Engineered exosome of miR-146a-5p modified by LTH peptide and application of engineered exosome

Abstract

The invention discloses an engineered exosome of LTH peptide modified miR-146a-5p and application, the core component of the medicine is the engineered exosome, and the engineered exosome is constructed by the following method: miR-146a-5p mimic infected human renal tubular epithelium HK2 cells with nucleotide sequences shown as SEQ ID NO.1-SEQ ID NO.2 are cultured and screened, the exosome rich in miR-146a-5p is separated from the culture supernatant of the cells, and the exosome rich in miR-146a-5p is obtained. Then, the kidney targeting peptide LTH is modified on the surface of the exosome. The invention reveals that HNRNP M protein is a key molecule for regulating and controlling miR-146a-5p to be sorted and enter the exosome for the first time, and verifies that the engineered exosome can be efficiently enriched in kidney, and by delivering miR-146a-5p to target IRAK1 gene in macrophage and inhibiting TRAF6 / IKK / NF-kappa B inflammation signal pathway, the macrophage is promoted to be polarized to a repairable M2 phenotype, so as to realize the purpose of improving the activity of the miR-146a-5p. And finally, the kidney injury induced by the calcium oxalate crystal is effectively relieved. The medicine has the advantages of clear mechanism, strong targeting property, good biocompatibility and the like, provides a brand new immunoregulation treatment strategy for renal injury, and has a wide clinical application prospect.

Description

Technical Field

[0001] This invention relates to the field of cell biology technology, and in particular to an engineered exosome of miR-146a-5p modified with LTH peptide and its application. Background Technology

[0002] Calcium oxalate (CaOx) crystal-induced kidney injury is a core pathological link in the occurrence, development, and recurrence of kidney stones. Currently, there are no specific drugs for treating this type of kidney injury in clinical practice. Conventional treatments mainly focus on symptom relief, such as using diuretics, urine alkalization, and analgesic and anti-inflammatory drugs (such as nonsteroidal anti-inflammatory drugs). However, these methods often only treat the symptoms and not the root cause, failing to precisely intervene in the abnormal immune inflammatory response triggered by damage to renal tubular epithelial cells, especially failing to effectively regulate the functional polarization of key immune cells such as macrophages, thus making it difficult to prevent further aggravation of damage and the occurrence of fibrosis. Although some studies have explored the use of stem cells or their conditioned medium and other biological agents for kidney repair, these methods have many limitations, including complex preparation, high difficulty in standardization, potential safety risks, and unstable treatment effects.

[0003] Therefore, there is an urgent need in this field to develop a novel, highly effective drug with a clearly defined mechanism of action that can precisely target the immunopathological aspects of kidney injury, effectively promote tissue repair, and provide a new treatment strategy for calcium oxalate kidney injury. Summary of the Invention

[0004] The purpose of this invention is to provide a miR-146a-5p overexpressing cell line, miR-146a-5p exosomes, their preparation methods and applications, which can precisely target the immunopathological aspects of kidney injury, effectively promote tissue repair, and provide a novel treatment strategy for calcium oxalate kidney injury.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect of the present invention, a miR-146a-5p overexpressing cell line is provided, said cell line being the miR-146a-5p-HK2 cell line; the miR-146a-5p-HK2 cell line is prepared by the following method: Human renal tubular epithelial HK2 cells were infected with miR-146a-5p mimic, whose nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.2. After culture and screening, miR-146a-5p overexpressing cell lines were obtained.

[0006] The sequence of the miR-146a-5p mimic is as follows: sense (5'-3'): UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO.1); antisense (5'-3'): CCCAUGGAAUUCAGUUCUCAUU (SEQ ID NO.2); In a second aspect of the invention, an engineered exosome rich in miR-146a-5p is provided, the exosome being secreted by the miR-146a-5p-HK2 cell line.

[0007] In a third aspect of the invention, a method for preparing the engineered exosomes rich in miR-146a-5p is provided, the method comprising: The miR-146a-5p overexpressing cell line was cultured to obtain a culture medium; The culture medium was separated and purified to obtain exosomes.

[0008] In a third aspect of the invention, a kidney-targeting engineered exosome is provided, which is obtained by modifying the exosome with an LTH peptide, wherein the amino acid sequence of the LTH peptide is H-Lys-Gly-Pro or a similar variant.

[0009] Furthermore, LTH peptide modification can be performed using in vitro membrane anchoring technology or other methods. As a specific implementation method, LTH-modified exosomes can be achieved using a commercially available kit from Enzeconi Technology Co., Ltd., specifically the ExoBrooch®-LTH lipid anchor kit, catalog number Cat# EA-12-1.

[0010] In a fourth aspect of the invention, the use of the miR-146a-5p overexpressing cell line in the preparation of drugs for kidney injury is provided.

[0011] In a fifth aspect of the invention, the use of the engineered exosomes enriched with miR-146a-5p is provided in the preparation of drugs for kidney injury.

[0012] In a sixth aspect of the invention, the use of the aforementioned kidney-targeting engineered exosomes in the preparation of drugs for kidney injury is provided.

[0013] In a seventh aspect of the invention, a pharmaceutical composition for treating kidney injury is provided, comprising a therapeutically effective amount of the engineered cell line, or the engineered exosomes rich in miR-146a-5p, or the engineered exosomes that target the kidney, and a pharmaceutically acceptable carrier.

[0014] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: This invention successfully develops a novel treatment method for kidney injury with a clear mechanism, strong targeting, significant efficacy, and high safety, effectively overcoming many shortcomings of existing technologies and possessing the following advantages: (1) Mechanism Innovation and Clarity: The invention reveals a complete therapeutic pathway for the first time. This invention is not a simple application of components, but rather the first to construct and verify a complete signaling pathway from "pathogenic stimulation" to "functional regulation". Specifically, this invention reveals for the first time that under calcium oxalate stimulation, the RNA-binding protein HNRNP M is a key molecule regulating the sorting of miR-146a-5p into exosomes derived from renal tubular epithelial cells; and further confirms that these exosomes can be taken up by macrophages, and through the miR-146a-5p they carry, they target and silence the IRAK1 gene, thereby inhibiting the activation of the downstream TRAF6 / IKK / NF-κB core inflammatory signaling pathway, ultimately driving macrophages to polarize from the pro-inflammatory M1 type to the anti-inflammatory and repair-oriented M2 type. This clear and complete mechanism provides a solid theoretical basis and a clear target for drug development.

[0015] (2) A Leap Forward in Targeting and Precision of Treatment This invention successfully solves the common technical problem of insufficient targeting of exosomes as delivery carriers in kidney diseases by modifying LTH peptides through in vitro membrane anchoring. Experiments have shown that engineered exosomes modified with LTH peptides can efficiently accumulate in damaged kidney tissue in vivo, while distributing less in organs such as the liver and spleen. This active targeting capability brings two core advantages: first, it significantly increases the effective concentration of the drug at the lesion site, thereby enhancing the therapeutic effect; second, it reduces the potential side effects caused by systemic exposure, improves the safety of treatment, and achieves a leap from "broad-spectrum action" to "precision strike".

[0016] (3) Synergistic and Enhanced Therapeutic Effects This invention demonstrates excellent synergistic therapeutic effects. On the one hand, miR-146a-5p itself, as a negative regulator of inflammation, directly exerts a powerful anti-inflammatory effect; on the other hand, the precise targeting achieved by LTH peptide modification ensures that miR-146a-5p is efficiently delivered to target cells. The combination of these two factors produces a synergistic effect of "1+1>2". In animal models, compared with unmodified exosomes, LTH-modified engineered exosomes showed statistically significant enhancements in improving renal function indicators (such as serum creatinine and blood urea nitrogen), reducing renal tissue pathological damage, reducing calcium salt crystal deposition, and promoting M2 macrophage infiltration.

[0017] (4) Advantages in Safety and Translational Applications: The components used in this invention have natural biocompatibility advantages. Exosomes, as endogenous carriers, have low immunogenicity and are less likely to trigger immune rejection reactions. Compared with complex methods such as stem cell therapy, the production process of exosomes is easier to standardize and scale up, and the quality is more controllable. In particular, the in vitro membrane anchoring technology used in this invention is a mild and controllable chemical modification method that can maintain the integrity of the exosome structure and the stability of its internal bioactive substances to the greatest extent, avoiding the unpredictable risks that may be brought about by gene engineering methods, and has great clinical translational potential and industrialization prospects. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 PCR results demonstrating high expression of engineered exosomes secreted by the miR-146a-5p-HK2 cell line.

[0020] Figure 2 Experimental results of engineered exosomes promoting macrophage polarization to M2 type in vitro (flow cytometry analysis of M1 / M2 markers).

[0021] Figure 3 In vivo imaging of engineered exosomes targeting the kidney. Figure A shows the imaging images for each group, and Figure B is a flowchart.

[0022] Figure 4 The image shows the effect of engineered exosome therapy on the improvement of renal function (serum creatinine, blood urea nitrogen) and renal tissue pathology (TUNEL staining, Von Kossa staining) in a rat model of kidney injury. Figure 4 A is a quantitative statistical graph showing the serum creatinine (Scr) and blood urea nitrogen (BUN) levels of rats in each group after treatment. Figure 4 B is a quantitative statistical graph showing the serum creatinine (Scr) and blood urea nitrogen (BUN) levels of rats in each group after treatment.

[0023] Figure 5 : In vivo investigation of the mechanism by which EXO (miR-146a-5p) protects against and reverses calcium oxalate-induced kidney injury.

[0024] Figure 6 Evidence of HNRNP M protein sorting miR-146a-5p into exosomes. Among them, Figure 6A: After knocking down (KD) or overexpressing (OE) HNRNP M in HK2 cells, the expression level of miR-146a-5p in the cells was detected by qRT-PCR. Figure 6 B: with Figure 6 Corresponding to A, the content of miR-146a-5p in the exosomes secreted by HK2 cells in each group was detected. Figure 6 C: Results of RNA immunoprecipitation (RIP) experiment. Figure 6 D: Dual-luciferase reporter gene assay to verify the direct interaction between miR-146a-5p and the 3'UTR of the target gene IRAK1. Figure 6 E: Western blotting results. Figure 6 F: A schematic diagram of the complete signaling pathway of the molecular mechanism of this invention. Detailed Implementation

[0025] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0026] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0027] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0028] The present application will now be described in detail with reference to embodiments and experimental data.

[0029] Example 1: Construction of a miR-146a-5p-overexpressing HK2 cell line (miR-146a-5p-HK2) 1. Experimental objective: To construct a stable human renal tubular epithelial cell line overexpressing miR-146a-5p.

[0030] 2. Experimental methods: Cell transfection: HK2 cells were seeded into 6-well plates. When the cells reached 50% confluence, miR-146a-5p mimic (synthesized by the company) was briefly transfected into the cells using Lipo3000 transfection reagent, and the cells were cultured for another 48 hours.

[0031] Exosome extraction: Conditioned culture medium was collected and centrifuged at 300×g, 2,000×g, and 10,000×g to remove cells and debris. Finally, exosomes were obtained by ultracentrifugation at 110,000×g for 70 minutes.

[0032] 3. Experimental Conclusion: A stable HK2 cell line expressing miR-146a-5p was successfully constructed. qRT-PCR analysis confirmed that the expression level of miR-146a-5p in this cell line was significantly higher than that in untransfected wild-type HK2 cells. Figure 1 ).

[0033] Example 2: Preparation and characterization of engineered exosomes rich in miR-146a-5p 1. Experimental objective: To prepare exosomes secreted by cell lines and to perform basic characterization on them.

[0034] 2. Experimental methods: (1) Exosome preparation: The miR-146a-5p-HK2 cells obtained in Example 1 were cultured to a confluence of 85%. The cells were gently washed twice with PBS, and then cultured for another 48 hours with exosome-free serum-free medium. The conditioned medium was collected and centrifuged sequentially at 4°C: 300×g for 10 minutes (to remove live cells), 2,000×g for 20 minutes (to remove dead cells), and 10,000×g for 30 minutes (to remove cell debris). Finally, the supernatant was ultracentrifuged at 4°C and 110,000×g for 70 minutes, the supernatant was discarded, and the precipitate was resuspended with an appropriate amount of PBS to obtain engineered exosomes (EXO-miR) rich in miR-146a-5p.

[0035] (2) Exosome characterization: miRNA content detection: Total RNA was extracted from exosomes and verified by qRT-PCR. The content of miR-146a-5p in EXO-miR was significantly higher than that in exosomes isolated from wild-type HK2 cells.

[0036] 3. Experimental conclusion: High-purity exosomes were successfully isolated from the culture supernatant of miR-146a-5p-HK2 cell line. Their morphology, particle size and markers were consistent with the characteristics of exosomes, and they were rich in miR-146a-5p.

[0037] Example 3: Preparation of LTH peptide-modified kidney-targeting engineered exosomes 1. Experimental objective: To prepare kidney-targeting exosomes by modifying the exosomes obtained in Example 2 with LTH peptide using a commercially available kit.

[0038] 2. Experimental methods: Exosome modification: Using the exosome targeted peptide modification kit from Enzekangtai Company, LTH peptide (SEQ ID NO:1) was co-incubated with exosomes to obtain LTH peptide-modified engineered exosomes (LTH-EXO-miR).

[0039] Modification verification: Western blotting was performed using a specific antibody against LTH peptide to detect the modified exosomes. Clear bands were observed, proving that LTH peptide had been successfully anchored on the surface of exosomes.

[0040] 3. Experimental conclusion: LTH peptide-modified kidney-targeting engineered exosomes were successfully prepared using in vitro membrane anchoring technology.

[0041] Example 4: Verification of the targeting ability and therapeutic effect of engineered exosomes on kidney injury 1. Experimental objective: To verify the renal targeting effect of LTH-EXO-miR and its therapeutic effect on calcium oxalate-induced kidney injury.

[0042] 2. Experimental methods: In vivo targeting validation: A rat model of calcium oxalate kidney injury was established (induced by drinking a 1% ethylene glycol and 2% ammonium chloride aqueous solution). Rats were randomly divided into groups and injected via tail vein with PBS, DiR-labeled EXO-miR, and DiR-labeled LTH-EXO-miR, respectively. Twenty-four hours after injection, the distribution of exosomes in vivo was observed using a small animal in vivo imaging system. Results are attached. Figure 3 As shown, the fluorescence signal intensity in the kidney region of the LTH-EXO-miR group was significantly higher than that of the EXO-miR group, demonstrating that LTH modification effectively enhances the kidney targeting of exosomes.

[0043] In vitro functional validation (macrophage polarization): Mouse macrophage line RAW264.7 was co-cultured with different exosomes (PBS, EXO-miR, LTH-EXO-miR). After 24 hours, the expression of M1 markers (CD86) and M2 markers (CD206) on the cell surface was detected by flow cytometry. Results are attached. Figure 2 As shown, compared with the PBS group, the EXO-miR group can promote macrophage polarization to M2 type, and the LTH-EXO-miR group has a more significant effect.

[0044] In vivo efficacy validation: Rats with kidney injury were randomly divided into a sham-operated group, a model group (PBS), an EXO-miR treatment group, and an LTH-EXO-miR treatment group. Treatment groups received tail vein injections of the corresponding exosomes twice weekly. After treatment, serum creatinine and blood urea nitrogen levels were measured to assess kidney function; kidney tissue was harvested for HE staining to observe pathological changes, and Von Kossa staining to observe calcium salt deposition. Results are attached. Figure 4 As shown: Figure 4 A showed that, compared with the model group, the LTH-EXO-miR treatment group significantly reduced Scr and BUN levels ( This demonstrates that it can effectively improve kidney function.

[0045] Figure 4 B shows damage such as vacuolar degeneration and luminal dilation of renal tubular epithelial cells in the model group, while the integrity of renal tubular structure was significantly improved in the LTH-EXO-miR treatment group; the bottom row shows Von Kossa staining (used to show calcium salt deposition), which shows a large amount of brown-black calcium salt crystal deposition in the renal interstitium of the model group, while crystal deposition was significantly reduced in the LTH-EXO-miR treatment group.

[0046] 3. Experimental conclusions: LTH peptide-modified engineered exosomes have good kidney targeting and can significantly improve calcium oxalate-induced kidney injury by regulating macrophage polarization, with better therapeutic effects than unmodified exosomes.

[0047] Example 5: In vivo exploration of the mechanism of action of engineered exosomes I. Experimental Objective Further explore the specific mechanisms by which engineered exosomes exert their protective effects in in vivo models.

[0048] II. Experimental Methods 1. After the treatment in Example 4, kidney tissue was taken from each group of rats.

[0049] 2. The expression levels of macrophage M2 markers (such as Arg1) and the phosphorylation levels of key proteins in the IRAK1 / TRAF6 / NF-κB pathway in renal tissue were detected by immunohistochemistry or Western blotting.

[0050] III. Experimental Conclusions The results are as follows Figure 5 As shown, in the renal tissue of the LTH-EXO-miR treatment group, the expression of M2 macrophage markers was significantly upregulated, while the phosphorylation levels of proteins such as p-IRAK1, p-IKK, p-NF-κB, and p65 were significantly inhibited. This demonstrates that engineered exosomes can regulate macrophage polarization in vivo through this signaling pathway.

[0051] Example 6: Validation of the mechanism by which HNRNP M mediates the sorting of miR-146a-5p into exosomes I. Experimental Objective: To verify the key role of HNRNP M protein in the process of miR-146a-5p sorting into exosomes.

[0052] II. Experimental Methods: 1. Gene manipulation: Knock down or overexpress HNRNP M in HK2 cells.

[0053] 2. Exosome analysis: Cells and their secreted exosomes were extracted from each group, and the changes in miR-146a-5p content in intracellular and exosomes were compared by qRT-PCR.

[0054] 3. Validation: The HNRNP M protein was directly bound to miR-146a-5p by RNA immunoprecipitation.

[0055] III. Experimental Results Figure 6 Results showed that regulating HNRNP M had no significant effect on the total amount of intracellular miR-146a-5p.

[0056] Figure 6 Results B showed that knocking down HNRNP M significantly reduced the content of miR-146a-5p in exosomes, while overexpression of HNRNP M significantly increased its content. This demonstrates that HNRNP M specifically regulates the sorting of miR-146a-5p into exosomes.

[0057] Figure 6 The results showed that miR-146a-5p was significantly enriched in the HNRNP M antibody group, confirming that the HNRNP M protein can directly bind to miR-146a-5p.

[0058] Figure 6 Results showed that, compared with the mutant reporter vector, miR-146a-5p significantly inhibited luciferase activity containing the wild-type 3'UTR of IRAK1.

[0059] Figure 6 Western blotting results for E showed that the phosphorylation levels of proteins such as IRAK1, p-IKK, p-NF-κB, and p65 were significantly inhibited in macrophages treated with LTH-EXO-miR.

[0060] Figure 6 F summarized the complete mechanism from "CaOx stimulation, HNRNP M downregulation, reduced exosome miR-146a-5p sorting, IRAK1 / TRAF6 / NF-κB pathway activation, macrophage M1 polarization, kidney injury to engineered exosomes supplementing miR-146a-5p, thereby inhibiting the IRAK1 / TRAF6 / NF-κB pathway, promoting macrophage M2 polarization, and repairing kidney injury".

[0061] IV. Experimental Conclusions As shown above, knocking down HNRNP M significantly reduced the level of miR-146a-5p in exosomes, but the intracellular level did not change much. RIP experiments confirmed that HNRNP M can directly bind to miR-146a-5p. This demonstrates that HNRNP M is a key protein regulating the sorting of miR-146a-5p into exosomes.

[0062] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0063] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0064] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A miR-146a-5p overexpressing cell line, characterized in that, The cell line is miR-146a-5p-HK2; the miR-146a-5p-HK2 cell line was prepared by the following method: Human renal tubular epithelial HK2 cells were infected with miR-146a-5p mimic, whose nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.

2. After culture and screening, miR-146a-5p overexpressing cell lines were obtained.

2. An engineered exosome rich in miR-146a-5p, characterized in that, Secreted by the miR-146a-5p-HK2 cell line as described in claim 1.

3. A method for preparing engineered exosomes rich in miR-146a-5p as described in claim 2, characterized in that, The method includes: The miR-146a-5p overexpressing cell line according to any one of claims 1-2 was cultured to obtain a culture medium; The culture medium was separated and purified to obtain exosomes.

4. A kidney-targeted engineered exosome, characterized in that, The exosomes described in claim 2 are obtained by modifying them with LTH peptide, wherein the amino acid sequence of the LTH peptide is SEQ ID NO:

1.

5. The use of the miR-146a-5p overexpressing cell line of claim 1 in the preparation of drugs for kidney injury.

6. The use of the engineered exosomes rich in miR-146a-5p as described in claim 2 in the preparation of drugs for kidney injury.

7. The use of the kidney-targeting engineered exosomes of claim 4 in the preparation of drugs for kidney injury.

8. A pharmaceutical composition for treating kidney injury, characterized in that, The exosomes comprise a therapeutically effective amount of the engineered cell line of claim 1, or the miR-146a-5p-rich engineered exosomes of claim 2, or the kidney-targeting engineered exosomes of claim 4, and a pharmaceutically acceptable carrier.

Images