A kit for serum autoantibody detection and its detection method and application

By designing a kit for detecting serum autoantibodies, using enzyme-linked immunosorbent assay (ELISA) and protein mass spectrometry to identify and screen HYI proteins, and constructing a recombinant HYI antigen protease plate, the problem of insufficient sensitivity and specificity in the existing technology for early gastric cancer screening has been solved, and specific detection and diagnosis of early gastric cancer has been achieved.

CN121899406BActive Publication Date: 2026-07-10BEIHUA UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610369371.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-25
Publication Date
2026-07-10
Estimated Expiration
2046-03-25

AI Technical Summary

Technical Problem

Current technologies lack highly sensitive and specific non-invasive examination methods for early gastric cancer screening. Serum markers such as CEA, CA72-4, and CA19-9 have poor specificity and sensitivity in early gastric cancer. There are no literature reports on the diagnostic value of HYI protein as a gastric cancer-associated antigen that induces the production of autoantibodies.

Method used

Design a kit comprising standards, an ELISA plate coated with recombinant HYI antigen protein, ELISA-labeled secondary antibody, chromogenic solution, reaction stop solution, and washing solution. Detect HYI autoantibodies in serum using ELISA, identify and screen HYI proteins as target antigens using protein mass spectrometry, construct recombinant HYI antigen protein and coat it with an ELISA plate, determine the optimal concentration, and detect the content of HYI autoantibodies in serum.

Benefits of technology

It achieves specific detection of early gastric cancer with high sensitivity, and is suitable for screening and diagnosis of precancerous lesions of gastric cancer, with broad application prospects. ROC curve analysis shows that the AUC value is 0.939, indicating that HYI autoantibody has good classification ability in the diagnosis of gastric cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121899406B_ABST
    Figure CN121899406B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological detection, and particularly relates to a kit for serum autoantibody detection, a detection method thereof and application. The kit comprises a standard sample, an enzyme-labeled plate coated with a recombinant HYI antigen protein, an enzyme-labeled secondary antibody, a chromogenic solution, a reaction termination solution and a washing solution. The standard sample is serum containing HYI autoantibodies. The kit for serum autoantibody detection provided by the application has high specificity and can specifically detect the content of HYI autoantibodies in human serum. As an auxiliary diagnostic means for high-expression HYI autoantibody gastric cancer, the kit has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a reagent kit for detecting serum autoantibodies, its detection method, and its application. Background Technology

[0002] Gastric cancer is one of the most common malignant tumors worldwide, and its mortality rate ranks among the highest of all cancer-related deaths globally. The prognosis of gastric cancer is closely related to the timing of diagnosis. Early-stage gastric cancer has a high 5-year survival rate after treatment; however, once it progresses to an advanced stage, the 5-year survival rate drops rapidly, and patients often experience serious complications, leading to a sharp decline in their quality of life and imposing a huge medical and economic burden on families and society. Therefore, improving the early diagnosis rate is key to improving the prognosis of gastric cancer.

[0003] Currently, the main reason why early-stage gastric cancer is difficult to diagnose in a timely manner is the lack of effective early screening methods. While gastroscopy and gastric biopsy are the primary diagnostic methods, they are invasive and unsuitable for large-scale screening of asymptomatic high-risk populations. Therefore, finding non-invasive diagnostic indicators and methods with high sensitivity and specificity is a new trend in early gastric cancer diagnosis and screening research. Serological biomarker detection is an important non-invasive method, and serum biomarkers such as CEA, CA72-4, and CA19-9 have been used, but their specificity and sensitivity in early gastric cancer are relatively poor. In recent years, the use of tumor-associated antigen (TAA)-induced autoantibodies as novel serological biomarkers has become a research hotspot in early cancer detection. Compared with conventional serum biomarkers, these autoantibodies have several advantages: they are stable in the blood, can be detected in the early stages of tumors, can be detected years before the appearance of clinical symptoms, and are easy to sample, suitable for long-term storage and large-scale screening.

[0004] Therefore, kits for specifically detecting autoantibodies can serve as a supplementary means for early cancer detection in medicine, enabling simple, rapid, and sensitive detection of cancer. Currently, although some studies suggest that tumor antigens can induce autoantibody responses, whether HYI protein can act as a gastric cancer-related antigen to induce autoantibody production, and its specific role and diagnostic value in gastric cancer, have not yet been reported in the literature. Summary of the Invention

[0005] The primary objective of this invention is to provide a kit for detecting serum autoantibodies.

[0006] A second objective of this invention is to provide a detection method for a reagent kit used for detecting serum autoantibodies.

[0007] A third objective of this invention is to provide a kit for detecting serum autoantibodies for use in the preparation of products for screening and diagnosing precancerous lesions of the stomach.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] A kit for detecting serum autoantibodies, the kit comprising a standard, an enzyme-labeled plate coated with recombinant HYI antigen protein, an enzyme-labeled secondary antibody, a chromogenic solution, a reaction termination solution, and a washing solution; wherein the standard is serum containing HYI autoantibodies; and the recombinant HYI antigen protein is a recombinant HYI antigen protein with a His tag.

[0010] Furthermore, the kit is used for gastric cancer detection.

[0011] Furthermore, the coating concentration of the recombinant HYI antigen protein is 0.5-2 μg / mL.

[0012] Furthermore, the coating concentration of the recombinant HYI antigen protein is 1 μg / mL.

[0013] Furthermore, the enzyme-labeled secondary antibody is horseradish peroxidase-labeled rabbit anti-human IgG antibody; the chromogenic solution is TMB chromogenic solution; the reaction termination solution is sulfuric acid; and the washing solution is PBST.

[0014] Furthermore, the concentration of the colorimetric solution is 2-3 mg / L; the concentration of the reaction termination solution is 2-3 M.

[0015] The detection method of the above-described reagent kit for detecting serum autoantibodies includes the following steps:

[0016] (1) Take out the ELISA plate coated with recombinant HYI antigen protein, wash the plate with washing solution, add the sample to be tested and the serially diluted standard, incubate at room temperature for 1-3 hours, wash with washing solution and spin dry;

[0017] (2) Add the enzyme-labeled secondary antibody to the system of step (1), incubate at room temperature for 1-3 hours, wash with washing solution and spin dry;

[0018] (3) Add colorimetric solution to the system after the reaction in step (2), develop color at room temperature in the dark for 10-20 min, and add stop solution to terminate the reaction;

[0019] (4) Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of each well at a wavelength of 450 nm.

[0020] Furthermore, the sample to be tested is serum.

[0021] The above-described kit for detecting serum autoantibodies is used in the preparation of products for screening and diagnosing precancerous lesions of the stomach.

[0022] Compared with the prior art, the main advantages of the present invention are as follows:

[0023] This invention discloses a kit for detecting serum autoantibodies, its detection method, and its application. The kit identifies and screens HYI autoantibodies that can detect early gastric cancer serum using protein mass spectrometry. It can specifically detect the content of HYI autoantibodies in early gastric cancer serum, exhibiting high specificity and sensitivity. It can be used for screening precancerous lesions of gastric cancer and in diagnostic products, showing broad application prospects. Attached Figure Description

[0024] Figure 1 Antibody levels in the serum of mice in the experimental and control groups;

[0025] Figure 2 The plasmid map of recombinant plasmid pET-15b-HYI;

[0026] Figure 3 The image shows the results of SDS-PAGE gel electrophoresis; lane 1 corresponds to pET-15b-HYI and lane 2 corresponds to pET-15b.

[0027] Figure 4 The relative expression levels of HYI autoantibodies in healthy controls and gastric cancer patients;

[0028] Figure 5 ROC curve analysis was performed to assess the diagnostic value of HYI autoantibodies in gastric cancer. Detailed Implementation

[0029] The technical solution of the present invention will be further described below with reference to specific embodiments. However, those skilled in the art should understand that the following embodiments are only for illustrating the present invention and should not be regarded as limiting the present invention. Specific conditions not specified in the embodiments are performed according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the reagents or instruments used are all conventional products obtained through commercial channels.

[0030] The human gastric cancer cell line HGC-27 used in this embodiment of the invention was purchased from Wuhan Pronosai Life Science Technology Co., Ltd., with product number CL-0107.

[0031] The mice used in this embodiment of the invention are BALB / c mice, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., strain code 211 (BALB / cAnNCrl).

[0032] Example 1

[0033] Protein mass spectrometry is used to screen antigens.

[0034] (1) Human gastric cancer cell line HGC-27 was resuscitated and cultured using RPMI-1640 medium containing 10% FBS and penicillin-streptomycin antibiotics. Cells in the logarithmic growth phase were collected and prepared into single-cell suspensions. Ten 8-week-old female BALB / c mice in good growth condition were randomly divided into experimental and control groups, with 5 mice in each group. The experimental group mice were inoculated with 5 × 10⁶ cells / mL via subcutaneous injection under the armpit. 6 Each mouse had one HGC-27 cell; control mice were injected with an equal volume of PBS buffer. Immunization was performed every two weeks for three consecutive immunizations. After each immunization, the antibody titer in mouse serum was measured using enzyme-linked immunosorbent assay (ELISA). After three immunizations, antibodies were purified from mouse serum using an antibody purification kit. The concentration of the purified antibodies was uniformly adjusted to 1 mg / mL, aliquoted, and stored at -20°C for later use.

[0035] (2) To screen for target proteins that specifically bind to serum autoantibodies, we used immunoprecipitation combined with mass spectrometry. HGC-27 cells in the logarithmic growth phase were collected, lysed on ice with lysis buffer, and the supernatant was collected after centrifugation to obtain a total cell protein solution. The mouse serum antibody purified in step (1) was incubated with pretreated protein agarose beads to form an antibody-bead complex. Subsequently, the complex and the total cell protein supernatant were slowly shaken at 4°C and incubated overnight for immunoprecipitation. After incubation, the mixture was centrifuged at 4°C and 3000 × g for 5 minutes, and the supernatant was carefully discarded. The beads were washed three times with pre-cooled lysis buffer to thoroughly remove non-specifically bound proteins. Finally, SDS loading buffer was added as the sample for protein proteometry detection. The sample was subjected to protein proteometry detection to screen for target proteins.

[0036] The results are as follows Figure 1 The figure shows the antibody levels in the serum of mice in the experimental and control groups. Figure 1 It was found that after three immunizations, high titers of anti-human gastric cancer cell antibodies were produced in the mouse serum, with the IgG3 subtype being the predominant type. Using this serum, we performed immunoprecipitation-mass spectrometry analysis and screened a target antigen specifically recognized by this antibody—HYI protein—from HGC-27 gastric cancer cells. This provides a candidate molecule for further research on the value of HYI in gastric cancer.

[0037] Example 2

[0038] Construction and expression of recombinant HYI antigen protein:

[0039] (1) Construction of recombinant plasmid: In this invention, pET-15b was used as a vector to construct a recombinant HYI antigen protein with a C-terminus containing a His tag, with a molecular weight of 31 kDa. The target gene HYI was amplified by PCR and introduced into the primers. Nde I. BamH I. Double enzyme digestion site: The upstream primer sequence is GGATCTTCCAGAGATCATATGATGGCGCCGCTGCGCTTC, and the downstream primer sequence is CTGCCGTTCGACGATGGATCCTTAATGAGGTGGGTTCAGAAGCT. After PCR amplification, the fragment was purified by agarose gel electrophoresis and then ligated with the pET-15b linearized vector digested with the same enzymes using T4 DNA ligase to construct the recombinant plasmid pET-15b-HYI. The plasmid map of recombinant plasmid pET-15b-HYI is shown below. Figure 2 As shown in the figure, the constructed recombinant plasmid pET-15b-HYI was transformed into E. coli DH5α competent cells and plated on LB plates containing 100 μg / mL kanamycin for screening. Single colonies were picked for bacterial PCR identification, and the plasmid was extracted for sequencing identification to obtain the correct recombinant plasmid pET-15b-HYI.

[0040] (2) Expression of recombinant plasmids: The correctly sequenced plasmids pET-15b and pET-15b-HYI were transformed into E. coli BL21(DE3) competent cells and plated on LB agar plates containing 100 μg / mL kanamycin. The plates were incubated overnight at 37°C with the plates inverted to obtain recombinant strains, named pET-15b / BL21 and pET-15b-HYI / BL21. Single colonies were picked and added to LB agar plates containing 100 μg / mL kanamycin. The plates were incubated overnight at 37°C and 220 rpm with shaking. When the OD600 reached between 0.6 and 0.8, IPTG was added to a final concentration of 0.5 mM to induce protein expression for 6 h, resulting in bacterial cell precipitation. HYI protein was purified using affinity chromatography to obtain recombinant HYI antigen protein. The purified recombinant HYI antigen protein was detected by SDS-PAGE gel chromatography, and the results are shown below. Figure 3 As shown.

[0041] The results are as follows Figure 3 The image shows the results of SDS-PAGE gel electrophoresis. Figure 3 It can be seen that lane 1 corresponds to pET-15b-HYI and lane 2 corresponds to pET-15b. The pET-15b cells without gene ligation showed no band after induction, while the pET-15b-HYI cells showed a band after induction, with a molecular weight of 31 kDa, indicating that the HYI protein was successfully induced in E. coli BL21(DE3).

[0042] Experimental Example 1

[0043] Determining the optimal antigen coating concentration for ELISA plates:

[0044] The optimal coating concentration for the microplate was determined using the checkerboard method and indirect ELISA detection. The specific operating steps are as follows:

[0045] (1) Coating of the microplate: The recombinant HYI antigen protein constructed in Example 2 was diluted with PBS solution to different concentrations (4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL) for coating. 100 μL of the above protein was added to each reaction well and coated at 37°C for 2 h.

[0046] (2) Blocking of the ELISA plate: Discard the coating solution, wash three times with PBST, and block with 5% skim milk at 37°C for 2 h. Discard the blocking solution and wash three times with PBST.

[0047] (3) Sample detection using an ELISA reader: To establish detection standards, we collected serum from multiple gastric cancer patients whose HYI autoantibodies were confirmed positive in preliminary experiments, and prepared a positive serum pool by mixing them. The positive serum pool was serially diluted at 1:500, 1:1000, 1:1500, and 1:2000. 100 μL of human positive serum at different dilutions was added to each well, and the mixture was incubated at 37°C for 1 h. The primary antibody was discarded, and the samples were washed three times with PBST. 100 μL of horseradish peroxidase-labeled rabbit anti-human IgG antibody was added to each well, and the mixture was incubated at 37°C for 1 h. After washing five times with PBST buffer, 100 μL of 2 mg / L TMB chromogenic solution was added to each well, and the mixture was incubated in the dark for 5 min. Then, 100 μL of 2M sulfuric acid was added to terminate the reaction. The absorbance of each well at 450 nm was detected using an ELISA reader.

[0048] Table 1. Determination of the optimal coating concentration of recombinant HYI antigen protein

[0049]

[0050] The results are shown in Table 1, which shows the determination of the optimal coating concentration of recombinant HYI antigen protein. Table 1 shows that when the coating concentration of recombinant HYI antigen protein is between 1 μg / mL and 2 μg / mL, the OD450 value is close to 1.0. When the coating concentration of recombinant HYI antigen protein is 1 μg / mL, the OD450 value is closest to 1.0. Therefore, the optimal coating concentration of antigen for the ELISA plate is 1 μg / mL.

[0051] Experimental Example 2

[0052] Analysis of HYI autoantibody levels in serum samples:

[0053] To verify the potential of HYI autoantibodies in the diagnosis of gastric cancer, we collected 20 serum samples, including 10 from healthy individuals and 10 from patients with early-stage gastric cancer, for serum autoantibody detection. The specific experimental steps are as follows:

[0054] (1) Collect blood samples from healthy individuals and blood samples from gastric cancer patients, centrifuge at 6000 rpm for 10 min and collect the supernatant.

[0055] (2) Equilibrate the ELISA plate coated with 1 μg / mL recombinant HYI antigen protein to room temperature, wash the plate 3 times with PBST washing buffer and spin dry. Then, add 100 μL of the serum to be tested treated in step (1) to each well, incubate at room temperature for 1 h, wash 3 times with PBST buffer and spin dry.

[0056] (3) Add 100 μL of HRP horseradish peroxidase-labeled rabbit anti-human IgG antibody to the system in step (2), incubate at room temperature for 1 h, wash the plate 3 times with PBST washing solution and spin dry;

[0057] (4) Add 100 μL of 2 mg / L TMB colorimetric solution to the system after the reaction in step (3), develop the color at room temperature in the dark for 20 min, and then add 100 μL of 2 M sulfuric acid to terminate the reaction.

[0058] (5) Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of each well at a wavelength of 450 nm.

[0059] The results are as follows Figure 4 The figure shows the relative expression levels of HYI autoantibodies in healthy controls and gastric cancer patients. Figure 4 The results showed that the serum HYI autoantibody levels in patients with early-stage gastric cancer were significantly higher than those in the healthy control group. This indicates that the above-mentioned kit can specifically detect serum HYI autoantibody levels, and this indicator shows good application potential in early gastric cancer screening.

[0060] Experimental Example 3

[0061] Diagnostic value of HYI autoantibodies in gastric cancer:

[0062] To further evaluate the diagnostic value of HYI autoantibodies in gastric cancer, serum HYI autoantibody levels were detected in 80 samples, including 40 healthy serum samples as the control group and 40 serum samples from early-stage gastric cancer patients as the observation group, following the procedures outlined in Experiment Example 2. ROC curves were plotted using the results, and AUC values ​​were calculated to assess the diagnostic value.

[0063] The results are as follows Figure 5As shown, the ROC curve analysis reveals the diagnostic value of HYI autoantibodies in gastric cancer. The AUC value of HYI autoantibodies in diagnosing gastric cancer is 0.939. An AUC greater than 0.9 indicates that the model has good classification ability, suggesting that HYI autoantibodies can specifically distinguish between gastric cancer and healthy controls. By detecting the level of HYI autoantibodies in serum, the purpose of screening for gastric cancer can be achieved.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. The basic principles and main features of the present invention have been described above with specific implementation schemes. Based on the present invention, some modifications or substitutions can be made, but these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of protection claimed by the present invention.

Claims

1. The application of a reagent kit for detecting serum autoantibodies in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The kit includes standards, an ELISA plate coated with recombinant HYI antigen protein, ELISA-labeled secondary antibody, chromogenic solution, reaction termination solution, and washing solution; the standards are serum containing HYI autoantibodies; the recombinant HYI antigen protein is a recombinant HYI antigen protein with a His tag.

2. The application of the reagent kit for detecting serum autoantibodies according to claim 1 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The kit is used for gastric cancer detection.

3. The application of the reagent kit for detecting serum autoantibodies according to claim 1 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The coating concentration of the recombinant HYI antigen protein is 0.5-2 μg / mL.

4. The application of the reagent kit for detecting serum autoantibodies according to claim 3 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The coating concentration of the recombinant HYI antigen protein was 1 μg / mL.

5. The application of the reagent kit for detecting serum autoantibodies according to claim 1 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The enzyme-labeled secondary antibody is horseradish peroxidase-labeled rabbit anti-human IgG antibody; the chromogenic solution is TMB chromogenic solution; the reaction termination solution is sulfuric acid; and the washing solution is PBST.

6. The application of the reagent kit for detecting serum autoantibodies according to claim 5 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The concentration of the colorimetric solution is 2-3 mg / L; the concentration of the reaction termination solution is 2-3 M.

7. The application of a reagent kit for detecting serum autoantibodies according to any one of claims 1-6 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The detection steps are as follows: (1) Take out the ELISA plate coated with recombinant HYI antigen protein, wash the plate with washing solution, add the sample to be tested and the serially diluted standard, incubate at room temperature for 1-3 hours, wash with washing solution and spin dry; (2) Add the enzyme-labeled secondary antibody to the system of step (1), incubate at room temperature for 1-3 hours, wash with washing solution and spin dry; (3) Add colorimetric solution to the system after the reaction in step (2), develop color at room temperature in the dark for 10-20 min, and add stop solution to terminate the reaction; (4) Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of each well at a wavelength of 450 nm.

8. The application of the reagent kit for detecting serum autoantibodies according to claim 7 in the preparation of products for screening and diagnosing precancerous lesions of the stomach, characterized in that, The sample to be tested is serum.

Citation Information

Patent Citations

  • Application of plasma autoantibody marker in early diagnosis of breast cancer and molecular subtype characterization of breast cancer

    CN113702636A

  • Kit for detecting serum autoantibody and application thereof

    CN119147759A