A reagent and kit for joint detection of four avian RNA viruses

By designing primer and probe combinations suitable for fluorescent multiplex quantitative PCR, rapid and accurate joint detection of H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus was achieved. This solves the problems of cumbersome detection, long cycle, and limited detection range in existing technologies, and has high sensitivity and specificity, making it suitable for rapid screening of biological products.

CN121896401BActive Publication Date: 2026-06-05SUZHOU LIANGCHEN BIOMEDICAL TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SUZHOU LIANGCHEN BIOMEDICAL TECH CO LTD
Filing Date
2026-03-24
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies for detecting avian RNA viruses are cumbersome, time-consuming, prone to errors, and have a limited detection range. Traditional PCR methods suffer from insufficient specificity and sensitivity, making it difficult to achieve joint detection of multiple avian RNA viruses.

Method used

Design primer and probe combinations suitable for fluorescence multiplex quantitative PCR, including specific upstream and downstream primers and fluorescent probes, for the simultaneous detection of H5N1, H7N9, avian paramyxovirus type IX and West Nile virus, to achieve rapid and accurate joint detection through multiplex fluorescence quantitative PCR reaction.

Benefits of technology

It enables single-tube, single-amplification detection of four avian RNA viruses, exhibiting high sensitivity, strong specificity, and good repeatability. It is suitable for large-scale sample screening of biological products and reduces the risk of exogenous nucleic acid contamination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896401B_ABST
    Figure CN121896401B_ABST
Patent Text Reader

Abstract

The application provides a reagent and kit for jointly detecting four kinds of avian RNA viruses. The reagent of the application comprises an upstream primer, a downstream primer and a probe for detecting H5N1, H7N9, avian parainfluenza virus type IX and West Nile virus. Through specific primer and probe sequences, H5N1, H7N9, avian parainfluenza virus type IX and West Nile virus in biological products can be simultaneously detected in one tube reaction through only one amplification, and the detection reagent or kit of the application has the advantages of high sensitivity, strong specificity, good repeatability and the like for the four kinds of avian RNA viruses, and has no interference and no cross reaction among each other, and can rapidly detect a large number of samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological product virus detection technology, specifically relating to a reagent and kit for the combined detection of four avian RNA viruses. Background Technology

[0002] Biological products are products prepared using traditional or modern biotechnology from microorganisms, cells, animal or human tissues and body fluids as raw materials for the prevention, treatment, or diagnosis of human diseases. Due to the diverse sources and complex composition of raw materials, biological products are susceptible to contamination by exogenous viruses during production, and many products cannot be terminally sterilized due to their compositional characteristics. Therefore, strict safety and quality control must be implemented at every stage of production, with the safety control of raw materials being particularly critical and directly affecting the safety of the final product. Virus detection is one of the core aspects of safety and quality control for biological products.

[0003] Avian viruses are a crucial indicator for evaluating the viral safety of biological products. In routine safety assessments, traditional detection methods such as cell experiments and animal antibody production experiments are still widely used. However, these methods typically suffer from limitations such as cumbersome operation, long cycles, significant errors, and high costs. Furthermore, existing detection technologies often have a limited scope. To cover multiple avian viruses, such as avian influenza virus, Newcastle disease virus, and West Nile virus, each virus must be tested individually, further extending the overall cycle. Meanwhile, conventional PCR qualitative detection methods, whether using the SYBR Green method with fluorescent dyes or agarose gel electrophoresis, suffer from deficiencies in specificity and sensitivity. When detecting RNA viruses, RNA must be reverse transcribed into cDNA before PCR amplification. These multiple steps not only increase experimental complexity but also significantly raise the risk of exogenous nucleic acid contamination.

[0004] In contrast, quantitative real-time PCR (qPCR) technology offers advantages such as short detection cycles, low risk of contamination, high sensitivity, and strong specificity, leading to its increasing adoption in this field. However, the real-time accuracy of this technology for specific viruses is highly dependent on the design quality of the selected primers and probes. To achieve the joint detection of multiple avian viruses, it is essential to ensure high sensitivity and accuracy for all target viruses. Therefore, developing primer and probe combinations suitable for the joint detection of multiple avian RNA viruses has become a key focus of current research. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent and kit for the rapid and accurate combined detection of four avian RNA viruses.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a reagent for the joint detection of four avian RNA viruses, the reagent comprising an upstream primer, a downstream primer, and a probe for detecting H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus.

[0008] The sequence of the upstream primer used to detect H5N1 is 5'-GCATTCACAGAAAGTGGTG-3' or its complementary sequence, the sequence of the downstream primer used to detect H5N1 is 5'-ACGCTCGAATTGAGTTATCA-3' or its complementary sequence, and the sequence of the probe used to detect H5N1 is 5'-GACATTTTACAGAGGATGTC-3' or its complementary sequence.

[0009] The sequence of the upstream primer used to detect H7N9 is 5'-GTCGACATAAACCCGGGCCAT-3' or its complementary sequence, the sequence of the downstream primer used to detect H7N9 is 5'-TCCTTGGTAATCGTTAACTGTGA-3' or its complementary sequence, and the sequence of the probe used to detect H7N9 is 5'-TATTCCCAAACGAAGTTGGAG-3' or its complementary sequence.

[0010] The sequence of the upstream primer used to detect avian paramyxovirus IX is 5'-TCAGACCTGGCTCTCAGACTG-3' or its complementary sequence. The sequence of the downstream primer used to detect avian paramyxovirus IX is 5'-AACCGCTGCGGACGATAAGATGA-3' or its complementary sequence. The sequence of the probe used to detect avian paramyxovirus IX is 5'-TAGGTACAATAATACCTGCCCTG-3' or its complementary sequence.

[0011] The sequence of the upstream primer used for detecting West Nile virus is 5'-GAAGCATCTCTTGAGTT-3' or its complementary sequence; the sequence of the downstream primer used for detecting West Nile virus is 5'-TTGTTTTGAGCTCCGC-3' or its complementary sequence; and the sequence of the probe used for detecting West Nile virus is 5'-TCAAGAAAGAACTA-3' or its complementary sequence.

[0012] In some preferred embodiments, the sequence of the upstream primer used to detect H5N1 is 5'-GCATTCACAGAAAGTGGTG-3', the sequence of the downstream primer used to detect H5N1 is 5'-ACGCTCGAATTGAGTTATCA-3', and the sequence of the probe used to detect H5N1 is 5'-GACATTTTACAGAGGATGTC-3'.

[0013] In some preferred embodiments, the sequence of the upstream primer used to detect H7N9 is 5'-GTCGACATAAACCCGGGCCAT-3', the sequence of the downstream primer used to detect H7N9 is 5'-TCCTTGGTAATCGTTAACTGTGA-3', and the sequence of the probe used to detect H7N9 is 5'-TATTCCCAAACGAAGTTGGAG-3'.

[0014] In some preferred embodiments, the sequence of the upstream primer for detecting avian paramyxovirus IX is 5'-TCAGACCTGGCTCTCAGACTG-3', the sequence of the downstream primer for detecting avian paramyxovirus IX is 5'-AACCGCTGCGGACGATAAGATGA-3', and the sequence of the probe for detecting avian paramyxovirus IX is 5'-TAGGTACAATAATACCTGCCCTG-3'.

[0015] In some preferred embodiments, the sequence of the upstream primer for detecting West Nile virus is 5'-GAAGCATCTCTTGAGTT-3', the sequence of the downstream primer for detecting West Nile virus is 5'-TTGTTTTGAGCTCCGC-3', and the sequence of the probe for detecting West Nile virus is 5'-TCAAGAAAGAACTA-3'.

[0016] In a specific embodiment, one end of the probe sequence is labeled with a fluorescent group and the other end is labeled with a quenching group, and the fluorescent groups labeled with each probe sequence are different.

[0017] In some preferred embodiments, the fluorescent group is selected from FAM, VIC, TAMRA, ROX and CY5, and the quenching group is selected from BHQ1, BHQ2 and BHQ3.

[0018] According to some specific and preferred embodiments, the probe for H5N1 is connected to the 5' end with a fluorescent group FAM and the 3' end with a quencher group BHQ1; the probe for H7N9 is connected to the 5' end with a fluorescent group ROX and the 3' end with a quencher group BHQ2; the probe for avian paramyxovirus IX is connected to the 5' end with a fluorescent group VIC and the 3' end with a quencher group BHQ1; and the probe for West Nile virus is connected to the 5' end with a fluorescent group TAMRA and the 3' end with a quencher group BHQ2.

[0019] In some embodiments, the reagent further includes enzyme-free water for dissolving the upstream primer, downstream primer, and probe.

[0020] In some preferred embodiments, the reagent can be obtained by mixing and dissolving the upstream primer, downstream primer, and probe used for detecting H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus in enzyme-free water.

[0021] In some preferred embodiments, the concentrations of the upstream and downstream primers used for detecting H5N1, H7N9, avian paramyxovirus IX, and West Nile virus are 5–15 μM, for example, 5 μM, 5.5 μM, 6 μM, 6.5 μM, 7 μM, 7.5 μM, 8 μM, 8.5 μM, 9 μM, 9.5 μM, 10 μM, 10.5 μM, 11 μM, 11.5 μM, 12 μM, 12.5 μM, 13 μM, 13.5 μM, 14 μM, 14.5 μM, or 15 μM. More preferably, the concentrations are 8–12 μM.

[0022] In some preferred embodiments, the concentrations of the probes used to detect H5N1, H7N9, avian paramyxovirus IX, and West Nile virus are 1–10 μM, for example, 1 μM, 1.5 μM, 2 μM, 2.5 μM, 3 μM, 3.5 μM, 4 μM, 4.5 μM, 5 μM, 5.5 μM, 6 μM, 6.5 μM, 7 μM, 7.5 μM, 8 μM, 8.5 μM, 9 μM, 9.5 μM, or 10 μM. More preferably, the concentrations are 4–6 μM.

[0023] A second aspect of the present invention provides a kit for the combined detection of four avian RNA viruses, the kit comprising the reagents described above for the combined detection of four avian RNA viruses.

[0024] In some embodiments, the kit further includes nucleic acid standards for H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus.

[0025] The sequence of the H5N1 nucleic acid standard is as follows:

[0026] GCATTCACAGAAAGTGGTGCTATTGTGGCTGAAATATTTCCCATTCCCTCCGTACCAGGACATTTTACAGAGGATGTCAAAAATGCAATTGGAATCCTCATCGGTGGACTTGAATGGAATGATAACTCAATTCGAGCGT.

[0027] The sequence of the H7N9 nucleic acid standard is as follows:

[0028] GTCGACATAAACCCGGGCCATGCAGATTTAGTGCTAAAGAAGCACAGGATGTCATCATGGAGGTCGTATTCCCAAACGAAGTTGGAGCCAGAATATTGACATCAGAGTCACAGTTAACGATTACCAAGGA.

[0029] The sequence of the avian paramyxovirus IX nucleic acid standard is as follows:

[0030] TCAGACCTGGCTCTCAGACTGATCTGCTCCAGTCTGAGAAGTACGCGATATATCGTAGGTACAATAATACCTGCCCTGATAATAATCCCACCCAGATTGAGCGGGCCAAATCATCTTATCGTCCGCAGCGGTT.

[0031] The sequence of the West Nile virus nucleic acid standard is as follows:

[0032] GAAGCATCTCTTGAGTTTCAAGAAAGAACTAGGAACCCTGACCAGCGCCATCAACCGGCGGAGCTCAAAACAA.

[0033] Preferably, the nucleic acid standards for H5N1, H7N9, avian paramyxovirus IX, and West Nile virus are packaged separately.

[0034] Specifically, the kit also includes PCR reaction solution, Taq DNA polymerase, and reverse transcriptase.

[0035] A third aspect of this invention also provides a method for the combined detection of H5N1, H7N9, avian paramyxovirus IX, and West Nile virus in biological products. Using RNA from the biological product to be tested as a template, a multiplex quantitative real-time PCR reaction is performed using either the reagent or kit described above for the combined detection of the four avian RNA viruses. Fluorescence signals are collected to determine the content of H5N1, H7N9, avian paramyxovirus IX, and West Nile virus in the biological product to be tested.

[0036] Specifically, the method for joint detection of H5N1, H7N9, avian paramyxovirus IX, and West Nile virus in biological products includes the following steps:

[0037] 1) Extracting nucleic acids from samples of biological products to be tested;

[0038] 2) Using the nucleic acid from step 1) as a template, perform multiplex fluorescent PCR amplification using the kit described above for the joint detection of four avian RNA viruses, and collect the fluorescence signal;

[0039] 3) Determine whether the biological product sample to be tested contains avian RNA viruses (H5N1, H7N9, avian paramyxovirus type IX, West Nile virus) based on the fluorescence signal.

[0040] The above methods are used for the diagnosis and treatment of non-disease-related conditions.

[0041] Preferably, the multiplex fluorescent PCR amplification reaction system in step 2) is shown in Table 1:

[0042]

[0043] In some embodiments, the reaction procedure for the multiplex quantitative PCR reaction is as follows:

[0044] 39~42℃ for 8~12 minutes;

[0045] 94~96℃ for 20~30 seconds;

[0046] 95~97℃ for 5~10 seconds, 58~62℃ for 25~35 seconds, repeat 38~42 times.

[0047] More preferably, the reaction procedure for the multiplex quantitative PCR reaction is as follows:

[0048] 39~41℃, 9~11min;

[0049] 94~96℃ for 24~26 seconds;

[0050] 95~97℃ for 7~9 seconds, 60~62℃ for 28~32 seconds, repeat 38~42 times.

[0051] According to some specific implementation methods, the reaction procedure for the multiplex quantitative PCR reaction is as follows:

[0052] 40℃ for 10 minutes;

[0053] 95℃ for 25 seconds;

[0054] 96℃ for 8 seconds, 61℃ for 30 seconds, repeat 40 times.

[0055] According to some specific implementation methods, the probe for H5N1 is connected to the 5' end with a fluorescent group FAM and the 3' end with a quencher group BHQ1; the probe for H7N9 is connected to the 5' end with a fluorescent group ROX and the 3' end with a quencher group BHQ2; the probe for avian paramyxovirus type IX is connected to the 5' end with a fluorescent group VIC and the 3' end with a quencher group BHQ1; and the probe for West Nile virus is connected to the 5' end with a fluorescent group TAMRA and the 3' end with a quencher group BHQ2.

[0056] Taking the above specific implementation method as an example, the result determination method after multiplex quantitative PCR reaction is as follows: Based on the validity of the experiment, if the test result of the biological product sample is ≤35 in the FAM channel and has an amplification curve, it is judged to be positive for H5N1 nucleic acid; if the Ct value is ≤35 in the ROX channel and has an amplification curve, it is judged to be positive for H7N9 nucleic acid; if the Ct value is ≤35 in the VIC channel and has an amplification curve, it is judged to be positive for avian paramyxovirus type IX nucleic acid; if the Ct value is ≤35 in the TAMRA channel and has an amplification curve, it is judged to be positive for West Nile virus nucleic acid; if there is no Ct value or the Ct value is >38 in all four channels, the corresponding virus is judged to be negative; if the test result of the biological product sample is 35 < Ct value ≤38 in any channel, the sample should be re-extracted for nucleic acid and tested again. If the repeated test result has no Ct value, it is negative; otherwise, it is positive.

[0057] Compared with the prior art, the present invention has the following advantages:

[0058] This invention designs primer and probe combinations suitable for fluorescent multiplex quantitative PCR reactions targeting H5N1, H7N9, avian paramyxovirus IX, and West Nile virus, and develops corresponding reagents and kits for the joint detection of these four avian RNA viruses. It also establishes a method for simultaneously detecting whether bioproducts are contaminated with these four avian RNA viruses. Based on the detection reagents or kits of this invention, only a single tube and a single amplification reaction are required to achieve the joint detection of four target avian RNA viruses or their pathogens. The detection reagents or kits of this invention have the advantages of high sensitivity, strong specificity, and good repeatability, and there is no cross-reactivity between the virus detection channels, making them suitable for rapid screening of large-scale samples in bioproducts. Attached Figure Description

[0059] Figure 1 This is a schematic diagram of the H5N1 amplification curve of the FAM channel in Example 1 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0060] Figure 2 This is a schematic diagram of the H5N1 amplification curve of the FAM channel in Example 1 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 5 Copy number / μL, 2×10 3 Copy number / μL, 2×10 1 Copy number / μL, 2×10 0 (copy number / μL)

[0061] Figure 3 This is a schematic diagram of the H7N9 amplification curve of the ROX channel in Example 1 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0062] Figure 4 This is a schematic diagram of the H7N9 amplification curve of the ROX channel in Example 1 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 5 Copy number / μL, 2×10 3 Copy number / μL, 2×10 1 Copy number / μL, 2×10 0 (copy number / μL)

[0063] Figure 5 This is a schematic diagram of the amplification curve of avian paramyxovirus type IX in the VIC channel in Example 1 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0064] Figure 6This is a schematic diagram of the amplification curve of avian paramyxovirus type IX in the VIC channel in Example 1 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 5 Copy number / μL, 2×10 3 Copy number / μL, 2×10 1 Copy number / μL, 2×10 0 (copy number / μL)

[0065] Figure 7 This is a schematic diagram of the West Nile virus amplification curve of the TAMRA channel in Example 1 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0066] Figure 8 This is a schematic diagram of the West Nile virus amplification curve of the TAMRA channel in Example 1 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 5 Copy number / μL, 2×10 3 Copy number / μL, 2×10 1 Copy number / μL, 2×10 0 (copy number / μL)

[0067] Figure 9 This is a schematic diagram of the amplification curves of the positive and negative reference samples in Example 1;

[0068] Figure 10 This is a schematic diagram of the H5N1 amplification curve of the FAM channel in Comparative Example 1 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0069] Figure 11 This is a schematic diagram of the H7N9 amplification curve of the ROX channel in Comparative Example 1 (the concentration of the nucleic acid standard is 2×10⁻⁶).7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0070] Figure 12 This is a schematic diagram of the amplification curve of avian paramyxovirus type IX in the VIC channel of Comparative Example 1 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0071] Figure 13 This is a schematic diagram of the West Nile virus amplification curve of the TAMRA channel in Comparative Example 1 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0072] Figure 14 This is a schematic diagram of the H5N1 amplification curve of the FAM channel in Comparative Example 2 (the concentration of the nucleic acid standard is 2 × 10⁻⁶). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0073] Figure 15 This is a schematic diagram of the H7N9 amplification curve of the ROX channel in Comparative Example 2 (the concentration of nucleic acid standard is 2×10).7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0074] Figure 16 This is a schematic diagram of the amplification curve of avian paramyxovirus type IX in the VIC channel in Comparative Example 2 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0075] Figure 17 This is a schematic diagram of the West Nile virus amplification curve of the TAMRA channel in Comparative Example 2 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0076] Figure 18 This is a schematic diagram of the H5N1 amplification curve of the FAM channel in Comparative Example 3 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0077] Figure 19 This is a schematic diagram of the H7N9 amplification curve of the ROX channel in Comparative Example 3 (the concentration of the nucleic acid standard is 2×10⁻⁶).7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0078] Figure 20 This is a schematic diagram of the amplification curve of avian paramyxovirus type IX in the VIC channel of Comparative Example 3 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0079] Figure 21 This is a schematic diagram of the West Nile virus amplification curve of the TAMRA channel in Comparative Example 3 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0080] Figure 22 This is a schematic diagram of the H5N1 amplification curve of the FAM channel in Comparative Example 4 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0081] Figure 23 This is a schematic diagram of the H7N9 amplification curve of the ROX channel in Comparative Example 4 (the concentration of the nucleic acid standard is 2×10⁻⁶).7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0082] Figure 24 This is a schematic diagram of the amplification curve of avian paramyxovirus type IX in the VIC channel of Comparative Example 4 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0083] Figure 25 This is a schematic diagram of the West Nile virus amplification curve of the TAMRA channel in Comparative Example 4 (the concentration of nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 (copy number / μL)

[0084] Figure 26 This is a schematic diagram of the amplification curves of the test sample and H5N1 nucleic acid standard detected by the FAM channel in Example 2 (the concentration of the nucleic acid standard is 2×10). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 (copy number / μL)

[0085] Figure 27 This is a schematic diagram of the amplification curves of the test sample and H7N9 nucleic acid standard detected by the ROX channel in Example 2 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×106 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 (copy number / μL)

[0086] Figure 28 This is a schematic diagram of the amplification curves of the test sample and the avian paramyxovirus type IX nucleic acid standard detected by the VIC channel in Example 2 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 (copy number / μL)

[0087] Figure 29 This is a schematic diagram of the amplification curves of the test sample and West Nile virus nucleic acid standard detected by the TAMRA channel in Example 2 (the concentration of the nucleic acid standard is 2×10⁻⁶). 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 (copy number / μL). Detailed Implementation

[0088] The present invention will be further described below with reference to embodiments. However, the present invention is not limited to the following embodiments. The implementation conditions used in the embodiments can be further adjusted according to different requirements of specific applications, and the implementation conditions not specified are conventional conditions in the industry. The technical features involved in the various embodiments of the present invention can be combined with each other as long as they do not conflict with each other.

[0089] Example 1: This example provides a kit for the combined detection of four avian RNA viruses, including reagents containing primers and probes, nucleic acid standards, PCR reaction solution, Taq DNA polymerase and reverse transcriptase.

[0090] The reagents containing primers and probes were prepared by dissolving artificially synthesized primers and probes in enzyme-free water and stored at -20°C. The specific sequences of the upstream primers, downstream primers, and probes used for detecting H5N1, H7N9, avian paramyxovirus IX, and West Nile virus are shown in Table 2.

[0091]

[0092] The upstream and downstream primers used for detecting H5N1, H7N9, avian paramyxovirus IX, and West Nile virus were at concentrations of 10 μM, and the probes used for detecting H5N1, H7N9, avian paramyxovirus IX, and West Nile virus were at concentrations of 5 μM.

[0093] The nucleic acid standards are a mixture of artificially synthesized H5N1 nucleic acid fragments, H7N9 nucleic acid fragments, avian paramyxovirus type IX nucleic acid fragments, and West Nile virus nucleic acid fragments, and are stored at -20°C for later use. Specific sequences are shown in Table 3.

[0094]

[0095] The PCR reaction solution was the qPCR premix solution (BeyoFast) from Shanghai Beyotime Biotechnology Co., Ltd. TM ProbeqPCR Mix (2×)).

[0096] Taq DNA polymerase (5 U / μL) is the Taq DNA polymerase (DreamTaq DNA Polymerase (5 U / μL)) from Thermo Fisher Scientific.

[0097] The reverse transcriptase used was Thermo Fisher Scientific's SuperScript™ IV One-Step RT-PCR System.

[0098] A standard curve was prepared using the above-mentioned reagent kit.

[0099] 1) Dilute the above nucleic acid standards to 2×10⁻⁶. 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Copy number / μL, 2×10 2 Copy number / μL, 2×10 1 Copy number / μL, 2×10 0 Copy number / μL, to prepare templates of different concentrations;

[0100] The positive control was 2×10 6 Copy number / μL of standard premixed solution, negative control is enzyme-free sterile water (RNase / DNase free water).

[0101] 2) Preparation of multiplex PCR reaction system:

[0102] PCR reaction system (20μL): 10μL 2×qPCR reaction solution; 1μL Taq DNA polymerase; 0.5μL reverse transcriptase; 0.5μL primer and probe reagents; 5μL template; enzyme-free sterile water to 20μL.

[0103] PCR reaction conditions: 40℃ for 10 min; 95℃ for 25 sec; 96℃ for 8 sec; 61℃ for 30 sec, for 40 cycles. Fluorescence signal was detected during annealing and extension at 61℃ to obtain amplification curves for each concentration of standard. Each concentration of standard was subjected to a multiplex PCR reaction three times, with three replicates per test.

[0104] According to the amplification curve ( Figure 1 , Figure 3 , Figure 5 , Figure 7 A standard curve was constructed with the Cq value obtained for each standard concentration as the ordinate and the logarithm of the standard copy number as the abscissa. The lowest concentration (2×10⁻⁶) was calculated from this curve. 1 The detection accuracy is measured in copies / μL. The Cq value is the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold, which is automatically generated by the instrument. The corresponding standard curves are summarized in Table 4.

[0105]

[0106] In this embodiment, the nucleic acid standard is 2×10 1 ~2×10 7 Within the range of copy number / μL concentration, the linear relationship of the four viruses was very good, and the detection accuracy was relatively high.

[0107] 5) Based on the amplification curve ( Figure 2 , Figure 4 , Figure 6 , Figure 8 ), select high (2×10) 7 Copy number / μL), medium (2×10) 5 Copy number / μL), low (2×10) 3 For three concentrations (copy number / μL), calculate the RSD of the measurement result for each concentration; select 2×10 1 Copy number / μL and 2×10 0 The copy number / μL was used as the detection limit, with total detection being the limit of detection. The corresponding data results are summarized in Table 5.

[0108]

[0109] In this embodiment, the nucleic acid standards for the four viruses all showed good repeatability and high sensitivity.

[0110] 6) Based on the amplification curve ( Figure 9 In this embodiment, the four virus detection methods showed good specificity, and no false positives were observed.

[0111] Comparative Example 1: This comparative example provides a kit for the combined detection of four avian RNA viruses. It is essentially the same as Example 1, except that the primer and probe sequences, as well as the nucleic acid standard sequences, are different, as detailed in Tables 6 and 7. The primer and probe sequences shown in Table 6 and the nucleic acid standard sequences shown in Table 7 are designed based on the same viral gene sequences as those in Example 1.

[0112]

[0113]

[0114] Multiplex PCR reactions were performed as described in Example 1, and the amplification curves for the four viruses are shown below. Figures 10-13 The standard curve and detection limit are statistically shown in Table 8.

[0115]

[0116] As shown in Table 8, the linear relationship and amplification efficiency of H5N1 in this comparative example met the requirements; however, the linear relationship and amplification efficiency of H7N9 were poor, especially for 2×10⁻⁶ cells. 5 Concentrations below copy number / μL cannot be stably detected; for avian paramyxovirus type IX, the linear relationship and amplification efficiency are good, but non-specific amplification exists, and false positives occur in the negative control; for West Nile virus detection, the linear relationship is poor and the amplification efficiency is low, especially at concentrations of 2×10⁻⁶. 3 Concentrations below copy number / μL cannot be stably detected; this comparative sample is not suitable as a kit for the combined detection of four avian RNA viruses.

[0117] Comparative Example 2: This comparative example provides a kit for the combined detection of four avian RNA viruses. It is basically the same as Example 1, except that the sequences of the primers and probes are different, as are the sequences of the nucleic acid standards, as shown in Tables 9 and 10. The sequences of the primers and probes shown in Table 9 and the sequences of the nucleic acid standards shown in Table 10 are designed based on the same viral gene sequences as the primers and probes in Example 1.

[0118]

[0119]

[0120] Multiplex PCR reactions were performed as described in Example 1, and the amplification curves for the four viruses are shown below. Figures 14-17 The standard curve and detection limit are statistically shown in Table 11.

[0121]

[0122] As shown in Table 11, this comparative example exhibited poor linearity and low amplification efficiency when detecting H5N1, particularly for 2×10⁻⁶ samples. 4 Concentrations below copy number / μL cannot be stably detected; for H7N9 detection, the linear relationship is good, but the amplification efficiency is low, especially for 2×10⁻⁶ μL. 3 Concentrations below copy number / μL cannot be stably detected; for avian paramyxovirus IX, the linear relationship is poor and the amplification efficiency is low, especially at concentrations of 2×10⁻⁶. 2 Concentrations below copy number / μL cannot be stably detected; no specific amplification curve was observed for West Nile virus detection; this comparative sample is not suitable as a kit for the combined detection of four avian RNA viruses.

[0123] Comparative Example 3: This comparative example provides a kit for the combined detection of four avian RNA viruses. It is basically the same as Example 1, except that the sequences of the primers and probes are different, as are the sequences of the nucleic acid standards, as shown in Tables 12 and 13. The sequences of the primers and probes shown in Table 12 and the sequences of the nucleic acid standards shown in Table 13 are designed based on the same viral gene sequences as the primers and probes in Example 1.

[0124]

[0125]

[0126] Multiplex PCR reactions were performed as described in Example 1, and the amplification curves for the four viruses are shown below. Figures 18-21 The standard curve and detection limit are statistically shown in Table 14.

[0127]

[0128] As shown in Table 14, this comparative example showed good linearity but low amplification efficiency when detecting H5N1, particularly for 2×10⁻⁶ cells. 3 Concentrations below copy number / μL cannot be stably detected; no specific amplification curve is found for H7N9 detection; avian paramyxovirus IX detection shows poor linearity and low amplification efficiency, especially at concentrations of 2×10⁻⁶. 2 Concentrations below copy number / μL cannot be stably detected; when detecting West Nile virus, the linear relationship is poor, the amplification efficiency is low, and there is no specific amplification curve; this comparative sample is not suitable as a kit for the joint detection of four avian RNA viruses.

[0129] Comparative Example 4: This comparative example provides a kit for the combined detection of four avian RNA viruses. It is basically the same as Example 1, except that the sequences of the primers and probes are different, as are the sequences of the nucleic acid standards, as shown in Tables 15 and 16. The sequences of the primers and probes shown in Table 15 and the sequences of the nucleic acid standards shown in Table 16 are designed based on the same viral gene sequences as the primers and probes in Example 1.

[0130]

[0131]

[0132] Multiplex PCR reactions were performed as described in Example 1, and the amplification curves for the four viruses are shown below. Figures 22-25 The standard curve and detection limit are statistically shown in Table 17.

[0133]

[0134] As shown in Table 17, this comparative example exhibited poor linearity and low amplification efficiency when detecting H5N1, particularly for 2×10⁻⁶ samples. 2 Concentrations below copy number / μL cannot be stably detected; for H7N9 detection, the linear relationship is poor and the amplification efficiency is low, especially at 2×10⁻⁶ μL. 2 Concentrations below copy number / μL cannot be stably detected; for avian paramyxovirus IX, the linear relationship is poor and the amplification efficiency is low, especially at concentrations of 2×10⁻⁶. 2 Concentrations below copy number / μL cannot be stably detected; for West Nile virus detection, the linear relationship is good, but the amplification efficiency is low, especially at concentrations of 2×10⁻⁶. 4 Concentrations below copy number / μL cannot be stably detected and non-specific amplification occurs; false positives are observed in the negative control. This comparative method is not suitable as a kit for the joint detection of four avian RNA viruses.

[0135] Example 2: This example provides a validation method for the combined detection of four avian RNA viruses in biological products.

[0136] This embodiment uses Vero cell culture medium contaminated with H5N1, H7N9, avian paramyxovirus IX, and West Nile virus for verification, and includes the following steps:

[0137] Total RNA extraction from the test biological product: Transfer 500 μL of concentrated Vero cell culture medium (with artificially added H5N1, H7N9, avian paramyxovirus IX, and West Nile virus standards) to a 1.5 mL centrifuge tube. Add 500 μL of total RNA extraction reagent (Trizol reagent) and mix thoroughly. Incubate at room temperature for 10 minutes. After incubation, add 200 μL of chloroform and vortex for 30 seconds to mix thoroughly. Centrifuge at 4°C and 13,000 rpm for 15 minutes. Transfer the supernatant to a clean centrifuge tube. Add an equal volume of isopropanol, gently invert the tube to mix thoroughly, and incubate at room temperature for 10 minutes. Centrifuge at 4°C and 13,000 rpm for 15 minutes. Discard the supernatant, add 500 μL of pre-cooled 75% ethanol to the precipitate, centrifuge at 13,000 rpm for 10 minutes at 4 °C, remove all supernatant with a pipette tip, dry the precipitate at room temperature in a biosafety cabinet for 10 minutes, finally add 20 μL of DEPC water to dissolve the precipitate, and store at -70 °C for later use.

[0138] The four nucleic acid standards from Example 1 were diluted to 2 × 10⁻⁶. 7 Copy number / μL, 2×10 6 Copy number / μL, 2×10 5 Copy number / μL, 2×10 4 Copy number / μL, 2×10 3 Plot the standard curve using the number of copies per μL.

[0139] Using the total RNA extracted from the test biological product as a template, multiplex PCR detection was performed using the kit of Example 1, following the reaction system and PCR conditions of Example 1, with culture medium as a negative control. Amplification curves of each virus in the test biological product were obtained. Figures 26-29 The negative control showed no amplification curve.

[0140] The H5N1 content in the tested biological product was found to be 9.06 × 10⁻⁶. 6 Copy number / μL, H7N9 content is 1.91×10 6 The copy number / μL and the content of avian paramyxovirus type IX were 1.86×10⁻⁶. 6 Copy number / μL, West Nile virus content was 1.10 × 10⁻⁶. 7 Copy number / μL.

[0141] The multiplex PCR detection method for four avian RNA viruses established using the kit in Example 1 is rapid, sensitive, and reliable. This detection method detects avian RNA viruses at the nucleic acid level, requiring only about 4 hours from sample processing to result acquisition. Furthermore, the biological sample can be inactivated before detection, effectively reducing biosafety risks. Using multiplex quantitative PCR technology, four pathogens—H5N1, H7N9, avian paramyxovirus IX (Newcastle disease virus), and West Nile virus—can be detected simultaneously, significantly increasing throughput and making it suitable for large-scale screening of biological samples. In terms of sensitivity, the nucleic acids of each virus show a sensitivity of 2 × 10⁻⁶. 1 Copy number / μL ~2×10 7 Excellent linearity across the copy number / μL range, with detection sensitivities reaching 2×10⁻⁶. 1 Copy number / μL. This method has good repeatability (SD≤0.5), high accuracy, and strong specificity, with no cross-reactivity or false positive results.

[0142] The present invention has been described in detail above, with the aim of enabling those skilled in the art to understand and implement the invention. However, this description should not be construed as limiting the scope of protection of the invention. All equivalent changes or modifications made in accordance with the spirit and essence of the invention should be covered within the scope of protection of the invention.

Claims

1. A reagent for the combined detection of four avian RNA viruses, characterized in that, The reagents include upstream primers, downstream primers, and probes for detecting H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus. The sequence of the upstream primer used to detect H5N1 is 5'-GCATTCACAGAAAGTGGTG-3', the sequence of the downstream primer used to detect H5N1 is 5'-ACGCTCGAATTGAGTTATCA-3', and the sequence of the probe used to detect H5N1 is 5'-GACATTTTACAGAGGATGTC-3'. The sequence of the upstream primer used to detect H7N9 is 5'-GTCGACATAAACCCGGGCCAT-3', the sequence of the downstream primer used to detect H7N9 is 5'-TCCTTGGTAATCGTTAACTGTGA-3', and the sequence of the probe used to detect H7N9 is 5'-TATTCCCAAACGAAGTTGGAG-3'. The sequence of the upstream primer used to detect avian paramyxovirus IX is 5'-TCAGACCTGGCTCTCAGACTG-3', the sequence of the downstream primer used to detect avian paramyxovirus IX is 5'-AACCGCTGCGGACGATAAGATGA-3', and the sequence of the probe used to detect avian paramyxovirus IX is 5'-TAGGTACAATAATACCTGCCCTG-3'. The sequence of the upstream primer used for detecting West Nile virus is 5'-GAAGCATCTCTTGAGTT-3', the sequence of the downstream primer used for detecting West Nile virus is 5'-TTGTTTTGAGCTCCGC-3', and the sequence of the probe used for detecting West Nile virus is 5'-TCAAGAAAGAACTA-3'.

2. The reagent for the combined detection of four avian RNA viruses according to claim 1, characterized in that, The probe sequence is labeled with a fluorescent group at one end and a quenching group at the other end, and the fluorescent groups labeled with each probe sequence are different.

3. The reagent for the combined detection of four avian RNA viruses according to claim 2, characterized in that, The fluorescent group is selected from FAM, VIC, TAMRA, ROX and CY5, and the quenching group is selected from BHQ1, BHQ2 and BHQ3.

4. The reagent for the combined detection of four avian RNA viruses according to claim 1, characterized in that, The reagent also includes enzyme-free water for dissolving the upstream primer, downstream primer, and probe.

5. The reagent for the combined detection of four avian RNA viruses according to claim 4, characterized in that, The concentrations of the upstream and downstream primers used for detecting H5N1, H7N9, avian paramyxovirus IX, and West Nile virus were 5–15 μM, respectively. And / or, the concentrations of probes used to detect H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus are 1~10 μM.

6. A kit for the combined detection of four avian RNA viruses, characterized in that, The kit includes the reagents for the combined detection of four avian RNA viruses as described in any one of claims 1 to 5.

7. The kit for the combined detection of four avian RNA viruses according to claim 6, characterized in that, The kit also includes nucleic acid standards for H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus. The sequence of the H5N1 nucleic acid standard is as follows: GCATTCACAGAAAGTGGTGCTATTGTGGCTGAAATATTTCCCATTCCCTCCGTACCAGGACATTTTACAGAGGATGTCAAAAATGCAATTGGAATCCTCATCGGTGGACTTGAATGGAATGATAACTCAATTCGAGCGT; The sequence of the H7N9 nucleic acid standard is as follows: GTCGACATAAACCCGGGCCATGCAGATTTAGTGCTAAAGAAGCACAGGATGTCATCATGGAGGTCGTATTCCCAAACGAAGTTGGAGCCAGAATATTGACATCAGAGTCACAGTTAACGATTACCAAGGA; The sequence of the avian paramyxovirus IX nucleic acid standard is as follows: TCAGACCTGGCTCTCAGACTGATCTGCTCCAGTCTGAGAAGTACGCGATATATCGTAGGTACAATAATACCTGCCCTGATAATAATCCCACCCAGATTGAGCGGGCCAAATCATCTTATCGTCCGCAGCGGTT; The sequence of the West Nile virus nucleic acid standard is as follows: GAAGCATCTCTTGAGTTTCAAGAAAGAACTAGGAACCCTGACCAGCGCCATCAACCGGCGGAGCTCAAAACAA.

8. The kit for the combined detection of four avian RNA viruses according to claim 6, characterized in that, The kit also includes PCR reaction solution, Taq DNA polymerase, and reverse transcriptase.

9. A method for the combined detection of H5N1, H7N9, avian paramyxovirus IX, and West Nile virus in biological products, characterized in that, Using RNA from the biological product to be tested as a template, a multiplex quantitative PCR reaction was performed using the reagent for the joint detection of four avian RNA viruses as described in any one of claims 1 to 5 or the kit for the joint detection of four avian RNA viruses as described in any one of claims 6 to 8. Fluorescence signals were collected to determine the content of H5N1, H7N9, avian paramyxovirus type IX, and West Nile virus in the biological product to be tested.

10. The method for joint detection of H5N1, H7N9, avian paramyxovirus IX, and West Nile virus in biological products according to claim 9, characterized in that, The reaction procedure for the multiplex quantitative PCR reaction is as follows: 39~42℃ for 8~12 minutes; 94~96℃ for 20~30 seconds; 95~97℃ for 5~10 seconds, 58~62℃ for 25~35 seconds, repeat 38~42 times.

Citation Information

Patent Citations

  • Monoclonal antibody of avian influenza virus PB2 protein, hybridoma cell, labeled compound, application and medicine

    CN119684443A

  • Avian paramyxovirus type 9 (APMV-9) recombinant hemagglutinin-neuraminidase (HN) protein expressed by baculoviruses, and diagnostic method of avian paramyxovirus type 9 (APMV-9) using same

    KR1020140081374A