Molecular marker chr1942920824 related to cold tolerance of soybean seedling and application thereof

By developing the InDel molecular marker Chr1942920824 on soybean chromosome 19 and its primer pair, the problem of identifying cold tolerance in soybean seedlings was solved, realizing a rapid, simple, and efficient breeding method and improving the resistance of soybeans to low temperatures.

CN121915191BActive Publication Date: 2026-06-26SANYA INST OF HENAN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610352410.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-23
Publication Date
2026-06-26
Estimated Expiration
2046-03-23

Smart Images

  • Figure CN121915191B_ABST
    Figure CN121915191B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular markers, and discloses a molecular marker Chr1942920824 related to soybean seedling cold tolerance and application thereof. The application uses GWAS whole genome association analysis to combine a soybean population seedling cold tolerance phenotype, and obtains a stable and reliable InDel molecular marker Chr1942920824 closely linked to soybean seedling cold tolerance, which is located at the 42920824th position on the 19th chromosome of soybean, inserts or deletes a fragment as shown in SEQ ID NO. 1, and a primer pair corresponding to the molecular marker Chr1942920824 is designed. The application further provides a method for rapidly identifying soybean seedling cold tolerance by using the molecular marker, which is simple and fast, accurate in identification result, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker Chr1942920824 that is closely related to cold tolerance in soybean seedlings and its applications. Background Technology

[0002] Soybeans Glycine max Originating in China, soybeans (L.) Merr. have undergone a long period of domestication and become an important economic crop essential for human life, providing approximately 44% of protein and 27% of edible oil. They are a crucial food crop for improving living standards. In northern my country, especially the Northeast, soybean production is frequently subjected to cold stress, hindering growth and yield. Researching low-temperature resistance and developing effective control technologies (such as breeding cold-resistant varieties, chemical regulation, and physical protection) can significantly improve soybeans' resistance to cold damage, reduce yield losses due to low temperatures, and ensure safe soybean production. With global climate change and the increasing frequency of extreme low-temperature events, researching soybean low-temperature resistance and promoting the application of related technologies can enhance the stability and adaptability of soybean cultivation, reduce production risks, and thus promote the sustainable development of the soybean industry.

[0003] Genome-wide association studies (GWAS) can simultaneously detect genetic variation within a large population across the entire genome, thereby identifying key genes or loci associated with traits. Molecular markers utilize the association between genetic markers and target traits for selection, thereby identifying individuals or genotypes possessing the target trait. Currently, numerous molecular markers have been successfully developed and applied to crop genetic breeding and genetic diversity analysis. Among them, InDel (inserted or deleted segments in the genome) markers, based on specific primers designed according to the sequences flanking the target locus or the inserted segment, are used for PCR amplification, exhibiting polymorphism in the length of the amplified fragment. These markers are characterized by clear bands, strong stability, and cost-effectiveness, and are increasingly being used in crops.

[0004] Therefore, this study, by combining genome-wide association analysis to develop molecular markers related to cold stress, is one of the effective means to accelerate the breeding process of new soybean varieties and is conducive to promoting the cultivation of cold-resistant soybean varieties. Summary of the Invention

[0005] One of the objectives of this invention is to provide an InDel molecular marker related to cold tolerance in soybean seedlings.

[0006] The second objective of this invention is to provide the application of the InDel molecular markers mentioned above that are related to cold tolerance in soybean seedlings.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] This invention utilizes GWAS genome-wide association analysis combined with the cold tolerance phenotype of soybean seedlings to obtain a stable and reliable InDel molecular marker Chr1942920824 that is closely linked to cold tolerance in soybean seedlings. The molecular marker is located at positions 42920825-42920920 on chromosome 19 of the soybean reference genome Glycine max Wm82.a4.v1, with the inserted or deleted fragment TTAAGGCCAATAAAAACCACCTAACATGAAAAATATACCGATATTATTCAACTAATTTTAAAATTTGAGTTAAAAGAATATAAAGTCTGCTTATAG (shown in SEQ ID NO.1).

[0009] Primer pairs were used to amplify the InDel molecular marker associated with cold tolerance in soybean seedlings. The primer pair sequence corresponding to the molecular marker Chr1942920824 is as follows:

[0010] Chr1942920824-F:GAATATAAAGTCTGCTTATAG (SEQ ID NO.2);

[0011] Chr1942920824-R: TCAAACCACGGGTTTCAACAG (SEQ ID NO. 3).

[0012] This invention also discloses the application of the above-mentioned molecular marker primer pairs in marker-assisted breeding related to cold tolerance in soybean seedlings. In other words, the molecular markers of this invention can be used in future marker-assisted breeding to determine whether soybean seedlings are cold-tolerant, thus determining whether soybean materials are cold-tolerant or cold-sensitive (cold stress sensitive).

[0013] This invention also discloses the application of the molecular markers in screening and identifying cold tolerance in soybeans. Specifically, the specific steps for identifying cold tolerance in soybean seedlings are as follows:

[0014] Using DNA from the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Chr1942920824. The PCR amplification reaction system is shown in Table 1.

[0015] Table 1. Reaction system for PCR amplification

[0016]

[0017] Pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.

[0018] Agarose gel electrophoresis detection of PCR products: Take 3 μL and judge the cold tolerance of soybean seedlings based on the band results.

[0019] PCR amplification was performed using primers Chr1942920824-F and Chr1942920824-R. If the PCR amplified a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was cold-resistant; if the PCR did not amplify a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was not cold-resistant.

[0020] In addition, this invention also protects a kit for identifying cold tolerance in soybean seedlings, the kit containing primer pairs Chr1942920824-F and Chr1942920824-R. Other components of the kit are conventional reagents. Specifically, it also includes 2×Taq DNA polymerase and distilled water. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 2×Taq DNA polymerase and distilled water; common PCR amplification reagents well-known in the art can be used.

[0021] The kit of this invention can rapidly identify the cold tolerance of soybean seedlings and the genotype of cold tolerance in soybean seedlings. The specific method follows the steps for identifying cold tolerance in soybean seedlings. Electrophoresis is performed on the PCR amplification products. PCR amplification is performed using primers Chr1942920824-F and Chr1942920824-R. If the PCR amplifies a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean is of the cold-tolerant genotype; if the PCR does not amplify a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean is of the cold-intolerant genotype.

[0022] The present invention has the following advantages:

[0023] (1) The inventors of this invention screened out a molecular marker Chr1942920824 that is related to cold tolerance of soybean seedlings. This molecular marker is located on chromosome 19. Using the molecular marker Chr1942920824 of this invention, the resistance of soybean seedlings to low temperature stress can be quickly identified.

[0024] (2) Screening using molecular markers linked to cold tolerance in soybean seedlings is beneficial for marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0025] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification related to cold resistance in soybean seedlings. Attached Figure Description

[0026] Figure 1 The results of the genome-wide association analysis (GWAS) of cold tolerance in soybean seedlings are presented in a Manhattan plot obtained using GAPIT software. The horizontal axis represents the genomic location of SNP loci in the core soybean germplasm population; the vertical axis represents the negative logarithm (base 10) of the p-value for each marker locus in the MLM model.

[0027] Figure 2 This is a quantile-quantile plot for genome-wide association analysis of cold tolerance in soybean seedlings.

[0028] Figure 3 This is a box plot showing the genotype distribution of the Chr1942920824 locus in the soybean population of Example 1 of this invention.

[0029] Figure 4 Electrophoresis images of the amplified Chr1942920824 molecular marker from 24 soybean germplasm resources, using an agarose gel with a concentration of 3%. In the figure, M represents the DNA marker. Detailed Implementation

[0030] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are all conventional methods.

[0031] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0033] Example 1: Location of candidate regions involved in the regulation of soybean cold stress

[0034] The genome-wide association analysis population used in this invention comes from the core soybean germplasm collected by the soybean team led by Wang Xuelu of the Sanya Research Institute of Henan University. The geographical distribution information of these soybean resources has been disclosed in the article "Zhang B, Wang M, Sun Y, Zhao P, Liu C, QingK, Hu X, Zhong Z, Cheng J, Wang H, Peng Y, Shi J, Zhuang L, Du S, He M, Wu H, Liu M, Chen S, Wang H, Chen X, Fan W, Tian K, Wang Y, Chen Q, Wang S, Dong F, Yang C, Zhang M, Song Q, Li Y, Wang X. Glycine max NNL1 restricts symbiotic compatibility with widely distributed bradyrhizobia via root hair infection. Nature Plants. 2021 Jan;7(1):73-86.". These soybean resources mainly include landraces that have evolved through long-term natural selection and artificially bred varieties. Geographically, these soybean varieties are widely distributed in Asia, Europe, Australia, and North America. China boasts the richest soybean germplasm resources, accounting for 93% of the total, and is widely distributed throughout the north and south, as well as the main soybean-producing areas of the Huang-Huai-Hai Plain. North America accounts for 2.6%, ranking second. The remaining germplasm resources come from Asia (1.6%), Europe (0.8%) (the least distributed), and Australia (2.2%). The wide distribution of germplasm resources is closely related to the diversity of population genetic background.

[0035] We began cold stress treatment on soybean core germplasm seedlings at three weeks of age in the culture room. Excluding differences in germination, we obtained 242 germplasm materials with relatively uniform growth. These materials were then placed in a 4°C cold storage facility and subjected to cold stress treatment for one week under dark conditions. Once we observed phenotypic polymorphism in the soybean population—characterized by tolerance to low temperatures and sensitivity to wilting—the soybean population was moved to a culture room with normal culture conditions for recovery treatment. After 24 hours of recovery, the materials sensitive to low temperatures began to exhibit a phenotype of leaf dehydration and death. Therefore, we decided to perform perforation sampling 24 hours after cold treatment to measure the electrical conductivity of the first pair of three leaves. Detailed electrical conductivity data are shown in Table 2.

[0036] Table 2. Relative electrical conductivity of 242 soybean germplasms after low-temperature stress and corresponding genotypes at each locus.

[0037]

[0038]

[0039]

[0040] Based on the relative conductivity data in Table 2, combined with population genome sequence information, GWAS analysis was performed. A mixed linear model (MLM) was used, and Manhattan plots and Quantile-Quantile plots were generated using GAPIT software. Figure 1 and Figure 2 We can see a peak in the 19th chromosome region of the Manhattan plot that is significantly above the threshold, namely the region containing Chr1942920824, indicating that the candidate regions we obtained are significantly associated with the soybean cold tolerance trait. The QQ plot shows that the point in the upper right corner is significantly off the diagonal, indicating that the variant sites in the candidate regions are significantly associated with the soybean cold stress trait.

[0041] We identified the InDel site Chr1942920824 in the candidate regions. To examine the association between this natural variation site and the cold stress phenotype, we constructed a box plot based on the relative conductivity data of soybean germplasm corresponding to the insertion and deletion haplotypes. Figure 3 As can be seen, there is a significant difference in the conductivity values ​​corresponding to the two haplotypes, indicating that this natural variation site is closely related to the soybean cold stress phenotype.

[0042] Example 2: Development of molecular markers related to cold tolerance in soybean seedlings

[0043] This invention measures the cold tolerance of soybean seedlings by the electrical conductivity of the first three-leaf stage after cold stress treatment. GWAS analysis located an InDel locus in the candidate region, named Chr1942920824. This locus is located at position 42920824 on chromosome 19 of the soybean reference genome Glycine max Wm82.a4.v1 (downloadable at: https: / / phytozome-next.jgi.doe.gov / ). The first allele is type A, consisting of a single T base; the second allele is type B, consisting of a 97 bp fragment: TTTAAGGCCAATAAAAACCACCTAACATGAAAAATATACCGATATTATTCAACTAATTTTAAAATTTGAGTTAAAAGAATATAAAGTCTGCTTATAG (SEQ ID NO. 5). Therefore, the difference between the two alleles lies in the insertion or deletion of a 96 bp segment at positions 42920825-42920920 on chromosome 19: TTAAGGCCAATAAAAACCACCTAACATGAAAAATATACCGATATTATTCAACTAATTTTAAAATTTGAGTTAAAAGAATATAAAGTCTGCTTATAG (SEQ ID NO.1). Based on the characteristics of this InDel site, we designed a forward primer Chr1942920824-F for this insertion or deletion segment, with the sequence GAATATAAAGTCTGCTTATAG (SEQ ID NO.2), and a reverse primer Chr1942920824-R downstream of it, with the sequence TCAAACCACGGGTTTCAACAG (SEQ ID NO.3).

[0044] Example 3: Application of Chr1942920824 molecular marker for identifying low-temperature resistance in soybean materials

[0045] We selected 12 low-temperature resistant germplasm materials (black soybean, Jiunong 16, AGS292, Hartwig, Hebei soybean, Yuechun 03-5, Jindou 40, flat soybean, brown soybean 1, Heinong 37, Tiehei soybean, Qingji 12) and 12 low-temperature sensitive germplasm materials (Linhe black plum soybean, Jindou 36, Pingdingxiang, Suinong 14, Jilin 6, Jichang soybean 1, Tiefeng 29, Chunhei soybean, Dahei soybean, Houjiaqiao Yuandou, Yangyanjing, Jindou 15) from the soybean population and extracted genomic DNA. We used the above molecular marker primer pairs Chr1942920824-F and Chr1942920824-R to verify the association between the low-temperature resistance phenotype of soybean germplasm and this natural variation site by conventional PCR amplification. Figure 4 As shown, germplasm materials sensitive to low-temperature stress could not amplify the 376 bp fragment shown in SEQ ID NO. 4, while low-temperature tolerant soybean germplasm materials could amplify this fragment. This indicates a strong correlation between the variation type of this natural variation site and the phenotype of our soybean population to low-temperature stress. Based on the primer design characteristics, the ability to amplify a band indicates the presence of this insert fragment, while the inability to amplify a band indicates the absence of this fragment. That is, low-temperature tolerant soybean germplasm materials all contain the 96 bp insert fragment and are genotype B, while low-temperature stress sensitive germplasm materials all lack this fragment and are genotype A. This molecular marker is simple, convenient, and efficient for identifying low-temperature resistance phenotypes in soybean seedlings.

[0046] Among them, SEQ ID The sequence of NO.4 is: GAATATAAAGTCTGCTTATAGATTTAGTATCAACCAATTATAAATTTCTTAAAAAAAACAATTAGAAATCATTTGACATATAACTTTTAAAATAATTCAAATGTCAACAACTTTATTATATTTAAAATTTGTATATTTTTACATCATCATTAAATTTAACACAAATTCAAAAAACAACAAT TGGTTTTATCAATAATAACAAAACCACAAAATTAAGAAAATGAATTTTAGTTCAAATTACCATAAAAACCTATTAGCATTGTGTATTTAGAGAGTGTTTGTGAAAGAATTTGACCCAAGTGAAAGCTTTTCCATGTTATTTTGGTATTTTTGCTTTTAAAAGTAAAATTTTTCTGTTGAAACCCGTGGTTTGA.

[0047] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The application of primer pairs for amplifying the InDel molecular marker Chr1942920824, which is associated with cold tolerance in soybean seedlings, in the identification of cold tolerance in soybean seedlings, characterized in that, The molecular marker Chr1942920824 is a fragment inserted or deleted at positions 42920825-42920920 on chromosome 19 of the soybean reference genome Glycine max Wm82.a4.v1, as shown in SEQ ID NO.

1. The primer pair sequence for amplifying the molecular marker Chr1942920824 is as follows: Chr1942920824-F:GAATATAAAGTCTGCTTATAG; Chr1942920824-R: TCAAACCACGGGTTTCAACAG; PCR amplification was performed using primers Chr1942920824-F and Chr1942920824-R. If the PCR amplified a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was cold-resistant; if the PCR did not amplify a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was not cold-resistant.

2. A method for identifying the cold tolerance of soybean seedlings, characterized in that, Includes the following steps: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed on Chr1942920824-F and Chr1942920824-R using the primers of the molecular marker Chr1942920824 described in claim 1, and the PCR amplification products were detected by electrophoresis. (3) The determination is based on the electrophoretic bands from step (2), and the specific criteria are as follows: PCR amplification was performed using primers Chr1942920824-F and Chr1942920824-R. If the PCR amplified a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was cold-resistant; if the PCR did not amplify a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was not cold-resistant.

3. The application of a reagent kit in identifying cold-resistant genotypes in soybean seedlings, characterized in that, The kit contains the primer pair described in claim 1, and the method for identifying the cold-resistant genotype of soybean seedlings using the kit is as follows: (1) Extract soybean genomic DNA; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed on Chr1942920824-F and Chr1942920824-R using primers of the molecular marker Chr1942920824. The PCR amplification products were then detected by electrophoresis. If the PCR amplified a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was a cold-resistant genotype. If the PCR could not amplify a characteristic band of 376 bp as shown in SEQ ID NO.4, the soybean was a cold-intolerant genotype.