Polypeptide for treating visceral hypersensitivity and application thereof

By designing the peptide PAR1-peptide, the interaction between PAR1 and β-arrestin2 is specifically interfered with, which solves the problems of poor selectivity and large side effects of existing drugs, and achieves precise treatment of visceral hypersensitive diseases, while reducing systemic side effects.

CN121974986APending Publication Date: 2026-05-05THE AFFILIATED HOSPITAL OF XUZHOU MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-05
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing drugs have problems with poor selectivity and significant side effects when treating viscerally hypersensitive diseases such as irritable bowel syndrome. In particular, traditional small molecule antagonists may affect the normal physiological function of PAR1, leading to systemic side effects.

Method used

A peptide was designed that can specifically interfere with the interaction between PAR1 and β-arrestin2. By using the peptide PAR1-peptide, the abnormal signaling pathway is blocked, thus avoiding affecting the normal physiological function of PAR1.

Benefits of technology

It enables precise intervention for diseases highly sensitive to internal organs, significantly reduces systemic side effects, improves treatment safety, and provides a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121974986A_ABST
    Figure CN121974986A_ABST
Patent Text Reader

Abstract

The invention discloses a polypeptide for treating visceral hypersensitivity and application thereof, and belongs to the technical field of biological medicine. The polypeptide can specifically interfere with the combination of a protease activated receptor 1 (PAR1) and beta-arrestin2, so that the abnormal activation of a signal channel on which the beta-arrestin2 depends is selectively inhibited, but the normal physiological function of the PAR1 is not influenced. The invention provides an amino acid sequence (SEQ ID NO.1) of the polypeptide and a coding gene (SEQ ID NO.2) of the polypeptide, and further comprises a recombinant expression vector and a pharmaceutical composition of the polypeptide. Experiments show that by applying the polypeptide in a local administration mode, the symptoms of a viscera high-sensitivity model animal can be remarkably relieved. The polypeptide provides a new strategy which is accurate, efficient and low in side effect risk for treating diseases characterized by viscera high sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a polypeptide for treating visceral hypersensitivity and its application. Background Technology

[0002] Protease-activated receptor 1 (PAR1) is an important member of the G protein-coupled receptor (GPCR) family, widely distributed in various cells and tissues, including vascular endothelial cells, platelets, gastrointestinal mucosal epithelium, and the enteric nervous system. Through its unique protease cleavage activation mechanism, it participates in regulating several key physiological and pathological processes, such as coagulation, inflammatory responses, cell proliferation, and gastrointestinal sensation and motility. The structure of PAR1 includes an extracellular domain, seven transmembrane α-helical domains, and an intracellular domain. The intracellular domain at the C-terminus plays a central role in signal transduction, internalization, and functional regulation after receptor activation.

[0003] In the gastrointestinal tract, PAR1 is expressed in the intestinal mucosal epithelium, myenteric plexus, and submucosal plexus. Studies have confirmed that abnormal activation of PAR1 can affect intestinal barrier function, promote the release of inflammatory factors, and directly participate in the transmission and regulation of intestinal sensory signals through G protein-dependent signaling pathways. In recent years, PAR1 has been found to play an important role in the development of visceral hypersensitivity. Visceral hypersensitivity is one of the core pathophysiological features of irritable bowel syndrome (IBS), characterized by a decreased threshold for the intestine to physiological or mildly harmful stimuli and an enhanced pain response. The global prevalence of IBS is approximately 11%, placing a heavy burden on patients' quality of life and healthcare systems. Current evidence indicates that PAR1 is abnormally expressed in the intestinal tissue of IBS patients, and its activation not only initiates non-G protein-dependent signal transduction through traditional G protein pathways but also through a specific interaction with the scaffold protein β-arrestin2. Specifically, after PAR1 is activated, its intracellular carboxyl terminus binds to β-arrestin2, which leads to the recruitment of β-arrestin2 to the receptor, thereby mediating receptor endocytosis, desensitization, and activation of downstream MAPK signaling cascades, ultimately amplifying primary afferent nerve signals and inducing or exacerbating visceral hypersensitivity.

[0004] Currently, drugs used clinically to alleviate visceral hypersensitivity, such as 5-HT4 receptor agonists, are often accompanied by systemic adverse reactions, including cardiovascular ones, due to their relatively broad target range, significantly limiting their clinical application. Intervention strategies targeting PAR1 itself primarily involve traditional small-molecule antagonists (such as Vorapaxar). While these antagonists can block receptor activation, their actions typically lack signal pathway selectivity. While inhibiting pathological PAR1 / β-arrestin2 interactions, they may also interfere with PAR1's normal physiological functions mediated by G proteins (such as cell protection and mucosal repair), potentially leading to increased bleeding risk or other side effects, thus limiting their long-term value in chronic gastrointestinal diseases.

[0005] Therefore, developing an intervention tool that can precisely and specifically block the interaction between PAR1 and β-arrestin2 without affecting other normal PAR1 signaling pathways has become an urgent need for treating visceral hypersensitivity and related PAR1-mediated diseases (such as IBS). Peptide drugs have shown great potential in this field due to their advantages such as high specificity, low toxicity, and ease of rational design. However, to date, no peptide drugs capable of specifically interfering with the interaction between PAR1 and β-arrestin2 have been developed or reported, indicating a significant technological gap in this area. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a polypeptide for treating visceral hypersensitivity and its application. This polypeptide can specifically interfere with the interaction between PAR1 and β-arrestin2, achieving precise intervention on visceral hypersensitivity pathological signals. While effectively alleviating disease symptoms, it significantly reduces the risk of systemic side effects caused by widespread inhibition of PAR1 function.

[0007] This invention is achieved through the following technical solution:

[0008] A polypeptide, the amino acid sequence of which is shown in SEQ ID NO.1.

[0009] An isolated nucleic acid molecule that encodes the aforementioned polypeptide.

[0010] Preferably, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.2.

[0011] A recombinant expression vector comprising the aforementioned nucleic acid molecules.

[0012] A host cell comprising the recombinant expression vector described above, or whose genome integrates the nucleic acid molecules described above.

[0013] A pharmaceutical composition comprising a therapeutically effective amount of the aforementioned polypeptide, the aforementioned nucleic acid molecule, the aforementioned recombinant expression vector, or the aforementioned host cell, and a pharmaceutically acceptable carrier or excipient.

[0014] The use of the above-mentioned polypeptides, nucleic acid molecules, recombinant expression vectors, host cells, or pharmaceutical compositions in the preparation of medicaments for the prevention and / or treatment of diseases characterized by visceral hypersensitivity.

[0015] Preferably, the disease characterized by visceral hypersensitivity is irritable bowel syndrome.

[0016] Preferably, the drug exerts its therapeutic effect by specifically interfering with the interaction between PAR1 and β-arrestin2.

[0017] Preferably, the dosage form of the drug is any pharmacologically acceptable dosage form.

[0018] The beneficial effects of this invention are as follows:

[0019] (1) This invention is the first to design and provide a peptide (PAR1-peptide) capable of specifically interfering with the interaction between PAR1 and β-arrestin2. This peptide targets the key functional region at the C-terminus of PAR1, providing a novel and precise molecular intervention tool. Compared to existing widely used traditional small molecule antagonists (such as Vorapaxar) that non-selectively block all PAR1 signaling pathways, this invention achieves a strategic upgrade from "receptor-level antagonism" to "precise intervention at the level of specific signaling pathways," opening up a completely new research direction for the treatment of PAR1-related diseases.

[0020] (2) The polypeptide of this invention selectively inhibits the abnormal activation of the β-arrestin2-dependent signaling pathway, which is closely related to the occurrence of visceral hypersensitivity, by specifically blocking the binding of PAR1 to β-arrestin2. Animal experiments directly confirmed that administration of this polypeptide via enema can significantly alleviate the symptoms of visceral hypersensitivity in mice with irritable bowel syndrome (IBS). This indicates that the polypeptide can directly target the core pathological link of the disease (abnormal signal amplification), and its clinical efficacy is expected to be clear.

[0021] (3) Because this peptide specifically interferes with the interaction between PAR1 and β-arrestin2 without directly affecting the PAR1-mediated G protein-dependent classical signaling pathway, it effectively treats pathological conditions (visceral hypersensitivity) while preserving PAR1's role in maintaining normal physiological functions such as the intestinal mucosal barrier and cell protection. This "functional selectivity" is expected to fundamentally avoid or significantly reduce systemic side effects such as increased bleeding risk caused by traditional non-specific PAR1 antagonists, as well as common cardiovascular adverse reactions of existing visceral hypersensitivity treatments (such as 5-HT4 receptor agonists), thus significantly improving treatment safety.

[0022] (4) The polypeptide, its encoding gene, and the pharmaceutical composition containing it provided by this invention provide the core material basis for developing novel, highly effective, and low-toxic drugs for treating irritable bowel syndrome (IBS) and other gastrointestinal functional diseases characterized by visceral hypersensitivity. Its "precision intervention" strategy is not limited to IBS, but also provides potential new treatment ideas for other diseases mediated by abnormal activation of the PAR1 / β-arrestin2 signaling axis (such as certain inflammatory pain, neurogenic diseases, etc.), and has important scientific value and broad clinical application prospects. Attached Figure Description

[0023] Figure 1 The immunoprecipitation method used in Example 2 was used to detect the inhibitory effect of the peptide PAR1-peptide on the interaction between PAR1 and β-arrestin2;

[0024] Figure 2 The effect of peptide PAR1-peptide on the expression levels of PAR1 and β-arrestin2 proteins was detected by Western Blot in Example 3.

[0025] Figure 3 This represents the weight gain rate of each group of mice in Example 4;

[0026] Figure 4 The sleep latency (A) and sleep duration (B) of each group of mice in Example 4 are shown.

[0027] Figure 5 This refers to the effect of the peptide PAR1-peptide on the pain threshold of mice in each group in Example 4.

[0028] Figure 6 This illustrates the effect of the peptide PAR1-peptide on the AWR scores of mice in each group, as shown in Example 4.

[0029] Figure 7The effect of the peptide PAR1-peptide on electromyography (A) and colorectal dilation pressure (B) of mice in each group in Example 4. Detailed Implementation

[0030] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0031] Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and the experimental methods without specific conditions are all conventional methods in the art.

[0032] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0033] The experimental animals used in the following examples were all C57BL / 6J mice, which were obtained from the Experimental Animal Center of Xuzhou Medical University.

[0034] Example 1: Obtaining a virus overexpressing the peptide PAR1-peptide

[0035] This embodiment illustrates the process of obtaining lentiviruses that overexpress PAR1-peptide active peptides. The specific steps are as follows:

[0036] The coding sequence of the PAR1 C-terminal polypeptide was obtained by synthesizing the gene, cloned into the lentiviral vector pAAV-Villin promoter-MCS-EGFP-3xFLAG-WPRE, packaged and obtained a lentivirus overexpressing the polypeptide PAR1-peptide—pAAV-Villin promoter-PAR1-EGFP-3xFLAG-WPRE. The C-terminus of this lentiviral polypeptide is tagged with EGFP and FLAG (synthesized by Heyuan Biotechnology (Shanghai) Co., Ltd.).

[0037] The amino acid sequence of the peptide PAR1-peptide, as shown in SEQ ID NO.1, consists of 51 amino acid residues and constitutes a region that can interfere with the function of β-arrestin2 protein, as detailed below:

[0038] Ser Ser Glu Cys Gln Arg Tyr Val Tyr Ser Ile Leu Cys Cys Lys Glu SerSer Asp Pro Ser Ser Tyr Asn Ser Ser Gly Gln Leu Met Ala Ser Lys Met Asp ThrCys Ser Ser Asn Leu Asn Asn Ser Ile Tyr Lys Lys Leu Leu Thr.

[0039] The nucleotide sequence of the gene encoding the polypeptide PAR1-peptide is shown in SEQ ID NO.2, and is 153 bp in length, as detailed below:

[0040] TCCTCTGAGTGCCAGAGGTACGTCTACAGTATCTTATGCTGCAAAGAAAGTTCCGATCCCAGCAGTTATAACAGCAGTGGGCAGTTGATGGCAAGTAAAATGGATACCTGCTCTAGTAACCTGAATAACAGCATATACAAAAAGCTGTTAACT.

[0041] Example 2: Study on the core mechanism of peptide PAR1-peptide

[0042] In this embodiment, the effect of peptide PAR1-peptide on the interaction between PAR1 / β-arrestin2 was detected by immunoprecipitation.

[0043] 1. Experimental Procedure

[0044] FHs 74 Int cells were cultured in 6-well plates, and the cells were treated in groups for 24 h before being collected. The experimental groups are as follows:

[0045] ①NS group: 0.9% normal saline;

[0046] ②H40632 group: 2 μL pAAV-Villin promoter-MCS-EGFP-3xFLAG-WPRE lentiviral vector control, titer 1×10⁻⁶ 11 vg / mL;

[0047] ③AAV-1 group: 1 μL of lentivirus pAAV-Villin promoter-PAR1-EGFP-3xFLAG-WPRE overexpressing the peptide PAR1-peptide, titer 1×10⁻⁶ 11 vg / mL;

[0048] ④AAV-2 group: 2 μL of lentivirus pAAV-Villin promoter-PAR1-EGFP-3xFLAG-WPRE overexpressing the peptide PAR1-peptide, titer 1×10⁻⁶. 11 vg / mL.

[0049] Take 400 μg of protein sample, add 350 μL of immunoprecipitation buffer containing 0.5 mM DTT, add primary antibody (Ptoteintech, 26366-1-AP, diluted 1 / 100), incubate overnight at 4°C, add 20 μL of Protein A agarose beads (Protein A-Sepharose CL-4B), incubate at 4°C with shaking for 2 h, centrifuge at 10000 g for 2 min at 4°C, discard the supernatant, wash the precipitate three times with immunoprecipitation buffer, and resuspend the precipitate with an appropriate amount of buffer. Add an equal volume of 2×SDS-PAGE loading buffer, boil for 5 min, centrifuge at 10000 g for 10 min, collect the supernatant, separate the protein by SDS-PAGE, and detect the protein by Western blotting.

[0050] 2. Experimental Results

[0051] like Figure 1 As shown, a weak PAR1 / β-arrestin2 binding band was observed in the NS group (saline control), reflecting the level of basal intracellular interaction. In the H40632 group (empty virus control), the PAR1 / β-arrestin2 binding band signal was slightly enhanced, but the difference was not significant compared with the NS group. This result indicates that the introduction of the empty viral vector itself did not specifically interfere with the endogenous interaction of PAR1 / β-arrestin2. In the AAV-1 and AAV-2 groups (peptide PAR1-peptide experimental groups), the β-arrestin2 band signal co-precipitated with PAR1 completely disappeared, while the PAR1 band itself remained clearly visible. Quantitative analysis by grayscale showed that the difference between the peptide PAR1-peptide experimental group and the empty virus control group was statistically significant (P = 0.019).

[0052] The experimental results of this embodiment show that the peptide PAR1-peptide can specifically inhibit the interaction between PAR1 and β-arrestin2.

[0053] Example 3: Effect of peptide PAR1-peptide on target protein expression levels

[0054] This embodiment observes the effect of PAR1-peptide treatment on the expression levels of PAR1 and β-arrestin2 proteins in cells.

[0055] 1. Experimental Procedure

[0056] HEK293 and FHs 74 Int cells were cultured in 6-well plates. Cells were divided into a control group (with solvent added) and an experimental group. The experimental group was treated with PAR1-peptide (1 μL lentivirus pAAV-Villin promoter-PAR1-EGFP-3xFLAG-WPRE, titer 1×10⁻⁶). 11 HEK293 and FHs 74 Int cells were treated with PBS (vg / mL) for 24 h. Total protein was extracted, and proteins were separated by SDS-PAGE. Proteins were transferred to PVDF membranes via a semi-dry / wet transfer method. The membranes were incubated with PBS containing 5% skim milk powder at room temperature for 2 h. Primary antibodies (PAR1, Ptoteintech, Cat No. 26366-1-AP, dilution 1 / 1500; β-arrestin-2, Ptoteintech, Cat No. 10171-1-AP, dilution 1 / 1500; β-actin, Ptoteintech, Cat No. 20536-1-AP, dilution 1 / 2000) were added and incubated overnight at 4°C. The membranes were washed three times with PBST, and secondary antibody (Cat Ptoteintech, No. SA00001-2, dilution 1 / 5000) was added and incubated at room temperature for 1 h. h, the membrane was washed again with PBST, chemiluminescent buffer was added, and the membrane was exposed. After image scanning, the bands were analyzed using ImageJ software. The effect of the peptide PAR1-peptide on the expression levels of proteins such as PAR1 and β-arrestin2 was detected.

[0057] 2. Experimental Results

[0058] like Figure 2 As shown, in both HEK293 and FHs 74 Int cell lines, compared with the untreated groups (HEK293, FHs 74 Int), the PAR1 protein band signal intensity in the PAR1-peptide-treated groups (HEK293+AAV, FHs 74 Int+AAV) did not change significantly, but the β-arrestin2 band signal was significantly weakened. Quantitative analysis of grayscale values ​​confirmed that this downregulation was statistically significant (P = 0.031).

[0059] The experimental results of this embodiment show that the PAR1-peptide does not affect the protein expression level of the target receptor PAR1 itself, but it can consistently and significantly reduce the expression of the downstream signaling protein β-arrestin2 in two different cell sources (human embryonic kidney cells and human intestinal epithelial cells). Combined with the results of Example 2, the resulting decrease in β-arrestin2 protein levels is likely due to the downstream cascade reaction or negative feedback regulation caused by the specific blocking of the upstream PAR1 / β-arrestin2 interaction. This further confirms, from the perspective of protein expression, the deep intervention efficacy of the PAR1-peptide on the PAR1 / β-arrestin2 signaling pathway.

[0060] Example 4: Evaluation of the therapeutic effect of peptide PAR1-peptide on viscerally hypersensitive mouse model

[0061] This embodiment verifies the overall therapeutic effect of the peptide PAR1-peptide based on the above mechanism in a disease animal model.

[0062] 1. Establishment and evaluation of a mouse model of visceral hypersensitivity induced by chronic sleep deprivation

[0063] (1) Model establishment

[0064] An IBS visceral hypersensitivity mouse model was established using a mouse sleep deprivation device. Eight-week-old male C57BL / 6J mice underwent a one-week acclimatization period. Pain thresholds were measured, and mice exhibiting hypersensitivity (pain threshold score ≥3 points when colonic and rectal distension pressure ≤20 mmHg) were excluded. Mice meeting the modeling criteria were then subjected to sleep deprivation. The mice were randomly divided into four groups (n=9, specific groupings are shown in step 3 below). Each group underwent a 21-day sleep deprivation intervention using the sleep deprivation device.

[0065] After the model is built, the model building effect is evaluated using the following three indicators:

[0066] ① Weight growth rate: Compare the weight growth rate before and after the modeling process;

[0067] ② Sleep latency: The time to the disappearance of the righting reflex in mice was determined by intraperitoneal injection of chloral hydrate (concentration 3%, dose 0.2 mL / 20g) as the sleep latency;

[0068] ③ Sleep duration: The time from the disappearance of the righting reflex to the spontaneous recovery of the righting reflex in mice is defined as the sleep duration.

[0069] (2) Model success determination

[0070] like Figure 3 ,4 As shown, compared with the control group, the group receiving sleep deprivation exhibited a significantly reduced weight gain rate ( Figure 3 ), sleep latency was significantly shortened ( Figure 4 (A) Sleep duration significantly prolonged ( Figure 4 (B)

[0071] The significant differences in the above three indicators (P < 0.05) together indicate that the 21-day chronic sleep deprivation mouse model was successfully established and can be used for subsequent visceral sensitivity experiments.

[0072] 2. Lentiviral enema

[0073] A 24 G blunt-tipped indwelling tubing (0.7 mm outer diameter, 30 mm length) was slowly inserted into the mouse colon approximately 2 cm via the anus. A 1 mL sterile syringe was connected, and 100 µL of enema was administered per mouse, either with physiological saline or a lentiviral suspension carrying the target gene (titer 1×10⁻⁶). 11 (vg / mouse). The injection time was controlled at 10-15 s, followed by gentle extubation. The mouse was then inverted with its head down for 30 s to promote fluid retention. The entire procedure was performed at 25°C under isoflurane (1.5%-2%) inhalation anesthesia. The mice were then isolated and observed for 24 h post-procedure.

[0074] 3. Experimental grouping (different drugs were injected during the enema step in step 2 above)

[0075] ①SHAM group: only 0.9% saline was injected;

[0076] ②SD+NS group: sleep deprivation + injection of 0.9% saline;

[0077] ③ SD+H40632 group: Sleep deprivation + injection of 0.9% saline solution and pAAV-Villin promoter-MCS-EGFP-3xFLAG-WPRE lentiviral vector control;

[0078] ④SD+AAV group: sleep deprivation + injection of 0.9% saline solution and lentivirus pAAV-Villin promoter-PAR1-EGFP-3xFLAG-WPRE overexpressing the peptide PAR1-peptide.

[0079] 4. Visceral sensitivity testing

[0080] (1) Preparation and placement of balloon

[0081] The balloon was constructed based on the published literature (Tao E, Long G, Yang T, et al. Maternal Separation Induced Visceral Hypersensitivity Evaluated via Novel and Small Size Distention Balloon in Post-weaning Mice. Front Neurosci. 2022;15:803957.Published 2022 Jan 28. doi:10.3389 / fnins.2021.803957IF: 3.2 Q2). A 2 cm long finger cot from a small latex glove was used. Three small holes were intermittently cut into the side wall of the indwelling needle catheter, and the finger cot was tied tightly to the end of the catheter with surgical sutures. After construction, the balloon was checked for leaks. If there were no leaks, the balloon was connected to a mercury manometer. Mice were fasted for 24 hours but allowed free access to water before the visceral sensitivity test.

[0082] (2) Abdominal withdrawal reflex (AWR) score

[0083] After mice were effectively anesthetized with sevoflurane, a self-made balloon coated with paraffin oil was slowly inserted into the mouse's anus about 2 cm deep. The balloon catheter was fixed to the mouse's tail. After the mice were fully awakened, their behavioral responses were observed in an observation box. The colorectal distention (CRD) method was used, with air being injected sequentially to increase the balloon pressure. The initial pressure was 10 mmHg, maintained for 20 seconds, and then increased by 10 mmHg every 4 minutes. The scores were calculated according to the AWR scoring system. The measurement was repeated 3 times, and the average value was taken.

[0084] (3) Pain threshold

[0085] The balloon insertion method before measurement is the same as in step (2). During the initial CRD, a pressure of 10 mmHg is applied and maintained for 10 s. The behavioral response of the mice is observed. After 4 min, a pressure of 20 mmHg is applied and the mice are scored until the behavioral performance reaches an AWR score of 3. The above test is repeated 3 times and the average value is taken.

[0086] (4) Electromyography (EMG)

[0087] Mice were anesthetized with sevoflurane and fixed on the operating table. The skin was cut along the direction of the external oblique muscle, and a sterile bipolar electrode was inserted into the external oblique muscle. The muscle surface was kept moist by dripping physiological saline. After the mice were fully awakened, colonic and rectal dilation was performed according to the AWR detection method described above. EMG was acquired using a LabChart v8.1.21 signal acquisition system. Each CRD was maintained for 10 seconds, with a 4-minute interval, and the measurement was repeated 3 times. The pressure gradients were 10, 20, 30, and 40 mmHg, and the discharge of the external oblique muscle was recorded. The system exported the area under the curve (AUC) of the EMG at each pressure gradient. The final result was the difference between the AUC and the baseline discharge at each pressure gradient, and the average value was taken.

[0088] 5. Experimental Results and Analysis

[0089] To verify the therapeutic effect of the peptide PAR1-peptide, visceral sensitivity was assessed in four groups of mice. The experimental results are as follows: Figure 5-7 As shown. After the enema, the control group received no special treatment. The other three groups of mice were subjected to sleep deprivation for 21 days, and visceral sensitivity was measured in all four groups. The specific analysis is as follows:

[0090] like Figure 5 As shown, compared with the SHAM group, the pain threshold of mice in the SD+NS and SD+H40632 groups was significantly reduced ( * P < 0.05, while the pain threshold of mice in the SD+AAV group did not decrease significantly (P > 0.05), indicating that PAR1-peptide enema can significantly improve the pain threshold of mice.

[0091] like Figure 6 As shown, compared with the SHAM group, the AWR score of mice in the NS+SD group was significantly increased at pressures of 20 and 40 mmHg. * P < 0.05), while the AWR score of the SD+AAV group mice did not increase significantly under any pressure (P > 0.05), indicating that PAR1-peptide enema can significantly reduce the AWR score of the colorectal dilation test in mice.

[0092] like Figure 7 As shown, compared with the SHAM group, the AUC of mice in the NS+SD group was significantly increased at pressures of 20, 30, and 40 mmHg. * P < 0.05), while the AUC of the SD+AAV group mice did not increase significantly under any pressure (P > 0.05), indicating that the PAR1-peptide enema can significantly reduce the AUC of the colorectal dilation experiment in mice.

[0093] The experimental results of this embodiment demonstrate that local administration of a lentivirus expressing the peptide PAR1-peptide via enema can produce a comprehensive and significant therapeutic effect in a sleep deprivation-induced visceral hypersensitivity model mouse. Specifically, it significantly prevents the descent of the pain threshold ( Figure 5 ), significantly reduced the abdominal wall withdrawal reflex (AWR) score caused by colorectal distension ( Figure 6 ) and abdominal electromyographic activity area (AUC, Figure 7 Furthermore, all indicators recovered to levels that were not statistically different from those of the normal (SHAM) group.

[0094] The overall efficacy of this drug forms a logical closed loop with the molecular and cellular mechanisms of action elucidated in this invention: the relief of visceral hypersensitivity symptoms in model mice is due to the specific inhibition of the pathological interaction between PAR1 and β-arrestin2 in vivo by the PAR1-peptide polypeptide (Example 2), and may precisely block the core signaling pathway driving visceral hypersensitivity by downregulating the protein level of β-arrestin2 (Example 3).

[0095] In summary, this embodiment validates, from the perspective of animal disease models, that targeted intervention of the PAR1 / β-arrestin2 interaction is an effective therapeutic strategy. This provides crucial preclinical pharmacodynamic evidence for developing the PAR1-peptide into an innovative drug for treating irritable bowel syndrome and other viscerally hypersensitive diseases through local administration, precise mechanism, and low risk of side effects.

[0096] The embodiments described above are only some, not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. The scope of protection of the present invention is determined by the scope claimed in the claims. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

Claims

1. A polypeptide, characterized in that, The amino acid sequence of the polypeptide is shown in SEQ ID NO.

1.

2. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the polypeptide as described in claim 1.

3. The isolated nucleic acid molecule according to claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule as described in claim 2 or 3.

5. A host cell, characterized in that, The host cell contains the recombinant expression vector as described in claim 4, or its genome integrates the nucleic acid molecules as described in claim 2 or 3.

6. A pharmaceutical composition, characterized in that, The product comprises a therapeutically effective amount of the polypeptide as described in claim 1, the nucleic acid molecule as described in claim 2 or 3, the recombinant expression vector as described in claim 4, or the host cell as described in claim 5, and a pharmaceutically acceptable carrier or excipient.

7. The use of the polypeptide of claim 1, the nucleic acid molecule of claim 2 or 3, the recombinant expression vector of claim 4, the host cell of claim 5, or the pharmaceutical composition of claim 6 in the preparation of a medicament for the prevention and / or treatment of diseases characterized by visceral hypersensitivity.

8. The application according to claim 7, characterized in that, The disease characterized by visceral hypersensitivity is irritable bowel syndrome.

9. The application according to claim 7, characterized in that, The drug exerts its therapeutic effect by specifically interfering with the interaction between PAR1 and β-arrestin2.

10. The application according to claim 7, characterized in that, The dosage form of the drug is any pharmacologically acceptable dosage form.