Mutant gene enrichment method, detection method and kit based on Cas9 specific cleavage and isonucleotide magnetic beads
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SUZHOU HAIMIAO BIOTECH CO LTD
- Filing Date
- 2025-12-19
- Publication Date
- 2026-04-28
AI Technical Summary
传统的基因突变检测方法通常采用PCR扩增(如ARMS-PCR或qPCR)或下一代测序(NGS),但ctDNA在游离核酸(cfDNA)中的丰度通常低于1%,突变位点仅为单一碱基变化,导致易产生非特异性扩增和假阳性信号
1.卓越的高特异性区分能力(背景有效清除)
Smart Images

Figure CN121931098A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular diagnostics and nucleic acid detection technology, and in particular to a method for selectively enriching mutant genes in mutant DNA by specifically cleaving wild-type sequences using Cas9 protein and combining it with heteronucleotide-modified magnetic beads, a gene mutation detection method, and a matching kit. Background Technology
[0002] Gene mutations (such as point mutations, insertions / deletions) are important driving events in the occurrence and development of cancer, especially in circulating tumor DNA (ctDNA). Detection of ctDNA can be performed using non-invasive liquid biopsy, which has significant clinical implications. Traditional gene mutation detection methods typically employ PCR amplification (such as ARMS-PCR or qPCR) or next-generation sequencing (NGS). However, the abundance of ctDNA in cell-free nucleic acids (cfDNA) is usually less than 1%, and mutation sites involve only single-base changes, leading to a high likelihood of non-specific amplification and false positive signals.
[0003] However, the existing methods have significant limitations: (1) low abundance of ctDNA leads to high background noise and severe interference from wild-type sequences during amplification; (2) without a pre-enrichment step, the detection sensitivity is insufficient to capture mutation allele frequencies below 0.1%; (3) for point mutations, the sequence similarity is high and the binding of specific probes is unstable.
[0004] To address the aforementioned issues, while there are existing reports of using the CRISPR / Cas9 system to cut specific sequences (such as for gene editing), there is still no integrated method that combines the Cas9 enzyme to specifically cut wild-type sequences with LNA (Locked Nucleic Acid) modified biotin oligonucleotide chains and streptavidin magnetic beads for targeted enrichment. Summary of the Invention
[0005] The technical problem to be solved by this invention is to address the shortcomings of the prior art by providing a method, detection method, and kit for enriching mutant genes based on Cas9 specific cleavage and isonucleotide magnetic beads. This invention can significantly improve the specificity and detection rate of mutant signals, filling the gap in the prior art.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In its first aspect, the present invention provides a method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads, comprising the following steps: 1) Sample extraction: Extracting cell-free DNA from biological samples to obtain cfDNA products; 2) Specific cleavage: The cfDNA product is mixed with an sgRNA complex formed by the Cas9 protein and a specific sgRNA, and incubated to allow the wild-type sequence to be recognized and cleaved, while the mutant DNA sequence is preserved. 3) Denaturation treatment: The product obtained in step 2) is inactivated by high temperature incubation, and the double-stranded DNA is destranded into single strands to obtain the denatured product; 4) Enrichment and capture: Magnetic beads coated with streptavidin were used as carriers and pre-bound with biotinylated oligonucleotide probes modified with isonucleotides (isoG / isoC) and locked nucleic acids (LNA) to obtain a magnetic bead probe system. The denaturation product obtained in step 3) is mixed with the magnetic bead probe system for hybridization enrichment. The enriched mutant DNA is obtained by magnetic separation and elution.
[0007] Preferably, the specific sgRNA in step 2) is designed for the wild-type sequence, so that the mutant DNA cannot be effectively cleaved by Cas9 due to at least one base mismatch.
[0008] Preferably, the sgRNA complex is constructed as follows: Cas9 protein and sgRNA were incubated at room temperature in HOLMES buffer or PBS to form a Cas9-sgRNA complex.
[0009] Preferably, the Cas9 protein is the SpCas9 protein derived from Streptococcus pyogenes.
[0010] Preferably, the incubation temperature in step 2) is 37°C and the incubation time is 30–60 min.
[0011] Preferably, the high-temperature incubation temperature in step 3) is 95°C, which is intended to inactivate the Cas9 endonuclease and unwind the double-stranded DNA into single strands, facilitating the enrichment and capture of subsequent mutant sequences.
[0012] Preferably, the sequence of the probe in step 4) is completely complementary to the mutation site in the same direction, and the probe contains: Guanine (G) and cytosine (C) are replaced by isoguanine (isoG) and isocytosine (isoC) to achieve unidirectional pairing; Adenine (A) and thymine (T) were modified with locked nucleic acid (LNA) to improve thermal stability and hybridization specificity; The probe's 5' end has a biotin group that can bind to streptavidin magnetic beads.
[0013] A second aspect of the present invention provides a mutant gene enrichment composition based on Cas9-specific cleavage and isonucleotide magnetic beads, which employs the method described above, and the composition comprises the following components: Cas protein, buffer solution, and specific sgRNA; Biotinylated oligonucleotide probes modified with isonucleotides (isoG / isoC) and locked nucleic acids (LNA); Streptavidin magnetic beads and elution buffer.
[0014] In a third aspect, the present invention provides a method for detecting mutant genes based on Cas9 specific cleavage and heteronucleotide magnetic bead enrichment. After enriching mutant DNA using the method described above, the mutant DNA is quantitatively or qualitatively analyzed using real-time quantitative PCR (qPCR), digital PCR (ddPCR), high-throughput sequencing (NGS), or isothermal amplification methods.
[0015] In a fourth aspect, the present invention provides a mutant gene detection kit based on Cas9 specific cleavage and heteronucleotide magnetic bead enrichment, for implementing the detection method described above, the kit comprising the composition described above.
[0016] The beneficial effects of this invention are: Compared with the prior art, the detection method of the present invention has the following significant advantages: 1. Excellent high-specificity discrimination ability (effective background removal) This method leverages the high sensitivity of the Cas9 protein to single-base mismatches between the sgRNA recognition sequence and the target sequence, ensuring that the sgRNA efficiently and specifically cleaves only the target wild-type sequence. This characteristic completely eliminates background interference from wild-type DNA, forming the basis for subsequent high-sensitivity detection.
[0017] 2. Dual-specific enrichment mechanism (efficient signal amplification) This invention organically combines the sequence selectivity of Cas9 (background removal) with the chemical specificity of heteronucleotide-LNA magnetic beads (target enrichment), forming a dual amplification screening mechanism of "background removal + target mutation enhancement". This mechanism works synergistically to greatly improve the enrichment efficiency and detection sensitivity of low-abundance mutant DNA.
[0018] 3. Broad compatibility and versatility The design of this detection method is not limited to specific mutation types, but is based on the principles of sequence recognition and complementary hybridization. Methodologically, it can be extended and applied to various gene variation types such as point mutations, small fragment deletions, and insertions, and has good platform versatility.
[0019] 4. Possesses a high degree of automation and application potential. The Cas9 cutting and magnetic bead enrichment steps of this method feature mild reaction conditions and a simple operation process. The entire detection process is compactly designed, easily integrated into a single-tube system, and adaptable to existing automated liquid workstations. It is suitable for the development and application of high-throughput, automated liquid biopsy detection equipment. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the overall process of the detection method of the present invention; Figure 2 The results are qPCR detection results of plasma samples from non-small cell lung cancer (NSCLC) patients and healthy individuals before and after enrichment in Example 1 (the Ct value of the NSCLC patient sample before enrichment was 35.07, and the Ct value after enrichment was 32.70; no fluorescence signal was observed in the healthy individual samples before and after enrichment). Figure 3 The results of qPCR detection in plasma samples from colorectal cancer (CRC) patients and healthy individuals before and after enrichment in Example 2 are shown (the Ct value of CRC patient samples before enrichment was 31.56, and the Ct value after enrichment was 32.70; no fluorescence signal was observed in healthy individual samples before and after enrichment). Figure 4 The results of qPCR detection after parallel enrichment of multiple mutation sites (EGFR L858R and KRAS G12D) in Example 3 are as follows (Ct value of NSCLC patient sample is 32.86, Ct value of CRC patient sample is 31.41). Figure 5 The results are qPCR detection results of NSCLC patient and normal control samples after omitting the Cas9 cutting step in Example 4 (control experiment) (the Ct value of the NSCLC patient sample is 31.05, and the Ct value of the normal control sample is 33.24). Detailed Implementation
[0021] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.
[0022] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.
[0023] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. For examples where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer are followed. For reagents or instruments whose manufacturers are not specified, they are all commercially available products.
[0024] To address these issues, this invention provides a detection method that utilizes Cas9 protein and specific sgRNA to identify and cleave wild-type sequences, and combines this with heteronucleotide-locked nucleic acid (LNA) modified probe beads for selective enrichment of mutant DNA. Through this dual-specificity screening mechanism, this invention aims to achieve efficient enrichment and accurate quantification of low-abundance mutant DNA. The technical process of this invention is as follows: Figure 1 As shown, the specific process is as follows: S1. Extraction and pretreatment of sample cfDNA Cell-free DNA (cfDNA) is extracted from plasma, urine, tissue, or cell samples. Magnetic bead extraction or silica membrane extraction is preferred, and the concentration of the purified product should be controlled within the range of 1–10 ng / μL.
[0025] S2. Cas9 specific recognition and wild-type sequence cutting 1. sgRNA design: sgRNA (20 nt in length) was designed based on the target mutation site, with its recognition sequence completely matching the wild-type sequence and adjacent to the PAM site (NGG); 2. sgRNA preparation: sgRNA can be obtained through in vitro transcription or is commercially available; 3. Construction of sgRNA complex: Cas9 protein (final concentration 100–300 nM) and sgRNA (250 nM) are compounded in HOLMES buffer or PBS system to form Cas9-sgRNA complex; preferably, the concentration of Cas9 protease is 250 nM.
[0026] The Cas9 protein is the SpCas9 protein derived from Streptococcus pyogenes. 4. Nucleic acid cleavage reaction: Add the extracted cfDNA to the reaction system and incubate at 37°C for 30–60 minutes; 5. Cleavage mechanism: The Cas9 complex only recognizes and cleaves wild-type sequences, while mutant sequences are retained because they cannot bind effectively to the Cas9-sgRNA complex due to mismatch.
[0027] 6. Reaction termination and destring: After the reaction is completed, the Cas9 endonuclease can be inactivated by high temperature treatment at 95℃, which will cause the double-stranded DNA to denature and destring into single strands, thus facilitating the subsequent enrichment and capture of specific magnetic beads.
[0028] S3. Isonucleotide magnetic beads enrich mutant DNA 1. Magnetic bead preparation: Magnetic beads coated with streptavidin are used as carriers; 2. Probe design and preparation: Biotin-labeled oligonucleotide probes (10–25 nt in length) are prepared in advance, with the probe sequence being completely complementary to the mutation site in the same direction; In this probe: Guanine (G) and cytosine (C) are replaced by isoguanine (isoG) and isocytosine (isoC) to achieve unidirectional pairing; Adenine (A) and thymine (T) were modified with locked nucleic acid (LNA) to improve thermal stability and hybridization specificity; The probe has a biotin group at its 5′ end, which can bind to streptavidin magnetic beads; 3. Enrichment and capture: Mix the Cas9-treated DNA with the above magnetic bead probe system and incubate at 45°C for 15-30 minutes; 4. Separation and purification: Unbound DNA is removed using magnetic separation technology, and after washing and elution, enriched mutant DNA is obtained.
[0029] S4. Detection and Analysis For enriched mutant DNA, downstream detection methods such as real-time quantitative PCR (qPCR), digital PCR (ddPCR), high-throughput sequencing (NGS), or isothermal amplification are used.
[0030] Preferably, the detection system employs a primer design strategy that spans mutation sites but avoids mutated bases. This design ensures that the same set of primers and probes can be used for both quantitative detection of mutant samples and effective monitoring of whether nonspecific enrichment of wild-type sequences occurs in the control group.
[0031] S5. Data Analysis and Result Determination Based on the differences in detection signals (such as Ct values), the enrichment effect and content of mutant DNA are scientifically evaluated.
[0032] The above is the general concept of the present invention. Based on this, detailed embodiments and comparative examples are provided below to further illustrate the present invention.
[0033] Example 1: EGFR L858R mutation detection (plasma cfDNA) (1) Sample source and DNA extraction Peripheral blood was collected in 5 mL from healthy individuals and non-small cell lung cancer (NSCLC) patients. The plasma was separated by centrifugation (1600 g, 10 min) using EDTA anticoagulation. cfDNA was extracted using a commercially available cfDNA extraction kit (such as the HaiMiao Bio-Extraction or Purification Kit).
[0034] The DNA concentration, as determined by the Qubit dsDNA HS detection kit, was 6.2 ng / μL, with a total amount of approximately 30 ng.
[0035] (2) sgRNA design and Cas9 complex preparation For the L858R mutation (CTG→CGG) in exon 21 of EGFR, the wild-type sequence “CTG” was selected as the sgRNA recognition target.
[0036] sgRNA sequence: 5′-AUUUUGGGCUGGCCAAACUGGUUUUAGAGCUAUGCUGAAAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGG-3′ (SEQ ID NO.1) In a buffer solution (20 mM HEPES, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, pH 7.5), Cas9 and sgRNA were combined at a 1:1 molar ratio and incubated at room temperature for 10 min to form a Cas9-sgRNA complex. The Cas9 protein is the SpCas9 protein derived from Streptococcus pyogenes. (3) Cas9 cleavage reaction Take 10 ng of cfDNA and add it to a 50 μL reaction system (containing 200 nM of Cas9-sgRNA complex).
[0037] Reaction conditions: Incubate at 37°C for 45 min.
[0038] After the reaction was completed, the sample was treated at 95°C for 15 min, and then rapidly cooled in a -20°C freezer to cause irreversible denaturation of the cfDNA and the formation of single strands.
[0039] Optionally, to ensure the enrichment effect in the later stage, the Cas9 cleavage reaction system can be scaled up proportionally to obtain a sufficient number of mutant samples.
[0040] (4) Enrichment of heteronucleotide magnetic beads A biotinylated oligonucleotide probe (18 nt in length) was prepared, with a sequence completely complementary to the L858R mutation site. The probe design features are as follows: 4-1. G / C are replaced with isoguanine (isoG / iG) and isocytosine (isoC / iC); 4-2. Both A and T are locked nucleic acids (A L / T L ); 4-3. Biotin-modified at the 5′ end.
[0041] The final synthesized oligonucleotide sequence is: 5′BIO-A LiGT L T L T L iGiGiCiCA L iGiCiCiCA L A L A L A L T L -3′ (SEQ ID NO.2) Pre-bind the probe with Dynabeads™ M-280 streptavidin magnetic beads (50 μg) (shaking at room temperature for 20 min).
[0042] The Cas9 treatment product was mixed with the probe magnetic beads and incubated at 45°C for 25 min to allow the mutant DNA to bind to the probe in the same direction.
[0043] Wash three times with washing buffer (1×PBS, 0.05% Tween-20), collect the binding product after magnetic separation, and elute it at 65°C for 5 min to obtain enriched mutant DNA.
[0044] (5) Detection and Results The EGFR L858R-specific qPCR system was used to detect the cleavage products before and after enrichment.
[0045] Design the following primers and probes: Upstream primer: 5′-CAGCCAGGAACGTACTGGTGA-3′ (SEQ ID NO.3) Downstream primer: 5′-TTCTTTCTCTTCCGCACCCA-3′ (SEQ ID NO.4) Probe: 5′FAM-TTGGCCCGCCCAAAATCTGTGATCTT-3′BHQ1 (SEQ ID NO.5) Test results as follows Figure 2 As shown, the Ct value of NSCLC patient samples before enrichment was 35.07, and the Ct value after enrichment significantly decreased to 32.70; no fluorescence signal was generated in normal human samples before and after enrichment. These results strongly indicate that Cas9 completely cleaves the wild-type sequence, essentially eliminating background interference from mutants. Simultaneously, the magnetic bead enrichment step significantly enhanced the fluorescence signal, effectively improving the sensitivity of EGFR L858R mutation detection.
[0046] Example 2: KRAS G12D mutation detection (plasma cfDNA) (1) Sample source and DNA extraction Peripheral blood was collected in 5 mL from healthy individuals and patients with colorectal cancer (CRC). The plasma was separated by centrifugation (1600 g, 10 min) using EDTA anticoagulation. cfDNA was extracted using a commercially available cfDNA extraction kit (such as the HaiMiao Bio-Extraction or Purification Kit).
[0047] The DNA concentration, as determined by the Qubit dsDNA HS detection kit, was 7.2 ng / μL, with a total amount of approximately 30 ng.
[0048] (2) sgRNA design and Cas9 complex preparation For the G12D mutation (GGT→GAT) in the KRAS coding region, the wild-type sequence “GGT” was selected as the sgRNA recognition target.
[0049] sgRNA sequence: 5′-GUAGUUGGAGCUGGUGGCGUGUUUUAGAGCUAUGCUGAAAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGG-3′ (SEQ ID NO.6) In a buffer solution (20 mM HEPES, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, pH 7.5), Cas9 and sgRNA were combined at a molar ratio of 1:1 and incubated at room temperature for 10 min to form the Cas9-sgRNA complex.
[0050] (3) Cas9 cleavage reaction Take 10 ng of cfDNA and add it to a 50 μL reaction system (containing 200 nM of Cas9-sgRNA complex).
[0051] Reaction conditions: Incubate at 37°C for 45 min.
[0052] After the reaction was completed, the sample was treated at 95°C for 15 min, and then rapidly cooled in a -20°C freezer to cause irreversible denaturation of the cfDNA and the formation of single strands.
[0053] Preferably, in order to ensure the enrichment effect in the later stage, the Cas9 cleavage reaction system can be scaled up proportionally to obtain a sufficient number of mutant samples.
[0054] (4) Enrichment of heteronucleotide magnetic beads Biotinylated oligonucleotide probes (18 nt in length) were prepared with sequences completely complementary to the KRAS G12D mutation site. Probe design features: 1. G / C are replaced with isoguanine (isoG / iG) and isocytosine (isoC / iC); 2. Both A and T are locked nucleic acids (A L / T L ); 3. Biotin-modified at the 5′ end.
[0055] The final synthesized oligonucleotide sequence is: 5′BIO-A L iGT L T L iGiGA L iGiCT L iGiGT L iGiGiCiGT L -3′ (SEQ ID NO.7) Pre-bind the probe with Dynabeads™ M-280 streptavidin magnetic beads (50 μg) (shaking at room temperature for 20 min).
[0056] The Cas9 treatment product was mixed with the probe magnetic beads and incubated at 45°C for 25 min to allow the mutant DNA to bind to the probe in the same direction.
[0057] Wash three times with washing buffer (1×PBS, 0.05% Tween-20), collect the binding product after magnetic separation, and elute it at 65°C for 5 min to obtain enriched mutant DNA.
[0058] (5) Detection and Results The products before and after enrichment were detected using the KRAS G12D specific qPCR system.
[0059] Design the following primers and probes: Upstream primer: 5′-TGTGGTAGTTGGAGCTGGTGG-3′ (SEQ ID NO.8) Downstream primer: 5′-TCTATTGTTGGATCATATTCGTCCA-3′ (SEQ ID NO.9) Probe: 5′FAM-CGTAGGCAAGAGTGCCTTGAGATACAG-3′BHQ1 (SEQ ID NO.10) Test results as follows Figure 3 As shown, the Ct value of the enriched CRC patient sample was 35.15, and the Ct value significantly decreased to 31.56 after enrichment; no fluorescence signal was generated in the normal human sample before and after enrichment. The results further verify that Cas9 can completely cleave wild-type background DNA. At the same time, the magnetic bead enrichment step of this invention can significantly enhance the fluorescence signal (significant ΔCt), achieving efficient enrichment and sensitive detection of KRASG12D mutation.
[0060] Example 3: Parallel enrichment of multiple mutation sites (1) Design of target gene and sgRNA Two sites, EGFR L858R and KRAS G12D, were selected, and the sgRNA sequences (SEQ ID NO.1 and SEQ ID NO.6) designed in Examples 1 and 2 were used. (2) The cleavage reaction of Cas9 In a buffer solution, the two sgRNAs were compounded with Cas9 at a molar ratio of 1:1:Cas9:sgRNA.
[0061] Take 10 ng of cfDNA from Example 1 (NSCLC) and Example 2 (CRC) and add it to a 50 μL reaction system (containing 200 nM of Cas9-sgRNA complex).
[0062] Reaction conditions: Incubate at 37°C for 45 min.
[0063] After the reaction was completed, the sample was treated at 95°C for 15 min, and then rapidly cooled in a -20°C freezer to cause irreversible denaturation of the cfDNA and the formation of single strands.
[0064] Preferably, in order to ensure the enrichment effect in the later stage, the Cas9 cleavage reaction system can be scaled up proportionally to obtain a sufficient number of mutant samples.
[0065] (3) Enrichment of heteronucleotide magnetic beads Pre-binding was performed using Dynabeads™ M-280 streptavidin magnetic beads (50 μg) mixed with probes (SEQ ID NO.2 and SEQ ID NO.7).
[0066] The Cas9-treated product was mixed with a hybrid probe magnetic bead system and incubated at 45°C for 25 min to perform parallel enrichment of multiple targets.
[0067] Wash three times with washing buffer (1×PBS, 0.05% Tween-20), collect the binding product after magnetic separation, and elute it at 65°C for 5 min to obtain enriched mutant DNA.
[0068] (4) Detection and Results The qPCR primers and probes designed in Example 1 (NSCLC) and Example 2 (CRC) were used to detect the cleavage products before and after enrichment.
[0069] Test results as follows Figure 4As shown, after magnetic bead enrichment, the target mutation sequences of both samples could be efficiently enriched and detected. Experimental results indicate that no cross-interference was observed between different mutation sites in the mixed sgRNA and mixed probe magnetic bead system. The method of this invention can successfully achieve efficient parallel capture and detection of multi-target mutant DNA.
[0070] Example 4 (Control Experiment): Validation of Samples Without Cas9 Processing To verify the importance of the Cas9 targeting and cutting step for detection specificity, this embodiment omits the Cas9 processing step for NSCLC and normal control samples, and only performs magnetic bead enrichment.
[0071] (1) Sample processing and denaturation Here, cfDNA from normal individuals and NSCLC patients in Example 1 was selected for testing.
[0072] The cfDNA was heated to 95°C for 15 min and then rapidly cooled in a -20°C freezer to cause irreversible denaturation and form single strands.
[0073] (2) Enrichment of heteronucleotide magnetic beads Pre-binding of the NSCLC probe (SEQ ID NO.2) with Dynabeads™ M-280 streptavidin magnetic beads (50 μg) was performed.
[0074] The denatured cfDNA product was mixed with probe magnetic beads and incubated at 45°C for 25 min for enrichment.
[0075] (3) Detection and Results The enriched samples were tested using the primers and probes designed in Example 1 (results are shown in...). Figure 5 ).
[0076] The experimental results showed that the Ct value of the NSCLC patient samples was 31.05, while the Ct value of the normal control samples was 33.24. Although the specific magnetic beads showed a certain enrichment effect, the lack of specific cleavage of wild-type nucleic acids by Cas9 in this experiment led to significant non-specific binding of the probe to the non-mutated sequence, resulting in Ct values of both samples being significantly higher than those in Example 1 (Ct value of 32.70 after enrichment). This result strongly demonstrates that Cas9 plays an indispensable role in eliminating wild-type background, improving detection specificity, and reducing Ct values in this invention.
[0077] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.
Claims
1. A method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads, characterized in that, Includes the following steps: 1) Sample extraction: Extracting cell-free DNA from biological samples to obtain cfDNA products; 2) Specific cleavage: The cfDNA product is mixed with an sgRNA complex formed by the Cas9 protein and a specific sgRNA, and incubated to allow the wild-type sequence to be recognized and cleaved, while the mutant DNA sequence is preserved. 3) Denaturation treatment: The product obtained in step 2) is inactivated by high temperature incubation, and the double-stranded DNA is destranded into single strands to obtain the denatured product; 4) Enrichment and capture: Magnetic beads coated with streptavidin were used as carriers and pre-bound with biotinylated oligonucleotide probes modified with heteronucleotides and locked nucleic acids to obtain a magnetic bead probe system. The denaturation product obtained in step 3) is mixed with the magnetic bead probe system for hybridization enrichment. The enriched mutant DNA is obtained by magnetic separation and elution.
2. The method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads according to claim 1, characterized in that, The specific sgRNA in step 2) is designed for wild-type sequences, so that mutant DNA cannot be effectively cleaved by Cas9 due to at least one base mismatch.
3. The method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads according to claim 2, characterized in that, The method for constructing the sgRNA complex is as follows: Cas9 protein and sgRNA were incubated at room temperature in HOLMES buffer or PBS to form a Cas9-sgRNA complex.
4. The method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads according to claim 3, characterized in that, The Cas9 protein is the SpCas9 protein derived from Streptococcus pyogenes.
5. The method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads according to claim 1, characterized in that, In step 2), the incubation temperature is 37°C and the incubation time is 30–60 min.
6. The method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads according to claim 1, characterized in that, In step 3), the high-temperature incubation temperature is 95℃.
7. The method for enriching mutant genes based on Cas9-specific cleavage and heteronucleotide magnetic beads according to claim 1, characterized in that, In step 4), the probe sequence is perfectly complementary to the mutation site, and the probe contains: Guanine (G) and cytosine (C) are replaced by isoguanine (isoG) and isocytosine (isoC); Adenine (A) and thymine (T) were modified with locked nucleic acid (LNA); The probe's 5' end has a biotin group that can bind to streptavidin magnetic beads.
8. A mutant gene enrichment composition based on Cas9 specific cleavage and isonucleotide magnetic beads, characterized in that, It employs the method described in any one of claims 1-7, and the composition comprises the following components: Cas protein, buffer solution, and specific sgRNA; Biotinylated oligonucleotide probes modified with heteronucleotides and locked nucleic acids; Streptavidin magnetic beads and elution buffer.
9. A method for detecting mutant genes based on Cas9 specific cleavage and heteronucleotide magnetic bead enrichment, characterized in that, After enriching mutant DNA using the method described in any one of claims 1-7, the mutant DNA is then quantitatively or qualitatively analyzed using real-time quantitative PCR, digital PCR, high-throughput sequencing, or isothermal amplification.
10. A mutant gene detection kit based on Cas9 specific cleavage and heteronucleotide magnetic bead enrichment, characterized in that, It is used to implement the detection method as described in claim 9, wherein the kit comprises the composition as described in claim 8.