, the T-genotype of Leymus chinensis has a significantly higher relative germination rate in saline-alkali environments than the C-genotype.
[0010] The present invention also provides a detection primer for the SNP molecular marker described above, as shown in SEQ ID NO. 1~2.
[0011] The present invention also provides a detection kit comprising the aforementioned detection primers.
[0012] The present invention also provides the application of any one of the SNP molecular marker, the detection primer, and the detection kit in distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period.
[0013] The present invention also provides the application of any one of the SNP molecular markers, the detection primers, and the detection kits in the preparation of reagents for distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period.
[0014] The present invention also provides the application of any one of the SNP molecular markers, the detection primers, and the detection kits in the identification of salt-tolerant Leymus chinensis individuals, population selection, or maintenance of salt-tolerant Leymus chinensis strains during the germination period.
[0015] This invention also provides a method for breeding sheepgrass varieties, comprising the following steps: (1) Extract genomic DNA from individual Leymus chinensis specimens during the germination period; (2) The genomic DNA was amplified by PCR using the detection primers described above; (3) The amplification products were digested with restriction endonuclease and detected by electrophoresis to determine the genotype of the SNP molecular marker; (4) Select T-genotype sheepgrass individuals as backup parents for breeding salt-tolerant sheepgrass varieties during the germination period.
[0016] In some embodiments, the restriction endonuclease is EcoRI, and the distinction between C genotype and T genotype is achieved by EcoRI recognizing and cleaving PCR amplification products.
[0017] The present invention also provides a method for screening salt and alkali tolerance during the germination period of Leymus chinensis, including using the SNP molecular markers to identify the genotype of Leymus chinensis germplasm resources in order to predict and screen Leymus chinensis individuals or populations with strong salt and alkali tolerance.
[0018] In summary, compared with the prior art, the present invention achieves the following technical effects: (1) In this invention, a SNP locus that is significantly associated with salt tolerance during germination was identified in Leymus chinensis. Through systematic phenotypic and genotypic association analysis, the correspondence between different genotypes of the SNP locus and salt tolerance phenotypes during germination of Leymus chinensis was clarified, providing a reliable genetic basis for molecular marker-assisted breeding of salt tolerance traits of Leymus chinensis from a genetic perspective.
[0019] (2) The present invention designs and constructs detection primers with good specificity, which can effectively distinguish between C homozygous genotype and C / T heterozygous genotype at the target site. The detection process is simple, reproducible, and the results are stable, making it suitable for rapid detection under conventional molecular breeding experimental conditions.
[0020] (3) By using the molecular markers and detection methods provided by the present invention, the genotypic level of salt and alkali tolerance of materials during the germination period can be assisted in the early stage of sheepgrass breeding, thereby significantly shortening the breeding cycle and improving the breeding selection efficiency.
[0021] (4) The molecular markers, detection primers and corresponding detection kits involved in this invention can be stably applied to multiple stages such as genotyping of Leymus chinensis germplasm resources, salt-tolerant variety selection, breeding population improvement and maintenance and purification of superior lines, and have good versatility and promotion application value. Attached Figure Description
[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 This is a graph showing the SNP index results of an embodiment of the present invention.
[0024] Figure 2 The electrophoresis results for genotype identification are shown in the embodiments of the present invention.
[0025] Figure 3 This is a statistical analysis of the relative germination rates of two genotypes of Leymus chinensis in salt-alkali soil, as described in this embodiment of the invention. Detailed Implementation
[0026] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used are commercially available.
[0028] Construction and validation of molecular markers for screening salt and alkali tolerance during the germination stage of Leymus chinensis To systematically evaluate the germination tolerance of Leymus chinensis germplasm resources under saline-alkali stress and to further explore molecular markers significantly associated with saline-alkali tolerance during germination, this example selected 200 Leymus chinensis germplasm resources from the National Cold-Region Crops and Soybean Germplasm Resource Mid-Term Bank and used a petri dish germination experiment to determine their germination ability under saline-alkali conditions.
[0029] (1) Determination of germination rate of Leymus chinensis under saline-alkali stress A mixed salt-alkali solution was used to simulate the ionic composition of soda-alkali soil, applying salt-alkali stress to the seed germination process of Leymus chinensis. The mixed salt-alkali solution was prepared by mixing NaCl, Na₂SO₄, NaHCO₃, and Na₂CO₃ in a molar ratio of 1:9:9:1, with a total salt concentration of 60 mM. Distilled water treatment served as a control group.
[0030] Three control treatments and three saline-alkali treatments were set up for each sample of Leymus chinensis material, with 30 plump and uniformly sized seeds in each treatment group. The petri dishes were placed in a light incubator for germination culture under the following conditions: photoperiod 14 h / 10 h, temperature 25℃ / 16℃. On day 20 of culture, the number of germinating seeds in each treatment group was counted, and the germination rate was calculated.
[0031] The relative germination rate of a material under salt and alkali stress was obtained by dividing the average germination rate of the salt and alkali treatment group by the average germination rate of its corresponding control group, which was used to characterize its germination tolerance under salt and alkali stress conditions.
[0032] (2) Screening of salt-alkali resistant and salt-alkali sensitive materials and construction of DNA pools The relative germination rates of 200 Leymus chinensis germplasm resources in salt and alkali conditions were ranked. The 20 materials with the highest relative germination rates were selected as the salt-tolerant material group, and the 20 materials with the lowest relative germination rates were selected as the salt-sensitive material group.
[0033] Fresh leaves were collected from both types of materials for subsequent genomic DNA extraction. The DNA extraction method is as follows: Weigh 0.1 g of fresh leaves, cut them into small pieces, place them in a mortar, add liquid nitrogen and grind them into a fine powder. Then add 500 μL of 2×CTAB solution to extract genomic DNA.
[0034] The formulation of the 2×CTAB solution is as follows: 2% CTAB, 0.1% PVP40, 20mM EDTA (pH 8.0), 100mM Tris-HCl (pH 8.0), 1.4M NaCl, 1% β-mercaptoethanol.
[0035] DNA from 20 samples of the salt-tolerant group was mixed in equal amounts to construct a salt-tolerant pool, and DNA from 20 samples of the salt-sensitive group was mixed in equal amounts to construct a salt-sensitive pool. Both DNA pools were then resequencing with 30-fold genome coverage.
[0036] (3) Resequencing data analysis and candidate site mining First, the raw sequencing data were quality controlled and filtered using the FASTP software, with the filtering parameters set to the software's default settings. The filtered high-quality sequencing data were then aligned to the *Leymus chinensis* reference genome (Li et al., PNAS, 2023, PMID: 37874858) using BWA software (v0.7.17-r1188).
[0037] After alignment, bcftools software was used to detect variant sites and filter the obtained SNP sites. MutMap software was then used to analyze the sequencing data from the two pools, calculating the SNP index for each SNP site and related statistical results. Figure 1 A distinct peak was observed in the SNP index on chromosome 2Ns, suggesting that this locus may be associated with salt tolerance during the germination period of Leymus chinensis.
[0038] (4) Molecular marker primer design and PCR amplification Analysis of sequencing data from the two pools revealed that at locus 10249086 on chromosome 2Ns, the salt-tolerant pool was predominantly C / T heterozygous, while the salt-sensitive pool was C. A pair of primers was designed based on the sequences near this locus, and their sequences are as follows: Forward primer: SEQ ID NO.1; Reverse primer: SEQ ID NO.2.
[0039] The above primers were used to amplify 200 Leymus chinensis germplasm resources by PCR. The PCR reaction system was as follows: DNA template: 0.5 μL; forward primer: 0.2 μL; reverse primer: 0.2 μL; 2×Rapid Taq Master Mix (Novozymes, catalog number P222-01): 5 μL; ddH2O: 4.1 μL, and the total reaction volume was 10 μL.
[0040] The PCR reaction program was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 54°C for 15 seconds, extension at 72°C for 15 seconds, for 35 cycles; final extension at 72°C for 5 minutes. PCR amplification products can be stored at 4°C.
[0041] (5) Restriction endonuclease digestion and genotyping The amplification product sequence of homozygous Leymus chinensis is as follows: CAAGTTTGGAGCTCTAGAAAATTAGTTCTCCTTCTGTTGCAAATAGGTACATATTTCCAGCTGTCCGGTAATTTCCCTCTGTGTGTATACCTTGCAATTTAAGAGAGAAAAGGCATTAGAATTGCATCGTAATGTG (SEQ ID NO. 3).
[0042] The amplification product sequence of heterozygous Leymus chinensis is as follows: CAAGTTTGGAGCTCTAGAAAATTAGTTTTCCTTCTGTTGCAAATAGGTACATATTTCCAGCTGTCCGGTAATTTCCCTCTGTGTGTATACCTTGCAATTTAAGAGAGAAAAGGCATTAGAATTGCATCGTAATGTG (SEQ ID NO. 4).
[0043] Add 0.2 μL of restriction endonuclease EcoRI (NEB, catalog number R3101S) to the PCR amplification product, mix well, and digest at 37°C for 8-16 hours. Perform agarose gel electrophoresis on the reaction product.
[0044] The results showed that the PCR amplification product of homozygous Leymus chinensis lacked the EcoRI recognition site and could not be digested, resulting in an electrophoretic band of 136 bp. In contrast, approximately half of the PCR amplification product of heterozygous Leymus chinensis could be digested by EcoRI into 25 bp and 111 bp bands. Since the 25 bp fragment is difficult to distinguish on agarose gel, the electrophoretic result of heterozygous Leymus chinensis showed two bands of 136 bp and 111 bp. Figure 2 ).
[0045] Statistical analysis of the relative germination rates of salt and alkali in different genotypes of Leymus chinensis showed that there were significant differences in the relative germination rates of salt and alkali between the two genotypes. Figure 3 The above results indicate that the molecular markers constructed in this embodiment can effectively distinguish between salt-tolerant and salt-sensitive materials during the germination period of Leymus chinensis, and can be used for molecular-assisted screening of salt tolerance during the germination period of Leymus chinensis.
[0046] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0047] sequence list SEQ ID NO.1 CAAGTTTGGAGCTCTAGAAAATTAGAATT SEQ ID NO.2 CACATTACGATGCAATTCTAATGCC SEQ ID NO.3 CAAGTTTGGAGCTCTAGAAAATTAGTTCTCCTTCTGTTGCAAATAGGTACATATTTCCAGCTGTCCGGTAATTTCCCTCTGTGTGTATACCTTGCAATTTAAGAGAGAAAAGGCATTAGAATTGCATCGTAATGTG SEQ ID NO.4 CAAGTTTGGAGCTCTAGAAAATTAGTTTTCCTTCTGTTGCAAATAGGTACATATTTCCAGCTGTCCGGTAATTTCCCTCTGTGTATACCTTGCAATTTAAGAGAGAAAAGGCATTAGAATTGCATCGTAATGTG。
Claims
1. The application of a primer for detecting a SNP molecular marker related to salt and alkali tolerance during the germination period of Leymus chinensis in any of the following: (a) Application in the identification of salt-tolerant Leymus chinensis individuals, population selection, or maintenance of salt-tolerant Leymus chinensis strains during the germination period; (b) Application in distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period; (c) Application in the preparation of reagents for distinguishing salt and alkali tolerance during the germination period of Leymus chinensis; The SNP molecular marker is located at position 28 of the nucleotide shown in SEQ ID NO.3 and exhibits C / T polymorphism; The nucleotide sequence of the SNP molecular marker is shown in any of the following: (1) The C genotype sequence as shown in SEQ ID NO.3; (2) The sequence of the T genotype as shown in SEQ ID NO.4; The detection primers are shown in SEQ ID NO. 1~2; The T-genotype of Leymus chinensis exhibits a significantly higher relative germination rate in saline-alkali environments than the C-genotype.
2. A method for breeding a variety of sheepgrass, characterized in that, Includes the following steps: (1) Extract genomic DNA from individual Leymus chinensis specimens during the germination period; (2) The genomic DNA was amplified by PCR using detection primers; (3) The amplification products were digested with restriction endonucleases and detected by electrophoresis to determine the genotype of the SNP molecular marker; (4) Select T-genotype Leymus chinensis individuals as backup parents for breeding salt-tolerant Leymus chinensis varieties during the germination period; The SNP molecular marker is located at position 28 of the nucleotide shown in SEQ ID NO.3 and exhibits C / T polymorphism; The nucleotide sequence of the SNP molecular marker is shown in any of the following: (1) The C genotype sequence as shown in SEQ ID NO.3; (2) The sequence of the T genotype as shown in SEQ ID NO.4; The T-genotype of Leymus chinensis exhibits a significantly higher relative germination rate in saline-alkali environments than the C-genotype.
3. The breeding method according to claim 2, characterized in that, The restriction endonuclease is EcoRI, which is used to distinguish between the C genotype and the T genotype by recognizing and cleaving the PCR amplification product.
4. A method for screening salt and alkali tolerance during the germination period of Leymus chinensis, characterized in that, This includes using SNP molecular markers to identify the genotype of Leymus chinensis germplasm resources in order to predict and screen Leymus chinensis individuals or populations with strong salt and alkali tolerance. The SNP molecular marker is located at position 28 of the nucleotide shown in SEQ ID NO.3 and exhibits C / T polymorphism; The nucleotide sequence of the SNP molecular marker is shown in any of the following: (1) The C genotype sequence as shown in SEQ ID NO.3; (2) The sequence of the T genotype as shown in SEQ ID NO.4; The T-genotype of Leymus chinensis exhibits a significantly higher relative germination rate in saline-alkali environments than the C-genotype.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to saline-alkaline resistance of leymus chinensis in germination period, amplification primer and application of SNP molecular marker
CN120843732A
Indel molecular marker related to salt tolerance of rape and application of Indel molecular marker
CN121428157A