Application of SAF-A gene and encoding protein thereof as diagnostic marker in diabetic nephropathy
By using the SAF-A gene and its encoded protein as diagnostic biomarkers and therapeutic targets, the problem of lacking early diagnostic biomarkers and treatment methods for DKD has been solved, enabling early diagnosis and targeted therapy of DKD, and significantly improving podocyte damage and kidney function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV
- Filing Date
- 2026-01-27
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies lack specific early diagnostic biomarkers and effective targeted therapies to address podocyte damage in diabetic nephropathy (DKD).
By utilizing the SAF-A gene and its encoded protein as diagnostic biomarkers, and by intervening in SAF-A expression through siRNA fragments specifically targeting renal podocytes, products for the diagnosis and treatment of DKD can be developed, including ELISA and colloidal gold test strips, as well as targeted drugs such as ASO and siRNA.
It provides new biomarkers for non-invasive early diagnosis and prognostic assessment of DKD, identifies SAF-A as a new target for DKD treatment, significantly improves podocyte injury and renal function, and has broad clinical translation and market potential.
Smart Images

Figure CN121899417A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of the SAF-A gene and its encoded protein as a diagnostic marker in diabetic nephropathy. Background Technology
[0002] Diabetic nephropathy (DKD) is the most common microvascular complication of diabetes and a leading cause of end-stage renal disease. One of its core pathological processes is podocyte damage, but the specific molecular mechanisms are not fully understood, resulting in a lack of specific early diagnostic biomarkers and effective targeted therapies.
[0003] SAF-A (Scaffold Attachment Factor A), also known as hnRNP U, is a multifunctional RNA-binding protein involved in chromatin organization, transcriptional regulation, and RNA metabolism. Current research mainly focuses on its role in cancer and the nervous system; its expression patterns, functions, and mechanisms in the kidneys, particularly in podocyte damage in diabetic nephropathy, remain unknown.
[0004] This invention is the first to discover and demonstrate that SAF-A is specifically and highly expressed in podocytes of DKD patients and animal models, and its expression level is positively correlated with disease severity. Intervention of SAF-A expression using a siRNA fragment specifically targeting SAFA can significantly improve podocyte damage and reduce proteinuria. Therefore, SAF-A can serve as a novel auxiliary diagnostic biomarker, a marker for predicting disease progression, and a therapeutic target for DKD. Summary of the Invention
[0005] Based on the above technical background, the purpose of this invention is to provide an application of the SAF-A gene and its encoded protein as a diagnostic marker in diabetic nephropathy, and to develop a specific siRNA fragment targeting SAFA in renal podocytes to reduce SAFA expression levels. This invention also develops a new use for SAFA in drugs for treating DKD, thus solving the current problem of lacking early specific diagnostic markers and effective targeted therapies for DKD.
[0006] One of the technical solutions provided by this invention is the application of the SAF-A gene and its encoded protein as diagnostic markers in the preparation of diagnostic products for diabetic nephropathy.
[0007] Furthermore, the expression level of the SAF-A protein was specifically upregulated in the test samples of patients with diabetic nephropathy, and its expression level was positively correlated with the severity of the disease.
[0008] Furthermore, the severity of the disease was assessed using indicators such as the urinary albumin-to-creatinine ratio (ACR), serum creatinine (SCr), or estimated glomerular filtration rate (eGFR).
[0009] Furthermore, the test samples are derived from human or animal bodies, including but not limited to blood, serum, plasma, urine, and kidney tissue.
[0010] Furthermore, the SAF-A protein was significantly elevated in the serum and kidney tissue of patients with diabetic nephropathy.
[0011] The second technical solution provided by this invention is the application of the SAF-A gene as a target in the preparation of RNA drugs for the treatment of diabetic nephropathy.
[0012] Furthermore, the RNA drug works by inhibiting the expression of the SAF-A gene or inhibiting its protein function.
[0013] Furthermore, the active ingredient that inhibits SAF-A gene expression is interfering RNA targeting the SAF-A gene.
[0014] The third technical solution provided by this invention is a siRNA fragment that specifically inhibits SAF-A gene expression, with the sequence: 5'-CACAGTGGTTTGTCTTGATACTTAT-3'. Based on the sequence of the siRNA fragment, an shRNA suitable for adeno-associated virus packaging was designed and synthesized, with the target sequence shown below:
[0015] Top strand:
[0016] TCGAGGCACAGTGGTTTGTCTTGATACTTATCTCGAGATAAGTATCAAGACAAACCACTGTGTTTTTTA; as shown in SEQ ID No.1;
[0017] Bottom strand:
[0018] AGCTTAAAAAACACAGTGGTTTGTCTTGATACTTATCTCGAGATAAGTATCAAGACAAACCACTGTGCC; as shown in SEQ ID No. 2.
[0019] The beneficial technical effects of this invention are as follows:
[0020] 1. Diagnostic value: This study reveals for the first time that SAF-A is specifically elevated in the serum of DKD patients and is significantly correlated with disease severity indicators (ACR, SCr, eGFR), providing a novel biomarker for non-invasive early diagnosis and prognostic assessment of DKD.
[0021] 2. Clear therapeutic target: In vitro and in vivo functional experiments (including podocyte-specific knockdown mouse model) confirmed that inhibiting SAF-A expression can effectively reduce podocyte damage, improve foot process structure, and reduce proteinuria, thus clarifying the effectiveness of SAF-A as a new therapeutic target for DKD.
[0022] 3. Mechanism innovation: For the first time, a novel mechanism by which SAF-A drives podocyte injury by regulating the expression of key cytoskeleton / cell cycle-related proteins (such as Myl12a, Tacc3, cyclin D / B1) has been elucidated, providing a multi-level potential mechanism for intervention.
[0023] 4. Broad application prospects: The development of diagnostic kits (such as ELISA, colloidal gold test strips) or targeted drugs (such as ASO, siRNA) based on SAF-A has huge clinical translation and market potential. Attached Figure Description
[0024] Figure 1 This invention relates to the upregulation of SAF-A expression in DKD and its clinical relevance; wherein:
[0025] AB transmission electron microscopy examination of renal biopsy specimens from DKD patients confirmed characteristic structural changes and preliminary histopathological analysis, including significant glomerular basement membrane thickening and extensive podocyte foot process fusion;
[0026] C represents the cell type-specific expression pattern of SAF-A (hnRNP U) in the renal parenchyma population in scRNA-seq, with podocyte clusters highlighted.
[0027] D represents the glomerular transcript abundance of SAF-A in control glomeruli and DKD glomeruli from the Woroniecka dataset in the Nephroseq database, with values representing the median centering intensity of log2 (control group, n=13; DKD group, n=9). The right panel shows SAF-A expression in the subgroup of Black / African American DKD patients (n=3), with data as mean ± standard deviation; unpaired two-tailed t-test, *p<0.05;
[0028] E shows representative immunofluorescence images of Kirrel (red) and SAF-A (green) in human glomeruli from control and DKD kidney biopsies. A magnified view (dashed box) highlights podocytes (white arrows), scale bar, 50 μm;
[0029] F represents the relative abundance of SAF-A in the serum of HC and DKD patients stratified by ACR, as measured by LC-MS / MS. Data are mean ± standard deviation; unpaired two-tailed t-test, *p<0.05, ***p<0.001;
[0030] G is a heatmap of the Pearson correlation coefficient between serum SAF-A levels (serum, LC-MS / MS) and clinical laboratory indicators, with colors indicating the magnitude of the correlation; coefficients showing significant association (p < 0.05), *p < 0.05, **p < 0.01;
[0031] H is a scatter plot depicting the relationship between serum SAF-A and SCr or eGFR, with fitted regression lines. Cohorts: total (n=98), HC (n=24), ACR < 30 mg / g (n=25), 30 ≤ ACR < 300 mg / g (n=24), and ≥ 300 mg / g (n=25).
[0032] Figure 2 The present invention aims to inhibit the therapeutic effect of SAF-A in a DKD mouse model; wherein:
[0033] A shows immunofluorescence images of Kirrel (red) and SAF-A (green) from the renal cortex of control and db / db mice. The magnified view (dashed box) indicates podocytes (white arrows). Scale bar, 50 μm.
[0034] B is a bright field image of primary podocytes from control (con) mouse glomeruli, scale bar, 100 μm, showing the Western blot band of SAF-A from primary podocytes from con and db / db mice;
[0035] C represents Coomassie brilliant blue staining of urinary protein in each group of mice, with bovine serum albumin (BSA) as a reference. The urinary albumin-creatinine ratio (uACR) is shown between groups. Data are presented as mean ± standard deviation. Two-way ANOVA and Tukey multiple comparisons: ##p < 0.01, db / db vs. CON; *p < 0.05, **p < 0.01, db / db+sh SAF-A vs. db / db+con;
[0036] D shows a representative PAS staining and transmission electron microscopy (TEM) image of the glomerulus, with the TEM scale bar shown in the figure.
[0037] E shows immunofluorescence images of Podocin (red), Desmin (green), Kirrel (green), and SAF-A (red) in the glomerulus. The magnified view (dashed box) indicates podocytes (white arrows). Scale bar, 50 μm;
[0038] F represents Western blot and quantitative analysis of podocin, nephrin, and desmin in kidney tissue. Data are presented as mean ± standard deviation; two-way ANOVA and Tukey multiple comparisons were performed. *p < 0.05, **p < 0.01, ***p < 0.001, db / db+shSAF-A vs. db / db+con.
[0039] Figure 3 This invention describes the mechanism by which SAF-A regulates podocyte injury in vitro; wherein:
[0040] A shows a representative immunofluorescence micrograph of Kirrel (red), SAF-A (green), and F-actin (phalloidin staining) in podocytes exposed to HG. The magnified view (dashed box) highlights binucleated podocytes (white arrows). Scale bar, 10 μm.
[0041] B represents flow cytometry analysis of cell cycle distribution in HG-treated podocytes (propidium iodide staining, RNase treatment), and quantification of the proportion of each phase. Data are presented as mean ± standard deviation; unpaired two-tailed t-test, *p < 0.05;
[0042] CD represents the Western blot results of HG-treated podocytes;
[0043] E shows an immunofluorescence image of Kirrel (red), SAF-A (green), and F-actin (phalloidin staining) in HG-treated podocytes with SAF-A knockdown. A magnified view (dashed box) highlights binucleated cells (white arrows), scale bar, 10 μm;
[0044] F represents flow cytometry and quantitative analysis of cell cycle distribution after SAF-A knockdown under HG conditions. Data are presented as mean ± standard deviation; unpaired two-tailed t-test, **p < 0.01;
[0045] GH represents the Western blot results of HG-treated podocytes with or without SAF-A knockdown;
[0046] I is a representative immunofluorescence image of Kirrel (red), SAF-A (green), and F-actin (phalloidin staining) in SAF-A overexpressing podocytes, showing a magnified view (dashed box), scale bar, 10 μm;
[0047] J represents flow cytometry analysis of cell cycle distribution in podocytes overexpressing SAF-A (NG+SAF-A oe) and vector control (NG+CON), quantifying the proportion of cells in G2 / M phase. Data are presented as mean ± standard deviation; unpaired two-tailed t-test. **p < 0.01;
[0048] KL represents the Western blot results of podocytes with or without SAF-A overexpression.
[0049] Figure 4 This invention relates to the expression level of SAF-A in the urine of patients with diabetic nephropathy and its correlation with clinical indicators; wherein:
[0050] a represents the relative abundance of SAF-A in the urine of HC and DKD patients stratified by ACR, as determined by LC-MS / MS;
[0051] b is a heatmap of the Pearson correlation coefficients between SAF-A levels (urine, LC-MS / MS) and clinical laboratory indicators in matched biofluids, with the color of the squares indicating the strength of the correlation.
[0052] Figure 5 This invention utilizes adeno-associated virus with SAF-A knockdown specifically in podocytes injected into dbdb mice, a model of diabetic nephropathy, to observe the therapeutic effect; wherein:
[0053] 'a' represents the experimental timeline. db / db mice were randomly divided into three groups: the untreated db / db group, the control AAV group (db / db + con), and the SAF-A shRNA AAV group (db / db + sh SAF-A).
[0054] b represents the transduction efficiency of adeno-associated virus (AAV) in the specified system;
[0055] cd represents the changes in body weight and blood glucose over time for each group. ns. No significant difference (two-way ANOVA, Tukey multiple comparison test; db / db + sh SAF-A group vs. db / db + con group);
[0056] ef represents the quantification of glomerular basement membrane thickness (e) and foot process density per μm GBM (f), with data presented as mean ± SD; one-way ANOVA, Tukey multiple comparison test, db / db + sh SAF-A group vs. db / db + con group, ** p < 0.01.
[0057] Figure 6 The transfection efficiency of siRNA and plasmid in this invention; wherein:
[0058] ab represents the transfection efficiency of siRNA and adenovirus (control showing EGFP labeling); data are mean ± SD; unpaired two-tailed t-test, * p < 0.05, ** p < 0.01.
[0059] Figure 7 For the present invention Figure 3Density analysis results of the Western blot. Detailed Implementation
[0060] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0061] Example 1: Validation of SAF-A as a diagnostic biomarker for DKD
[0062] 1. Collect serum samples from healthy controls and DKD patients at different proteinuria stages.
[0063] 2. The content of SAF-A protein in serum was detected by liquid chromatography-tandem mass spectrometry (LC-MS / MS) or enzyme-linked immunosorbent assay (ELISA).
[0064] 3. Statistical analysis showed that serum SAF-A levels in DKD patients were significantly higher than those in healthy controls (p<0.001), and increased with increasing ACR (anti-inflammatory response rate). Figure 1 F).
[0065] 4. Pearson correlation analysis showed that serum SAF-A levels were positively correlated with SCr (r=0.65, p<0.01) and negatively correlated with eGFR (r=-0.70, p<0.01). Figure 1 GH).
[0066] Conclusion: Serum SAF-A levels can serve as an effective biomarker for diagnosing DKD and assessing its severity.
[0067] Example 2: The therapeutic effect of inhibiting SAF-A on DKD (animal experiment)
[0068] 1. Construct an adeno-associated virus (AAV) carrying a podocyte-specific promoter (Nphs2) to drive SAF-A shRNA.
[0069] 2. Ten-week-old db / db mice were randomly divided into three groups: untreated group, AAV-control group, and AAV-shSAF-A group, and injected with the virus via the tail vein.
[0070] 3. Ten weeks after the intervention, urine, blood biochemical indicators, and kidney tissue were tested.
[0071] 4. Results: The urinary albumin-to-creatinine ratio (uACR) in the AAV-shSAF-A group was significantly lower than that in the control group (p<0.01). Figure 2A); glomerular pathological damage was reduced, and foot process fusion was improved ( Figure 2 B); the expression of podocyte marker proteins Podocin and Nephrin increased, while the expression of Desmin decreased. Figure 2 C).
[0072] Conclusion: Podocyte-specific knockdown of SAF-A can effectively treat DKD and improve renal function and renal pathology.
[0073] Example 3: Cellular mechanism of SAF-A-induced podocyte damage
[0074] 1. In conditionally immortalized mouse podocytes (MPC5), groups were set up including normal glucose (NG), high glucose (HG), HG+SAF-AsiRNA, and NG+SAF-A overexpression.
[0075] 2. Detect cell phenotype and molecular changes.
[0076] 3. Results: HG induced upregulation of SAF-A expression, leading to cytoskeleton disorder (F-actin staining) and an increased proportion of cells in the G2 / M phase (flow cytometry). Knockdown of SAF-A reversed these damaging phenotypes. Figure 3 AB). Overexpression of SAF-A under NG conditions is sufficient to mimic the HG-induced damage phenotype ( ). Figure 3 C).
[0077] Conclusion: SAF-A is a key driver of high glucose-induced podocyte injury.
[0078] Example 4: Exploring the downstream mechanisms of SAF-A (multi-omics analysis)
[0079] 1. Immunofluorescence, flow cytometry, and Western blot analysis were performed on SAF-A overexpressing and control podocytes to detect cell cycle.
[0080] 2. Integrated analysis revealed that SAF-A regulates the expression of cytoskeleton / cell cycle-related proteins (such as Myl12a, Tacc3, cyclin D / B1), thereby leading to podocyte cytoskeleton damage and cell cycle disorder.
[0081] 3. Flow cytometry analysis of the cell cycle revealed that overexpression of SAF-A altered the cell cycle of podocytes. Conversely, knockdown of SAF-A in high-glucose-cultured podocytes alleviated podocyte cytoskeleton damage and cell cycle disturbances.
[0082] Conclusion: SAF-A mediates podocyte injury by coordinating posttranscriptional splicing and translational reprogramming.
[0083] The specific relevant experimental data are as follows:
[0084] 1. Human specimen
[0085] Kidney tissue, urine, and serum samples were obtained from the Biobank of the First Affiliated Hospital of Zhengzhou University and the National Human Genetic Resources Sharing Service Platform (License No.: 2021-KY-361). This study analyzed four archived kidney tissue specimens (two from DKD patients and two from controls). Control tissues were obtained from pre-transplant donor kidney biopsy samples or from donor kidneys deemed unsuitable for transplantation. Serum and urine samples were obtained from 74 DKD patients and 24 healthy controls (HC). DKD patients were stratified by albumin-creatinine ratio (ACR): ACR < 30 mg / g (n=25), 30 ≤ ACR < 300 mg / g (n=24), and ACR ≥ 300 mg / g (n=25). This study was approved by the Ethics Committee of Zhengzhou University; informed consent was waived for delabeled residual specimens.
[0086] 2. Podocyte-specific SAF-A knockdown mice
[0087] A shRNA adeno-associated virus (AAV) vector targeting SAF-A (hnRNP U) was constructed under the regulation of the podocyte-specific protein (Nphs2) promoter (Shanghai Hanheng Biotechnology). The specific sequence is as follows:
[0088] Interference sequence: CACAGTGGTTTGTCTTGATACTTAT; as shown in SEQ ID No. 3;
[0089] Reverse complementary sequence: ATAAGTATCAAGACAAACCACTGTG; as shown in SEQ ID No. 4.
[0090] Male db / db mice aged 8-10 weeks were acclimatized and then randomly divided into three groups at 10 weeks of age: untreated db / db group, db / db+AAV-control (db / db+con) group, and db / db+AAV-sh SAF-A (db / db+sh SAF-A) group. The vector (1.5×10^12 vg / ml; 100 μl / mouse) was injected via tail vein. Mouse body weight and urinary parameters were monitored during the experiment. Mice were sacrificed at 20 weeks of age, and tissue and biofluid samples were collected.
[0091] All animal experiments were conducted in accordance with the guidelines of the National Institutes of Health (NIH) and approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Approval No.: ZZU-LAC20241115).
[0092] 3. Morphological studies
[0093] Formalin-fixed and paraffin-embedded kidney tissue sections were stained with periodic acid-Schiff (PAS) and observed for pathological morphology under a light microscope. For electron microscopy, renal cortical samples were fixed in 2.5% glutaraldehyde and prepared into ultrathin sections, which were then imaged under a Zeiss EM-10 electron microscope. All morphological assessments were performed by blinded observers.
[0094] 4. Immunofluorescence staining
[0095] Immunofluorescence staining was performed on frozen or formalin-fixed sections and cultured podocytes. After fixation and blocking, samples were incubated overnight at 4°C with primary antibody, followed by incubation with Alexa Fluor-conjugated secondary antibody. DAPI staining was used to label cell nuclei. Images were acquired using a Zeiss LSM 880 confocal microscope. Antibody details are shown in Table 1.
[0096] Table 1. Detailed information on antibodies
[0097]
[0098] 5. Cell Culture and Processing
[0099] Conditionally immortalized mouse podocytes (MPC5; passages 5-10) were cultured according to reported methods. Cells were divided into four groups: normal glucose (NG, 5.6 mmol / L), high glucose (HG, 30 mmol / L) + transforming growth factor-β1 (TGF-β1, 2 ng / mL), NG + control plasmid (NG + CON), NG + SAF-A overexpression (NG + SAF-A oe), HG + control siRNA (HG + NC), and HG + SAF-A siRNA (HG + SAF-A si). Transfection was performed using Lipofectamine 3000; RNA and protein samples were collected 48 hours after transfection.
[0100] In the adenovirus knockdown assay, podocytes were infected with adenovirus encoding SAF-A shRNA (MOI = 100). A control adenovirus carrying enhanced green fluorescent protein (EGFP) (NG+con-ADV) was used. Western blot experiments employed an adenovirus knockdown strategy, while immunofluorescence and flow cytometry experiments used non-fluorescently labeled siRNA. The siRNA, plasmid, and adenovirus were all constructed by Shanghai Hanheng Biotechnology. The siRNA sequences are shown in SEQ ID No. 5-8, the plasmid sequences in SEQ ID No. 9, and the adenovirus sequences in SEQ ID No. 10-12.
[0101] 6. SDS-PAGE and Western blot analysis
[0102] Podocytes were lysed using RIPA buffer containing protease / phosphatase inhibitors. Protein concentration was determined using the BCA method. After separation by SDS-PAGE gel electrophoresis, proteins were transferred to nitrocellulose membranes, blocked, and incubated overnight at 4°C with primary antibody, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibody (antibody sources are shown in Table 1). The bands were visualized using chemiluminescence immunoassay, and quantification was performed using ImageJ software (version 1.53k).
[0103] 7. RNA extraction and real-time RT-PCR
[0104] Total RNA was extracted using the RNeasy Mini Kit. cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit. Real-time quantitative PCR (qPCR) was performed using SYBR Green mixture. Primer sequences are shown in Table 2, as indicated by SEQ ID No. 13-22. Relative mRNA expression levels were calculated using the 2^–ΔΔCt method.
[0105] Table 2 Primer sequences
[0106]
[0107] 8. Flow cytometry cell cycle analysis
[0108] Podocytes were fixed with ethanol, treated with RNase A, stained with propidium iodide, and analyzed using a BD FACSCelesta flow cytometer. Cell cycle distribution was analyzed using ModFit LT software (Verity Software House, USA).
[0109] 9. Single-cell RNA sequencing and analysis
[0110] Single-cell RNA sequencing was performed using the 10x Genomics Chromium platform, and sequencing libraries were constructed using the Illumina platform. Data processing included sequence alignment, UMI counting, quality control, normalization, dimensionality reduction, cluster analysis, and Seurat cell type annotation. Differential expression analysis employed nonparametric tests with multiple validation corrections.
[0111] 11. Mass spectrometry proteomics analysis
[0112] Urine and serum samples were centrifuged, filtered, and desalted before being analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS) on a Q Exactive HF-X system. Data analysis was performed using the UniProt human proteome database in MaxQuant software. Identification results were filtered for a 1% false discovery rate (FDR).
[0113] Peptide samples were dissolved in loading buffer, aspirated by an autosampler, and bound to an analytical column (75 μm * 25 cm, C18, 2 μm, 100 Å) for separation. A 100-min analytical gradient was established using two mobile phases (Mobile Phase A: 0.1% formic acid and Mobile Phase B: 0.1% formic acid, 80% ACN). The liquid chromatography flow rate was set to 300 nL / min. Mass spectrometry (MS) acquired data in DDA mode, with each scan cycle consisting of one full MS scan (R = 60 K, AGC = 3e6, max IT = 20 ms, scan range = 350–1800 m / z) followed by 25 MS / MS scans (R = 15 K, AGC = 2e5, max IT = 50 ms). The HCD collision energy was set to 28 Å. The quadrupole screening window was set to 1.6 Da. The dynamic exclusion time for repeated ion acquisition was set to 35 s.
[0114] Mass spectrometry data were retrieved using MaxQuant (V1.6.6) software with the Andromeda database search algorithm. The database used for the search was the Human Proteome Reference Database in Uniprot (February 9, 2022, containing 20,375 protein sequences). The main search parameters were as follows: variable modifications were selected as Oxidation (M) and Acetyl (Protein N-term); fixed modifications were selected as Carbamidomethyl (C); the primary mass spectrometry matching tolerance was set to 20 ppm in the initial search and 4.5 ppm in the primary search; the secondary mass spectrometry matching tolerance was set to 20 ppm. Search results were filtered based on a 1% FDR at the protein and peptide levels, removing reverse-database proteins, contaminating proteins, and proteins with only one modified peptide. The remaining identification information was used for subsequent analysis.
[0115] 15. Statistical Analysis
[0116] Data are expressed as mean ± standard error (SEM) or standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software (GraphPad Software, USA). T-tests were used for comparisons between two groups; analysis of variance (ANOVA) was used for comparisons among multiple groups, followed by Dunnett's or Tukey's multiple comparison tests according to the experimental design. A p-value < 0.05 was considered statistically significant.
[0117] 16. Results
[0118] 16.1 Extensive splicing reprogramming and SAF-A upregulation were observed in human DKD podocytes.
[0119] Preliminary histopathological analysis of renal biopsy specimens from patients with DKD confirmed characteristic structural changes, including significant glomerular basement membrane thickening and extensive podocyte foot process fusion. Figure 1 AB). SAF-A was most significantly upregulated in podocytes of the kidney tissue of DKD patients (AB). Figure 1 (C - Red Box). Analysis of the Nephroseq database (https: / / nephroseq.org / resource / login.html) showed that, compared with the control group, the glomerular SAF-A mRNA level was significantly increased in DKD patients (p=0.0132). Figure 1 D), consistent with our experimental results. Immunofluorescence staining showed that SAF-A (green) expression was upregulated in DKD podocytes and significantly redistributed from perinuclear localization to punctate intranuclear foci. Simultaneously, the expression pattern of the podocyte marker protein Kirrel (red) suggested cellular structural disruption. Figure 1 E. Representative immunofluorescence images of Kirrel (red) and SAF-A (green) in human glomeruli from control and DKD renal biopsies. Magnified view (dashed box) highlights podocytes (white arrow). Scale bar, 50 μm). Assessment of serum SAF-A protein levels in the clinical cohort showed significantly elevated SAF-A levels in patients with DKD, increasing in a gradient with the severity of albuminuria. Figure 1 F). Correlation analysis showed that serum SAF-A levels were positively correlated with serum creatinine (SCr) and negatively correlated with estimated glomerular filtration rate (eGFR). Figure 1 G), suggesting that SAF-A may be a potential biomarker for early diabetic kidney injury. However, urinary SAF-A expression was not significantly correlated with these clinical indicators (G). Figure 4 (a and 4b).
[0120] 2. In the DKD mouse model, the upregulation and nuclear translocation of SAF-A are associated with podocyte cytoskeleton damage and nuclear division.
[0121] Next, the conservation of SAF-A dysregulation in the experimental DKD mouse model was investigated. Immunostaining of kidneys from db / db mice showed disruption of podocyte structure, along with increased SAF-A expression and enrichment in the nucleus. Figure 2 A). Primary podocyte experiments from db / db mice confirmed a significant upregulation of SAF-A ( Figure 2 B). To clarify the causal relationship, podocyte-specific SAF-A knockdown was achieved in db / db mice using AAV-sh SAF-A. Figure 5a). Virus transfection efficiency and SAF-A knockdown efficiency are shown in [reference needed]. Figure 5 b. SAF-A knockdown did not affect blood glucose levels or body weight in db / db mice. Figure 5 c and 5d). However, SAF-A knockdown significantly reduced albuminuria in mice, improved renal histopathological damage, and preserved foot process structures ( Figure 2 C and 2D, Figure 5 e and 5f). Immunofluorescence and Western blot analysis showed that SAF-A knockdown restored the expression of slit septum proteins Podocin, Nephrin, and Kirrel, and reduced the level of the damage marker Desmin (e and 5f). Figure 2 E and 2F).
[0122] 3. SAF-A drives podocyte skeletal damage and nuclear division in vitro by regulating the expression of cell cycle-related and cytoskeletal proteins.
[0123] Similar results were observed in cultured podocytes treated with high glucose (HG) combined with TGF-β. HG conditioned therapies to induce SAF-A upregulation and nuclear translocation, accompanied by cytoskeleton disruption and an increase in the proportion of cells in the G2 / M phase. Figure 3 A-3C (p=0.0104) indicated abnormal expression of cytoskeleton-related and cell cycle-related proteins. After in-depth analysis and screening, we examined the expression levels of Cyclin D1 and Cyclin B1, key serine / threonine kinases involved in cell cycle regulation (Nek2), and the microtubule-stabilizing protein Tacc3. All four proteins were significantly upregulated in podocytes cultured under HG conditions. Conversely, the expression of the myosin light chain subunit Myl12a (myosin light chain 12a), involved in cytoskeleton remodeling and cell motility, was significantly downregulated. Figure 3 D). However, in podocytes cultured under HG conditions, these abnormalities were significantly alleviated after SAF-A knockdown (D). Figure 3 E-3H). Transfection efficiency and knockdown efficiency are shown in [link to E-3H]. Figure 6 ab. SAF-A inhibition under HG conditions also significantly reduced the proportion of podocytes in the G2 / M phase of the cell cycle ( Figure 3 F, p=0.0016).
[0124] To further confirm the effect of SAF-A upregulation on podocyte cytoskeleton integrity and nuclear division, SAF-A overexpression (NG+SAF-A oe) was mediated by plasmid in podocytes cultured under normal conditions. Cytoskeleton damage, nuclear division, and protein expression changes in HG-cultured podocytes were consistent with the phenotypes observed in SAF-A-overexpressing podocytes. Figure 3I-3L) indicates that increased SAF-A expression is a key factor driving HG-induced cytoskeleton disruption and abnormal nuclear division. Western blot density analysis results are shown in […]. Figure 7 .
[0125] In summary, this invention is the first to demonstrate that SAF-A expression is specifically upregulated in podocytes of DKD patients and animal models, and that its expression level is positively correlated with disease severity. Specifically, SAF-A protein is significantly elevated in the serum and kidney tissue of DKD patients, and can serve as a novel biomarker for the auxiliary diagnosis of DKD and the assessment of its progression. Furthermore, by specifically knocking down a SAFA siRNA fragment and constructing a shRNA fragment based on this siRNA fragment for viral packaging, inhibiting SAF-A expression can effectively improve glucose-induced podocyte damage, reduce proteinuria, and protect kidney function, revealing the effectiveness of SAF-A as a novel therapeutic target for DKD and providing a new solution for the early diagnosis and targeted therapy of diabetic nephropathy.
Claims
1. Application of SAF-A gene and its encoded protein as diagnostic markers in the preparation of diagnostic products for diabetic nephropathy.
2. The application of the SAF-A gene and its encoded protein as diagnostic markers in the preparation of diagnostic products for diabetic nephropathy, as described in claim 1, is characterized in that... The expression level of the SAF-A protein was specifically upregulated in samples from patients with diabetic nephropathy, and its expression level was positively correlated with the severity of the disease.
3. The application of the SAF-A gene and its encoded protein as diagnostic markers in the preparation of diagnostic products for diabetic nephropathy, as described in claim 2, is characterized in that... The severity of the disease is assessed using the urine albumin-to-creatinine ratio, serum creatinine, or an estimated glomerular filtration rate.
4. The application of the SAF-A gene and its encoded protein as diagnostic markers in the preparation of products for the diagnosis of diabetic nephropathy, as described in claim 2, is characterized in that... The test samples are derived from human or animal blood, serum, plasma, urine, or kidney tissue.
5. Application of SAF-A gene as a target in the preparation of RNA drugs for the treatment of diabetic nephropathy.
6. The use of the SAF-A gene as a target in the preparation of RNA drugs for treating diabetic nephropathy as described in claim 5, characterized in that, The RNA drug works by inhibiting the expression of the SAF-A gene or inhibiting its protein function.
7. The use of the SAF-A gene as a target in the preparation of RNA drugs for treating diabetic nephropathy as described in claim 5, characterized in that, The active ingredient that inhibits SAF-A gene expression is interfering RNA targeting the SAF-A gene.
8. A siRNA fragment that specifically inhibits SAF-A gene expression, characterized in that, The sequence is: 5'-CACAGTGGTTTGTCTTGATACTTAT-3'.
9. The siRNA fragment that specifically inhibits SAF-A gene expression according to claim 8, characterized in that, Based on the sequence of the siRNA fragment, shRNA that can be used for adeno-associated virus packaging was designed and synthesized, and its target sequence is shown below: Top strand: TCGAGGCACAGTGGTTTGTCTTGATACTTATCTCGAGATAAGTATCAAGACAAACCACTGTGTTTTTTA; Bottom strand: AGCTTAAAAAACACAGTGGTTTGTCTTGATACTTATCTCGAGATAAGTATCAAGACAAACCACTGTGCC.