Application of miR-183 overexpression reagent in medicine for promoting ovarian granular cell proliferation

The reagent that overexpresses miR-183 solved the problem of inhibited proliferation of ovarian granulosa cells, promoted the proliferation of ovarian granulosa cells, and improved follicle development and ovulation.

CN121931032APending Publication Date: 2026-04-28SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN AGRI UNIV
Filing Date
2026-01-29
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Impaired proliferation of ovarian granulosa cells affects follicle development and ovulation, and current technologies are insufficient to effectively promote their proliferation.

Method used

By using reagents that overexpress miR-183, including gene editing technology, miR-183 miRNA mimics, small molecule drugs, or plasmids/lentiviruses, the expression of miR-183 in vivo can be increased, thereby promoting the proliferation of ovarian granulosa cells.

Benefits of technology

It effectively rescued the granulosa cell proliferation inhibition induced by Poly(i:c), restored the cell's proliferative capacity, and enhanced the development and ovulation process of follicles.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121931032A_ABST
    Figure CN121931032A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of a reagent for overexpressing miR-183 in a medicine for promoting ovarian granular cell proliferation and application of the reagent for overexpressing miR-183 in the medicine for promoting ovarian granular cell proliferation, and the reagent for overexpressing miR-183 is characterized in that the sequence of miR-183 is as shown in SEQ ID NO.1, and the sequence of miR-183 is as shown in SEQ ID NO.2. The invention finds that overexpression of miR-183 can effectively rescue cell proliferation obstruction induced by Poly (i: c), and inhibition of miR-183 can cause cell proliferation obstruction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of reagents that overexpress miR-183 in drugs that promote the proliferation of ovarian granulosa cells. Background Technology

[0002] As an important somatic cell component of the ovary, ovarian granulosa cells play an irreplaceable role in maintaining normal ovarian physiological function. They not only participate in follicle development, maturation, and ovulation, but also undertake the synthesis and secretion of steroid hormones, significantly contributing to the homeostasis of the female reproductive endocrine system. Granulosa cells also play a crucial defensive role in the construction of the ovarian immune defense network, resisting the invasion of pathogenic microorganisms.

[0003] Ovarian granulosa cells, originating from the primordial follicle stage, accompany the development, maturation, and ovulation of the follicle. Based on their location within the follicle and their biological function, they are classified into two types: cumulus granulosa cells and parietal granulosa cells. Cumulus granulosa cells form the pseudostratified epithelial structure surrounding the oocyte, primarily supporting oocyte development. Since the oocyte's ability to utilize glucose is limited, it receives most of its nutrition from the cumulus granulosa cells. Parietal granulosa cells, located in the inner layer of the follicle wall, form a pseudostratified epithelial structure in contact with the basement membrane and adjacent to the outer membrane. As receptors for hormone stimulation, they gradually transform into part of the corpus luteum after ovulation, participating in subsequent hormonal regulation. The close connection between the oocyte and granulosa cells not only compensates for the oocyte's limited ability to absorb small metabolites but also provides the necessary nutrients for oocyte growth. Granulosa cells precisely regulate the metabolic activities of the developing oocyte by controlling the synthesis rate and phosphorylation modification pattern of key proteins. Granulosa cell apoptosis is highly correlated with follicular atresia. In dominant follicles, granulosa cells act as estrogen receptors, maintaining follicular development through multiple mechanisms, including estradiol secretion, gap junction communication, and peroxide scavenging. Therefore, analyzing the abundance of non-apoptotic granulosa cells in sow ovaries can assess the reproductive performance of the breed, and selective breeding targeting ovarian granulosa cells can improve production performance.

[0004] Granulosa cells play an important role in follicular atresia, oocytes acquiring fertilization capacity, embryogenesis regulation, and follicular microenvironment regulation. (1) Granulosa cells participate in the regulation of the entire process of meiotic maturation of follicles. The pre-ovulatory surge of luteinizing hormone (LH) induces meiotic maturation in vivo, but oocytes lack LH receptors, while parietal granulosa cells are receptors for secreting hormones. Therefore, the induced maturation process of follicles is mediated by granulosa cells. Subsequently, granulosa cells induce fully developed oocytes to complete the first meiotic division and arrest again in metaphase II. The meiotic inhibition effect may be due to the transmission of oocyte maturation inhibitory factors from granulosa cells that make up the follicle wall to the oocyte through gap junctions. Subsequently, the cumulus granulosa cells surrounding the germ cells undergo expansion or mucinization, inducing cytoplasmic maturation. Mature cytoplasm includes the deposition of extracellular matrix rich in hyaluronic acid, leading to granulosa cell expansion and separation. The loss of gap junctions caused by the expansion and separation of these cells leads to a reduction in the amount of meiotic inhibitory substances transmitted to the oocytes. However, the stimulation of granulosa cells by gonadotropins may induce the generation of maturation signals, thereby overcoming the meiotic inhibition mechanism of follicles. Finally, the nuclear-matured oocytes are released from meiotic arrest, while metaphase II oocytes are still surrounded by expanded cumulus granulosa cells and are released into the fallopian tube in preparation for fertilization. (2) Granulosa cells participate in the regulation of biological processes such as follicular atresia, follicle development, oocytes acquiring fertilization capacity, and embryogenesis. Gonadotropin-releasing hormone (GnRH) secreted by the hypothalamus regulates the secretion of gonadotropins (FSH) and luteinizing hormone (LH) by activating the hypothalamus-pituitary-ovarian axis. It is noteworthy that during follicular atresia, granulosa cells initiate the apoptosis program earlier than oocytes and theca cells. This time difference suggests that granulosa cells may be the initiating cell type that triggers follicular atresia. The specific mechanism is reflected in the negative feedback effect of the ovary: the androgens produced by the membrane cells are used by the granulosa cells as raw materials for the synthesis of estradiol, while the granulosa cells themselves produce inhibin. Estradiol and inhibin inhibit FSH secretion by synergistically regulating the hypothalamus-pituitary-ovarian axis, thereby hindering the growth and development of secondary follicles. The pleiotropic factors secreted by the granulosa cells (such as gonadotropins, growth factors and cytokines) constitute the local microenvironment, which maintains their own survival and promotes follicle growth. During the selection of dominant follicles, the granulosa cells acquire functional LH receptor expression, and their increased dependence on LH signaling promotes the continuous development of follicles, and finally completes the physiological process of ovulation under the trigger of LH peak. In addition, co-culturing mature oocytes with additional cumulus or parietal granulosa cells can improve the developmental potential of oocytes in many species. This may be because the cumulus granulosa cells and parietal granulosa cells produce specific substances that enable oocytes to acquire the ability to fertilize and develop embryos, but the specific mechanism needs further verification. (3) As the helper cells of oocytes, the functions of cumulus granulosa cells include delivering metabolic substrates and nutrients required for oocyte maturation.The proliferation and differentiation process of this cell population is highly synchronized with the maturation of oocytes, and the two form a functional community through metabolic coupling. However, the oocytes themselves have limited glucose metabolism capacity, and their energy demand mainly depends on the supply of pyruvate produced by the mitochondria of cumulus cells. This transcellular energy transfer mechanism is of great significance for oocytes to acquire maturation capacity. Granulosa cells metabolize glucose captured in the follicular microenvironment through glycolysis and provide pyruvate produced by glycolysis to oocytes through gap junctions. In addition, during follicular growth, cumulus cells produce ATP and increase the supply of ATP to oocytes. Through gap junction communication, they provide key metabolites and energy to developing oocytes, including molecules such as cAMP and ions such as chloride, calcium and sodium. These substances are transferred to oocytes to ensure the acquisition of the molecular mechanisms required to support early embryonic development, thereby helping oocyte development. (4) Because oocytes have insufficient glucose metabolism capacity, they are highly dependent on mitochondrial oxidative phosphorylation (OXPHOS) to obtain energy. Mitochondrial ATP is the primary energy source for FSH-dependent granulosa cell proliferation and differentiation during follicular development, produced through mitochondrial oxidative phosphorylation in the electron transport chain (ETC) complex. During FSH-induced follicular development, the production of reactive oxygen species (ROS) increases significantly due to increased mt-OXPHOS. ROS are an unavoidable natural byproduct of mt-OXPHOS; excessive ROS induces oxidative damage to mtDNA, oxidation of specific amino acids, and lipid peroxidation, reducing granulosa-oocyte communication that affects pre-ovulatory oocyte quality, ultimately inducing apoptosis and cell death. Oocytes themselves lack the capacity to mobilize all necessary antioxidant defense mechanisms; this protection is provided by surrounding granulosa cells, whose metabolites glutathione and melatonin are particularly important during this maturation stage. Furthermore, during glucose metabolism in granulosa cells, reduced nicotinamide adenine dinucleotide phosphate (NADPH) is produced for biosynthesis via the pentose phosphate pathway, contributing to the oocyte's redox balance.

[0005] In female mammals, the number of primordial follicles in reserve is determined during embryonic development. After puberty, these primordial follicles gradually evolve into antral follicles, eventually maturing and being released from the body. This process is the result of competition among primordial follicles; 99% of follicles undergo atresia and fail to mature. Follicles primarily contain two cell types: granulosa cells and oocytes. Granulosa cells supply energy to oocytes, regulate reactive oxygen species levels in the follicular microenvironment, and establish intercellular functions. Granulosa cell apoptosis and oxidative stress may influence follicular atresia. In the ovarian physiological environment, miRNAs regulate granulosa cell fate by targeting mRNAs. Some miRNAs promote granulosa cell proliferation by inhibiting specific gene expression, ensuring the number of cells required for follicle growth. Other miRNAs regulate follicular atresia by activating apoptosis pathways, maintaining a dynamic balance in follicular development. Therefore, it is necessary to determine the effects of specific miRNAs on granulosa cells. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides the application of reagents that overexpress miR-183 in drugs that promote the proliferation of ovarian granulosa cells.

[0007] The application of a reagent that overexpresses miR-183 in drugs that promote the proliferation of ovarian granulosa cells, wherein the sequence of miR-183 is: UAGGCACUGGUAGAAUUCACU, denoted as SEQ ID NO.1.

[0008] This invention discovers that overexpression of miR-183 can effectively rescue granulosa cell proliferation inhibition, while inhibition of miR-183 leads to granulosa cell proliferation inhibition. Therefore, the application of reagents that overexpress miR-183 in drugs that promote ovarian granulosa cell proliferation is proposed.

[0009] Preferably, the reagent for overexpressing miR-183 is a reagent used to increase the expression of miR-183 in vivo using gene editing technology, miRNA mimics of miR-183, small molecule drugs that promote the expression of miR-183 using small molecule drugs, plasmids / lentiviruses that promote the expression of miR-183 in vivo using plasmids / lentiviruses, or miR-183 agonists.

[0010] Preferably, the nucleotide sequence of the miRNA mimics is shown in SEQ ID NO.3.

[0011] A preferred method for overexpressing miR-183 is to transfect ovarian granulosa cells with the sequence shown in SEQ ID NO.3.

[0012] Preferably, the transfection step is as follows: adding the transfection solution to a culture plate of ovarian granulosa cells for culturing; The transfection solution is a mixture of liposome transfection reagent and the sequence shown in SEQ ID NO.3.

[0013] Preferably, the dosage form of the drug or reagent is either an oral dosage form or an injectable dosage form.

[0014] Preferably, the drug further comprises pharmaceutically acceptable excipients or carriers.

[0015] Preferably, the ovarian granulosa cells are any one of human, mouse, or pig ovarian granulosa cells.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention reveals that Poly(i:c) inhibits granulosa cell proliferation. Sequencing of the Poly(i:c)-treated and control groups showed that miR-183 could be a differentially expressed gene. Treatment of mouse granulosa cells with 5 μg / mL Poly(i:c) and qRT-PCR detection showed that the expression level of miR-183 in the 5 μg / mL Poly(i:c)-treated group showed a significant down-regulation trend, consistent with the sequencing results. This further demonstrates that overexpression of miR-183 can effectively rescue Poly(i:c)-induced cell proliferation inhibition, while inhibition of miR-183 leads to cell proliferation inhibition. Attached Figure Description

[0017] Figure 1 To investigate the inhibitory effect of Poly(i:c) on granulosa cell proliferation, A shows the effect of CCK assay on the inhibitory effect of different concentrations of Poly(i:c) on granulosa cell proliferation; B shows the change in the expression level of the proliferation and apoptosis maker gene in the 5 μg / mL Poly(i:c) treatment group and the control group by qRT-PCR; C shows the change in the expression level of the proliferation and apoptosis maker gene in the 5 μg / mL Poly(i:c) treatment group and the control group by Western blotting. BCL-2 , BAX Changes in protein expression levels.

[0018] Figure 2 MicroRNA characterization analysis was performed on the 5 μg / mL Poly(i:c) treatment group and the control group. A represents the number of microRNAs in the Poly(i:c) treatment group and the control group; B represents the length characteristics of microRNAs in the Poly(i:c) treatment group and the control group; C represents the source statistics of microRNAs in the Poly(i:c) treatment group and the control group; and D represents the abundance statistics of the top 15 microRNAs in the Poly(i:c) treatment group and the control group.

[0019] Figure 3For microRNA downstream target gene functional enrichment analysis, A is the differential microRNA downstream target gene GO functional enrichment analysis; B is the differential microRNA downstream target gene KEGG functional enrichment analysis.

[0020] Figure 4 To investigate the effect of miR-183 knockdown on granulosa cell proliferation, A shows the trend of miR-183 expression in mouse granulosa cells treated with 5 μg / mL Poly(i:c) as detected by qRT-PCR, consistent with sequencing results; B shows the changes in the expression level of the proliferation and apoptosis maker gene in the 5 μg / mL Poly(i:c), miR-183 knockdown group, and the 5 μg / mL Poly(i:c) + miR-183 overexpression group detected by qRT-PCR; C shows the Western blot analysis of miR-183 knockdown-treated granulosa cells. BAX , BLC-2 Changes in protein expression levels.

[0021] Figure 5 This is the structure of Poly(i:c). Detailed Implementation

[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0023] The structural formula of Poly(i:c) in this invention is shown below. Figure 5 .

[0024] Test methods 1. Collect pig ovaries and separate follicles. After thorough rinsing with pre-warmed physiological saline at 38±1℃ to remove blood contamination, porcine ovaries were immediately transferred to 1xPBS preservation medium containing 1% penicillin and streptomycin antibiotics and stored in an incubator pre-temperatured to 38.6℃ to maintain physiological temperature before transport to the laboratory. Ovarian specimens were first rinsed twice with sterile 1xPBS buffer, followed by surface disinfection with 75% ethanol (analytical grade) for 15 seconds, and then rinsed a second time with 1xPBS buffer. The ovarian cortex was then incised with a sterile scalpel, and the cortical tissue was carefully torn apart with ophthalmic forceps. Follicle separation was performed using fine forceps. Specifically, the connective tissue surrounding the follicle was completely dissected, and the follicle was gently agitated along the base of the medulla to ensure complete detachment from the ovarian matrix. The separated follicles were washed twice with DME / F12 medium containing 1% penicillin and streptomycin antibiotics and then transferred to pre-sterilized cell culture dishes. The culture system used DME / F12 complete culture medium containing 1% penicillin and streptomycin, and the culture conditions were set at a constant temperature of 37℃ and a cell culture incubator with a concentration of 5% CO2 for in vitro culture.

[0025] 2. Preparation of transcriptome sequencing samples After connective tissue removal, follicles were transferred to a sterile operating table, and residual culture medium on the follicle surface was thoroughly absorbed using sterile filter paper. A single wash was performed using PBS buffer containing 1% penicillin and streptomycin, followed immediately by a second absorption using sterile filter paper to ensure no liquid residue remained on the sample surface. The dried follicles were then rapidly transferred to liquid nitrogen for ultra-low temperature freezing. Once all samples were collected, the cryovials were transferred to a -80°C cryogenic storage chamber for long-term storage; the chamber temperature was monitored in real-time using an electronic monitoring system. Three control samples and three Poly(i:c) treated samples were ultimately selected for transcriptome analysis.

[0026] 3. Follicle sample processing Follicles were gently inserted into 6-well cell culture plates using ophthalmic forceps, and 5 mL of F12 serum-free medium was added to each well. For the control group, 5 μL of ultrapure water was added per milliliter. In the 2 μg / mL, 5 μg / mL, and 10 μg / mL treatment groups, 10 μL, 25 μL, and 50 μL of Poly(i:c) solution, pre-diluted with ultrapure water to 1 mg / mL, were added to each well, respectively. After addition, the mixture was gently shaken to mix, and then incubated at 37°C in a 5% CO2 incubator for 24 hours.

[0027] 4. Degree of follicular atresia assessment Freshly collected follicle samples were blotted with sterile filter paper to remove any residual PBS solution containing 1% penicillin and streptomycin. The follicle diameter was then precisely measured using calipers, and samples of 4-5 mm were selected for subsequent testing. After pretreatment, follicles were classified according to their morphological characteristics: healthy follicles appeared pink with a clear vascular network and good translucency; early atretic follicles appeared pale pink with a few visible vascular structures but significantly reduced translucency; late atretic follicles appeared milky white to pale yellow with no vascular structures on the surface and obvious internal turbidity. The judgment criteria are shown in Table 3.

[0028] Table 3: Criteria for Judging the Degree of Follicular Atresia 5. Resuscitation and Culture of Mouse Granulosa Cell Lines (1) Quickly remove the frozen MGC mouse granulocytes from the liquid nitrogen tank and place them in a 37°C constant temperature water bath to stir and thaw.

[0029] (2) Quickly place the cryopreservation tube in a clean bench, use a pipette to aspirate the cryopreservation solution into a 15mL centrifuge tube, add 1mL of complete culture medium containing 10% fetal bovine serum, and centrifuge at 1500rpm for 3min.

[0030] (3) After centrifugation, observe whether there is cell precipitation. If so, discard the supernatant, add 5 mL of complete culture medium containing 10% fetal bovine serum, gently pipette the cells to form a cell suspension, and finally inoculate them into T25 cell culture flasks. Place the culture flasks in a constant temperature incubator with 5% carbon dioxide and 37°C for culture. Observe the cell morphology after 24 hours and passage the cells.

[0031] 6. Cell passage (1) Pre-place trypsin, complete culture medium containing 10% fetal bovine serum and phosphate buffer (PBS) in a 37°C water bath to ensure that the reagents reach the optimal reaction temperature.

[0032] (2) Remove the cell culture flask to be passaged from the incubator, remove the original culture medium, and add pre-warmed PBS for a single wash to remove residual serum.

[0033] (3) Add 1 mL of pre-warmed trypsin digestion solution and immediately put the culture container back into the incubator for 1 minute of enzymatic digestion.

[0034] (4) Take out the cell culture flask and add 3 mL of complete culture medium containing 10% fetal bovine serum to terminate the enzymatic digestion process.

[0035] (5) Transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1200 rpm for 3 minutes, discard the supernatant, add 10 mL of complete culture medium, resuspend the cells, and evenly distribute them into two T25 culture flasks. (6) Place the culture flask in a 5% CO2, 37℃ incubator for incubation.

[0036] 7. Cell transfection (1) Mouse granule cells were seeded into cell culture plates and transfected when the cell density reached 70%.

[0037] (2) Prepare transfection solution A: Take 3 μL / 0.3 μL Lipofectamine TM Add 3000 to 50 μL / 5 μL of Opti-MEM (corresponding to 12-well plate / 96-well plate), gently pipette to mix well, and incubate at room temperature for 5 min.

[0038] (3) Prepare transfection solution B: Take 50 μL / 5 μL minics (inhibitor is 100 μL / 10 μL) and add it to 50 μL / 5 μL Opti-MEM, mix well by pipetting, and incubate at room temperature for 5 min.

[0039] (4) Mix solution A and solution B, blow them evenly, and incubate at room temperature for 15 minutes.

[0040] (5) Add the incubated transfection solution to the cell culture plate, place it in a 5% carbon dioxide incubator at 37°C, and replace with fresh complete culture medium after 6 hours of culture.

[0041] 8. Collection of cell and tissue samples and extraction of RNA (1) After washing with phosphate-buffered saline (PBS), add 1 mL of TRIzol reagent to the cell culture wells and lyse at room temperature for 2 minutes. Ensure complete cell lysis by repeatedly pipetting, and then transfer the lysate to a 1.5 mL enzyme-free centrifuge tube.

[0042] (2) Weigh an appropriate amount of follicular tissue sample and place it in a 1.5 mL enzyme-free centrifuge tube. After cutting the tissue into small pieces with sterile surgical scissors, add 1 mL of TRIzol reagent and let it stand at room temperature for 5 minutes to ensure that the tissue is fully lysed.

[0043] (3) Initial centrifugation: Centrifuge at 12000 rpm for 5 minutes at 4℃, and carefully transfer the upper aqueous phase to a new 1.5 mL enzyme-free centrifuge tube.

[0044] (4) Chloroform extraction: Add 200 μL of chloroform, shake vigorously for 15 seconds to mix thoroughly, and let stand at room temperature for 5 minutes.

[0045] (5) Second centrifugation: Centrifuge at 12,000 rpm for 15 minutes at 4°C, and transfer the upper aqueous phase to a new centrifuge tube.

[0046] (6) RNA precipitation: Add an equal volume of isopropanol, gently invert to mix, and let stand at room temperature for 10 minutes.

[0047] (7) Precipitation collection: Centrifuge at 12,000 rpm for 10 minutes at 4°C and carefully discard the supernatant.

[0048] (8) Washing steps: Add 1 mL of pre-cooled 75% ethanol and gently invert to suspend the white RNA precipitate.

[0049] (9) Final centrifugation: Centrifuge at 12,000 rpm for 5 minutes at 4°C and discard the supernatant.

[0050] (10) Dissolution and preservation: Dry at room temperature for 2-5 minutes until the ethanol is completely evaporated, add 30-50 μL of enzyme-free water to dissolve the RNA, mix well, and then aliquot and store in an ultra-low temperature freezer at -80℃.

[0051] 9. mRNA reverse transcription The steps for mRNA reversal are shown in Table 4: Table 4: mRNA Reversal Components and Procedures 10. miRNA reverse transcription Table 5: Inversion components and steps of miRNA 11. qRT-PCR (1) Prepare the qRT-PCR reaction solution according to Tables 2.6 / 2.7, add the reaction solution to the quantitative plate, and set up 3 technical replicates for each sample. See Tables 6 and 7.

[0052] Table 6: mRNA qRT-PCR reaction steps and system Table 7: miRNA qRT-PCR reaction steps and system (2) Place the quantification plate in the groove inside the quantification machine, close the lid, and set the amplification program: 1. Pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 5 s, optimal annealing temperature for mRNA for 30 s, and 40 cycles at 72℃. The relative gene expression levels were calculated using the 2-ΔΔCt method. The quantification results for mRNA were corrected using ACTB as an internal reference, and the quantification results for microRNA were corrected using U6 as an internal reference. As shown in Table 8:

[0053] Table 8: mRNA primer sequences 12. Protein content detection (1) Take 0.8 mL of protein standard preparation solution and add it to a protein standard tube containing 20 mg BSA. After dissolving completely, prepare a protein standard stock solution of 25 mg / mL.

[0054] (2) Transfer 20 μL of the stock solution and mix it with 980 μL of PBS buffer to dilute and prepare a protein standard working solution with a concentration of 0.5 mg / mL.

[0055] (3) Based on the number of samples to be tested, mix BCA reagent A solution and B solution at a volume ratio of 50:1 to prepare an appropriate amount of BCA working solution. After thorough mixing, it is ready for use.

[0056] (4) Add 0, 1, 2, 4, 8, 12, 16 and 20 μL of protein standard working solution to the standard wells of the 96-well plate in sequence, and dilute to 20 μL with standard diluent to form a concentration gradient.

[0057] (5) Transfer 1 μL of the sample to be tested into the sample well of the 96-well plate and add PBS buffer to make up the volume to 20 μL.

[0058] (6) Add 200 μL of BCA working solution to all standard wells and sample wells, seal and incubate at 60°C for 30 minutes.

[0059] (7) Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of each well at a wavelength of 562 nm.

[0060] (8) Plot a standard curve based on the absorbance values ​​of the standard wells, and calculate the original protein concentration of the sample by combining the absorbance values ​​of the sample wells and the dilution factor through a linear regression equation.

[0061] 13. Western blotting (1) Protein extraction and quantification: Total protein was extracted from cells using RIPA cell lysis buffer (Beyotime, Shanghai, China) and quantified using BCA protein concentration assay kit (Beyotime, Shanghai, China).

[0062] (2) Gel preparation and electrophoresis: Polyacrylamide gels of the required concentration were prepared using an SDS-PAGE rapid gel preparation kit. Three-color pre-stained protein markers were added to both lanes of the gel, and approximately 20 μg of protein was loaded into the middle lane. Electrophoresis was first performed at a constant voltage of 80 V until the bromophenol blue indicator entered the separating gel. Then the voltage was adjusted to 120 V and electrophoresis was continued until the proteins were fully separated.

[0063] (3) Wet electrotransfer: The separated protein was transferred to a polyvinylidene fluoride (PVDF) membrane (ThermoScientific, Madison, WI, USA) using wet electrotransfer technology.

[0064] (4) Membrane blocking and washing: The PVDF membrane was immersed in TBST blocking solution containing 5% skim milk and blocked at room temperature for 2 hours. After blocking, the membrane was washed 5 times with TBST buffer, each time for 5 minutes.

[0065] (5) Antibody incubation and color development: The washed PVDF membrane was incubated overnight with the primary antibody at 4°C, followed by washing three times with TBST buffer for 10 minutes each time. After washing, the membrane was incubated with the secondary antibody at room temperature for 1 hour, followed by washing four more times with TBST buffer for 5 minutes each time. Finally, the color reaction was performed using a high-sensitivity ECL chemiluminescence kit (ThermoScientific, Madison, WI, USA).

[0066] (6) Image acquisition and analysis: Exposure and image acquisition were performed using the Tanon 5200 chemiluminescence imaging analysis system (Tanon, Shanghai, China).

[0067] Data statistics and analysis All data were statistically analyzed using GranphPad Prism 8. A p-value < 0.05 was considered statistically significant. Data are expressed as mean ± standard deviation (mean ± SD).

[0068] result 1. Poly(i:c) inhibits granulosa cell proliferation via miR-183. (1) Poly(i:c) inhibits granulosa cell proliferation Inhibition of granulosa cell proliferation is a crucial factor in follicular atresia. To investigate whether Poly(i:c) invasion can lead to inhibition of granulosa cell proliferation, granulosa cells treated with different concentrations (2 μg / mL, 5 μg / mL, and 10 μg / mL) of Poly(i:c) were analyzed using CCK-8 assays. The results showed that granulosa cell proliferation was inhibited to varying degrees at all concentrations of Poly(i:c). Figure 1 A). To further confirm that Poly(i:c) can inhibit granulosa cell proliferation, the expression levels of maker genes related to proliferation and apoptosis were detected by qRT-PCR in the control group and the 5 μg / mL Poly(i:c) treatment group. The results showed... Caspase 3 Expression levels were significantly upregulated. BCL-2 / BAX and PCNAThe expression level was significantly upregulated (P<0.05). Figure 1 B). WB detection BCL-2 , BAX Changes at the protein level were observed after Poly(i:c) treatment. BCL-2 Protein levels showed a significant downward trend. BAX Protein levels did not change significantly, but BCL-2 and BAX The ratio was significantly downregulated, indicating that Poly(i:c) treatment inhibited granulosa cell proliferation. Figure 1 C).

[0069] (2) microRNA sequencing analysis A total of 370 microRNAs were identified in the 5 μg / mL Poly(i:c) treatment group and the control group by high-throughput sequencing, of which 330 microRNAs were co-expressed in both groups. Figure 2 A). These microRNAs are mainly distributed in lengths of 20-23 nucleotides (A). Figure 2 B). Experimental analysis of microRNA categories revealed that the most prevalent microRNAs in both the Poly(i:c) treatment and control groups were from the Let-7 family. Figure 2 C). The abundance of miR-143-3p was highest in the control group, and the abundance of miR-21-5p was highest in the 5 μg / mL Poly(i:c) treatment group. Figure 2 D). Functional enrichment analysis of downstream target genes of these microRNAs ( Figure 3 (AB). The results showed that target genes were enriched in biological processes such as immune response and cellular senescence.

[0070] (3) Poly(i:c) mediates miR-183 to inhibit granulosa cell proliferation Previous studies have shown that downregulation of miR-183 can mediate the inhibition of cell proliferation and promotion of apoptosis by different target genes. In this experiment, mouse granulosa cells were treated with 5 μg / mL Poly(i:c), and qRT-PCR analysis revealed a significant downregulation of miR-183 expression in the 5 μg / mL Poly(i:c) treatment group, consistent with sequencing results. Figure 4 A).

[0071] This invention constructs miR-183 inhibitor and overexpression vectors to transfect mouse granular cells.

[0072] The miR-183 inhibitor is used to transfect cells to inhibit miR-183 expression. The nucleotide sequence of the miR-183 inhibitor is CAGTGAATTCTACCAGTGCCATA, denoted as SEQ ID NO.2.

[0073] Cell transfection with miR-183 mimics resulted in overexpression of miR-183. The nucleotide sequence of miR-183 mimics is: TATGGCACTGGTAGAATTCACT, denoted as SEQ ID NO.3.

[0074] qRT-PCR results showed that after transfection of cells with the miR-183 inhibitor, the expression of apoptosis maker genes showed a significant upregulation trend, while the expression of cell proliferation maker genes showed a significant downregulation trend. Simultaneously, mouse granulosa cells were co-transfected with a miR-183 overexpression vector and 5 μg / mL Poly(i:c). qRT-PCR results showed that overexpression of miR-183 effectively rescued Poly(i:c)-induced cell proliferation inhibition. Figure 4 B). The experiment used a Western blot (WB) test to compare the miR-183 inhibition group with the control group. BAX , BCL-2 Quantitative analysis of the protein revealed that inhibiting miR-183 leads to BCL-2 / BAX Lower ( Figure 4 C) indicates that inhibiting miR-183 leads to impaired cell proliferation.

[0075] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0076] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0077] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of a reagent overexpressing miR-183 in drugs promoting the proliferation of ovarian granulosa cells, characterized in that, The sequence of miR-183 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The reagents for overexpressing miR-183 include reagents used to increase the expression of miR-183 in vivo using gene editing technology, miRNA mimics of miR-183, small molecule drugs that promote the expression of miR-183 using small molecule drugs, plasmids / lentiviruses that promote the expression of miR-183 in vivo using plasmids / lentiviruses, or miR-183 agonists.

3. The application according to claim 2, characterized in that, The nucleotide sequence of the miRNA mimics is shown in SEQ ID NO.

3.

4. The application according to claim 3, characterized in that, Method for overexpressing miR-183: Transfect ovarian granulosa cells with the sequence shown in SEQ ID NO.

3.

5. The application according to claim 3, characterized in that, The transfection step is as follows: the transfection solution is added to a culture plate of ovarian granulosa cells for culture. The transfection solution is a mixture of liposome transfection reagent and the sequence shown in SEQ ID NO.

3.

6. The application according to claim 1, characterized in that, The dosage form of the drug or reagent is either oral or injectable.

7. The application according to claim 1, characterized in that, The drug also contains pharmaceutically acceptable excipients or carriers.

8. The application according to claim 1, characterized in that, The ovarian granulosa cells mentioned are any one of the ovarian granulosa cells of humans, mice, or pigs.