Bacterial strain for degrading alternaria toxin and application of bacterial strain

Abstract

The invention discloses a strain for degrading alternaria toxin and application of the strain, and relates to the technical field of microorganisms. The disclosed biocontrol bacterium MM14-1 is identified to be trichoderma harzianum through ITS, the trichoderma harzianum MM14-1 shows that the trichoderma harzianum MM14-1 has a good inhibition effect on growth of alternaria alternata in a degradation test on a liquid culture medium, the degradation rate reaches 96%, meanwhile, the degradation rate of an intracellular crude extract of the trichoderma harzianum MM14-1 on alternaria alternata toxin is 98.04%, and the trichoderma harzianum MM14-1 can be used for preparing the trichoderma harzianum. The intracellular crude extract of trichoderma harzianum MM14-1 can inhibit synthesis of alternaria tenuissima toxin, can be applied to prevention and treatment of alternaria tenuissima and alternaria tenuissima toxin, can overcome the problems of environmental safety, health safety and the like caused by use of chemical pesticides, is beneficial to pollution-free production of agricultural products, and can improve the product quality. According to the method, a strain capable of degrading alternaria toxin more efficiently, safely and stably is provided, and a breakthrough from bacterium prevention to detoxification is achieved.

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular to a strain that degrades Alternaria toxin and its application. Background Technology

[0002] Xinjiang is a prime production area for processing tomatoes in China, accounting for over 80% of the national output. However, with the continuous expansion of processing tomato cultivation and the promotion of trellisless cultivation methods, insufficient ventilation and light penetration in the fields have become increasingly prominent, leading to frequent outbreaks of tomato fungal diseases. Tomato fruits are frequently infected by Alternaria alternata after harvest. Alternaria sp. Infection by Alternaria alternata causes black, sunken spots on tomato fruits, severely impacting tomato yield. It also accumulates Alternaria toxins within the tomato plant, such as Alternaria methyl ether (AME), Alternaria alcohol (AOH), Alternaria ketoacid (TeA), and TEN, which pose health risks. TeA, a cytotoxic and genotoxic mycotoxin, has the highest detection rate and content among all Alternaria toxins in tomato products and grains. It not only directly causes agricultural product spoilage and economic losses but also poses potential acute and chronic health threats to consumers by contaminating the food chain. It exhibits cytotoxicity, genotoxicity, mutagenicity, and can cause digestive system damage, liver and kidney dysfunction, immunosuppression, and even potential carcinogenic risks, making it a significant risk factor in food safety.

[0003] Currently, in terms of prevention and control technologies, traditional physical methods such as heat treatment and ultraviolet radiation can have some effect on Alternaria toxin, but their effectiveness is affected by various factors and may impact food quality. Domestic and international research on... Alternaria sp. Chemical control measures still heavily rely on chemical pesticides, but pesticide resistance and residues are becoming increasingly prominent problems. Therefore, biological control has become a research hotspot due to its environmentally friendly and sustainable characteristics. Among these methods, microbial degradation of toxins can specifically target the toxic groups of fungal toxins, converting them into low-toxicity or non-toxic products, which is of great significance for the safe and high-value utilization of contaminated agricultural products.

[0004] However, the field of biodegradation is still in its early exploratory stages, with a relatively weak research foundation. In recent years, although a few studies have successfully isolated strains with degradation capabilities by screening microorganisms using Alternaria toxin as the sole carbon source, systematic work remains very limited. In particular, research on key functional enzymes and molecular mechanisms of degradation is extremely lacking, and the degradation effect is unclear, which seriously restricts the transformation of this technology into practical applications. Summary of the Invention

[0005] This application provides a strain for degrading Alternaria toxin and its application. By applying the Trichoderma strain to degrade Alternaria toxin, the degrading bacteria directly act on the toxin molecules, breaking them down into low-toxicity or non-toxic products. This method is more efficient, safe, and stable than traditional biodegradation methods, solving the technical problems of poor Alternaria toxin degradation efficiency in existing technologies and ensuring agricultural product safety. It enables the large-scale preparation of active crude extracts from highly efficient strains, the identification of key active components, and the development of biocontrol agents suitable for agricultural product treatment, achieving a breakthrough from "antibacterial" to "detoxification."

[0006] In one aspect, embodiments of this application provide a Trichoderma crassum MM14-1.

[0007] One possible implementation involves the use of Trichoderma crassum MM14-1 in the degradation of Alternaria toxin.

[0008] In one possible implementation, Trichoderma crassum MM14-1 is used in the preparation of products that degrade Alternaria toxin.

[0009] In one possible implementation, the Alternaria toxin is Alternaria ketoxin.

[0010] Furthermore, this application also provides a degradation formulation for Alternaria toxin, said degradation formulation containing Trichoderma harzianum (… Trichoderma crassum MM14-1, its culture or its intracellular crude extract, or at least one of them.

[0011] One or more technical solutions provided in the embodiments of this application have at least the following technical effects or advantages:

[0012] This application embodiment utilizes a strain that degrades Alternaria toxin and its application, employing the *Trichoderma* strain provided in this application (…). Trichoderma crassum MM14-1 was cultured and tested, and the results showed that *Trichoderma* (…) Trichoderma crassum MM14-1 has the effect of degrading ketone acids from Alternaria alternata in tomato products. (Trichoderma harzianum) Trichoderma crassum When MM14-1 and Alternaria alternifolia ketoacid are cultured in liquid culture medium, Alternaria alternifolia ketoacid can be significantly degraded, with a degradation rate of 98.04%. This effectively controls the pollution of Alternaria alternifolia toxin in tomato products, overcomes a series of environmental and health safety problems caused by the use of chemical pesticides, and is conducive to the pollution-free production of agricultural products and improves product quality. Attached Figure Description

[0013] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 The degradation effects of different strains on TeA in liquid culture medium provided in the embodiments of this application; Figure 2 The *Trichoderma* provided in the embodiments of this application ( Trichoderma crassum Colony morphology and spore images of MM14-1; among which, Figure 2 -A represents Trichoderma ( Trichoderma crassum Colony morphology diagram of MM14-1; Figure 2 -B is a spore diagram of Trichoderma MM14-1; Figure 3 The *Trichoderma* provided in the embodiments of this application ( Trichoderma crassum ) Evolutionary tree of the ITS gene in MM14-1; Figure 4 The *Trichoderma* provided in the embodiments of this application ( Trichoderma crassum The degradation rate of TeA toxin by different components of MM14-1; Figure 5 The *Trichoderma* provided in the embodiments of this application ( Trichoderma crassum Mass spectrum of the degradation of TeA in tomato products by intracellular crude extract of MM14-1; Figure 6 The *Trichoderma* provided in the embodiments of this application ( Trichoderma crassum Degradation efficiency of MM14-intracellular crude extract on TeA in tomato products. Detailed Implementation

[0015] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this application. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0016] The Alternaria toxin in this application is selected from Alternaria solanilide (TeA).

[0017] Trichoderma pachyderma ( Trichoderma crassum MM14-1 was the first isolate isolated from new plum soils in 15 locations in Xinjiang, and was identified by ITS as *Trichoderma lappa*. Trichoderma crassumMM14-1, in the degradation test of Trichoderma MM14-1 on liquid culture medium, showed a good inhibitory effect on the growth of Alternaria alterniflora, with a degradation rate of 96%. Meanwhile, in the PDB liquid culture test, Trichoderma MM14-1 showed... Trichoderma crassum The intracellular crude extract of MM14-1 showed a TeA degradation rate of 98.04%.

[0018] This strain was deposited prior to the application date at the Budapest Treaty International Depository for Microorganisms: China General Microbiological Culture Collection Center (CGMCC). Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China. The deposit date is October 9, 2025, and the accession number is CGMCC No. 42238. Microbiological identification confirms it as *Trichoderma* (…). Trichoderma crassum ).

[0019] Unless otherwise specified, all materials and reagents mentioned below are commercially available products well known to those skilled in the art; unless otherwise specified, all methods described are methods known in the art. Unless otherwise defined, the technical or scientific terms used should have the ordinary meaning understood by those skilled in the art to which this invention pertains.

[0020] Example 1: Thick-skinned Trichoderma ( Trichoderma crassum Separation, screening and identification of MM14-1 1. Strain isolation and screening Five g of soil was uniformly separated and weighed using the quartering method. 45 mL of sterile water was added, and the mixture was incubated in a shake flask at 25°C and 150 r / min for 1 h. The resulting culture was then serially diluted 10⁻¹ to 10⁻⁶, with 50 μL of each of the six dilutions spread onto PDA medium. The plates were sealed and incubated at 28°C for 24 h or more until clearly visible single colonies formed. Single colonies were selected from the plates, and different bacterial species were chosen and purified based on their morphology. Bacteria were cultured using streak plating, and fungi were cultured using spot inoculation. The colonies were then cultured in fresh medium for 1–7 days, labeled, and observed for contamination by other microorganisms.

[0021] The obtained strains were co-cultured with TeA standard in PDB liquid medium for 3 days, and the degradation rate was calculated. Three copies of each strain were prepared. The strain with the highest degradation rate was selected for secondary screening and stored for later use. The degradation rate of TeA was calculated according to formula (1). The test results are shown in Table 1 and... Figure 1 .

[0022] Toxin degradation rate (%) = (peak area of ​​control group - peak area of ​​experimental group) / peak area of ​​control group × 100%; (1) Table 1. Degradation effect of different strains on TeA in liquid culture medium

[0023] from Figure 1 As shown in Table 1, the experimental results indicate that all tested strains exhibited significant degradation ability in the liquid culture medium degradation screening test against TeA toxin. Among them, Figure 1 The horizontal axis represents the sample name of the experimental bacterial strain, and the vertical axis represents the degradation rate against TeA toxin. Figure 1 The strain ZJ14-1 is the *Thalassiopeia* mentioned in this application. Trichoderma thick Among the strains, MM14-1 and ZJ14-1 (MM14-1) showed the most significant degradation effect, with a peak area decreasing to 2.00E+07 and a degradation rate of 78%, the highest among all groups. Strain ZJ10-5 also exhibited strong degradation activity, with a degradation rate of 76%. Other strains, such as ZJ7-4 and ZJ8-3, had degradation rates of 71%, ZJ6-1 and ZJ14-3 70%, and ZJ8-7 and ZJ14-2 68% and 67%, respectively. Although strain ZJ10-6 had a relatively low degradation rate of 62%, its peak area (3.52E+07) was significantly lower than that of the blank control group (9.22E+07). The overall results indicate that the experimental strains all exhibited stable and significant degradation effects on TeA under liquid culture conditions, demonstrating good application potential.

[0024] 2. Morphological characteristics The initial colonies of strain MM14-1 on PDA medium are white, dense, round, and have regular edges. Figure 2 As shown in -B, as the colony grows, green spores gradually appear in the center, with the color changing from light green to dark green or blue-green. Figure 2 -A shows that the entire colony eventually turns green. A white hyphae grow band surrounds the colony, and the surface may be slightly fluffy or fibrous.

[0025] 3. Physiological and biochemical characteristics Strain MM14-1 is suitable for growth on PDA medium. The suitable temperature range for growth is 25℃ ~ 28℃, with the optimum temperature being 25℃. The suitable pH range for growth is 4 ~ 8, with the optimum pH being 4.

[0026] 4. Molecular biological characteristics DNA was extracted from the degrading bacterium MM14-1 using a fungal DNA extraction kit, following the instructions. BLAST (a tool for aligning nucleic acid or protein sequences, developed by NCBI) was used to analyze adjacent species, and a phylogenetic tree was constructed using MEGA11.0 (a tool for constructing phylogenetic trees). Figure 3 As shown, the degrading bacterium MM14-1 and some ITS genes of Trichoderma hymenopsis ( Trichoderma crassum The strain shared 94% homology with DAOM 164916 ITS. Based on its morphological characteristics, physiological and biochemical features, and the results of the aforementioned BLAST analysis, strain MM14-1 was ultimately identified by microbiology as *Trichoderma*. Trichoderma crassum This strain was deposited prior to the application date at the Budapest Treaty International Depository for Microorganisms: China General Microbiological Culture Collection Center (CGMCC). Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China. The deposit date is October 9, 2025, and the accession number is CGMCC No. 42238.

[0027] Specifically, Trichoderma chrysanthemi ( Trichoderma crassum The ITS sequence of MM14-1 is as follows: TATTGATATGCTTAAGTTCAGCGGGTATTCCCTACCTGATCCGAGGTCAACATTTCAGAAGTTTGGGGTGTTTAACGGCTGTGGACGCGCCGCGCTCCCGATGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCAC TGTATTTCGGGGCCGGCCCCGTAAAGGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATT CTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAACGCCCACGAGGGGCGCCGAGATGGCTCAGATAGTAAAAAAACCCGCGAGGGGGTA TACAATAAGAGTTTTGGTTGGTCCTCCGGCGGGCGCCTTGGTCCGGGGCTGCGACGCACCCGGGGCAGAGATCCCGCCGAGGCAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGTT Example 2: Microbial strain ( Trichoderma crassum MM14-1 culture method The strain obtained in Example 1 ( Trichoderma crassum MM14-1 was inoculated onto PDA solid medium with an inoculation needle and activated. It was then cultured in an incubator at 28°C for 7 days. The mycelial cake (1 cm in diameter) of Trichoderma MM14-1 was taken with a sterile punching loop and transferred to PDB liquid medium. It was then cultured in a shaking incubator at 25°C at a rate of 180 r / min for 72 h to obtain Trichoderma cells and fermentation broth.

[0028] Example 3: Microbial strain ( Trichoderma crassum MM14-1 test against Alternaria toxin The punch was used to extract *Trichoderma* from Example 2, which had been activated for 7 days. Trichoderma crassum The mycelial cake (1 cm in diameter) of MM14-1 and 20 μL of TeA standard solution were added to 20 mL of PDB liquid culture medium (the liquid composition of the control group CK and the experimental group is shown in Table 2). The mixture was cultured on a shaker at 28℃ and 180 r / min for 3 days. Alternaria toxin was detected using QuEChERS (a sample pretreatment method) combined with liquid chromatography-mass spectrometry / mass spectrometry. Each experiment was repeated 3 times. The degradation rate of TeA was calculated according to formula (1) in Example 1. The test results are shown in Table 3. The content of Alternaria toxin TeA in the shaker culture liquid on the 3rd day was detected using liquid chromatography-mass spectrometry / mass spectrometry. Compared with the control group CK, the content of *Trichoderma* (*Hypertricis*) in the experimental group was significantly lower. Trichoderma crassum MM14-1 achieved a 96% degradation rate for TeA.

[0029] Table 2. Trichoderma ( Trichoderma crassum MM14-1 experimental groupings on liquid culture medium

[0030] Table 3. Trichoderma ( Trichoderma crassum Degradation rate of TeA by MM14-1 in liquid culture medium

[0031] Example 4: Preparation of Crude Intracellular Extract of Trichoderma lataniae The *Trichoderma* obtained in Example 2 ( Trichoderma crassumMM14-1 cells were activated on PDA plates for 7 days, followed by activation on PDB medium for 3 days. Cells were deposited by centrifugation at 8000 rpm for 20 min in 50 mL centrifuge tubes. After adding 10 mL of PBS (phosphate-buffered saline), the cells were washed with a first agitation and transferred to a 15 mL centrifuge tube. The cells were then centrifuged again under the same conditions, the supernatant was discarded, and 5 mL of PBS was added for a second agitation and centrifugation. Finally, a small amount of PBS was added for a third agitation and cell washing, and the cells were transferred to a 1.5 mL centrifuge tube. After centrifugation and discarding the supernatant, the Trichoderma MM14-1 cells were obtained.

[0032] The above centrifuged precipitate is Trichoderma ( Trichoderma crassum The MM14-1 bacterial cells were rinsed with sterile PBS buffer, centrifuged, and the supernatant was discarded. The cells were then transferred to a 1.5 mL centrifuge tube and a small amount of liquid nitrogen was added. The cells were then ground continuously in a mortar for 2-5 minutes (this step was repeated multiple times under ice bath conditions). After thorough grinding, the broken cells were washed with a small amount of PBS and centrifuged (8000 rpm, 20 min). The supernatant was transferred to a 15 mL centrifuge tube, and this step was repeated three times. Subsequently, the cells were centrifuged at 8000 rpm for 20 min, and the supernatant was transferred to a clean glass tube to obtain the crude intracellular extract of Trichoderma MM14-1.

[0033] Example 5: Thick-skinned Trichoderma ( Trichoderma crassum The effect of intracellular crude extract of MM14-1 on TeA The *Trichoderma* obtained in Example 4 ( Trichoderma crassum The intracellular crude extract of MM14-1 was tested for TeA on liquid culture medium. The liquid composition of the control group (CK) and the experimental group is shown in Table 4.

[0034] Table 4. Trichoderma ( Trichoderma crassum Experimental grouping of MM14-1 intracellular crude extract on liquid culture medium

[0035] Table 5. Trichoderma ( Trichoderma crassum Degradation rate of TeA by MM14-1 on liquid culture medium

[0036] As shown in Table 5 and Figure 4 As shown, the content of Alternaria toxin TeA in the shaker culture liquid on day 3 was detected by liquid chromatography-mass spectrometry / mass spectrometry. Compared with the control group (CK), the intracellular crude extract of Trichoderma MM14-1 in the experimental group showed a TeA degradation rate of 98.63%. Figure 4The horizontal axis represents the microbial composition of Trichoderma MM14-1, and the vertical axis represents the degradation rate of the corresponding TeA toxin.

[0037] Example 6: Application of Trichoderma harzianum in the degradation of Alternaria toxin In the embodiments of this application, *Trichoderma* ( Trichoderma crassum The application of MM14-1 in the degradation of Alternaria toxin, or in the preparation of products that degrade Alternaria toxin. *Trichoderma harzianum* ( Trichoderma crassum The application of MM14-1 in controlling plant diseases caused by Alternaria toxin, or in the preparation of control agents for Alternaria toxin-induced diseases. The application of Trichoderma harzianum in degrading Alternaria toxin is also relevant to the preparation of biocontrol agents for controlling Alternaria toxin in tomatoes.

[0038] Alternatively, Trichoderma ( Trichoderma crassum The application of MM14-1 in the degradation of Alternaria toxin is applied to tomato products. This is achieved through the use of *Trichoderma* (…). Trichoderma crassum The crude intracellular extract of MM14-1 can be directly added to tomato products to prevent contamination by Alternaria toxin in tomato products.

[0039] For example, the concentration of the intracellular crude extract added ranges from 1% to 5%, and the tomato products can be tomato powder, tomato sauce, or fresh tomato pulp.

[0040] Specifically, sterile Watson's water was used to dilute tomato sauce by 20% and tomato powder by 5%, resulting in a final volume of 20 mL. 20 mL of tomato sauce, fresh tomato pulp, and tomato powder solution were added to a 150 mL Erlenmeyer flask, followed by 20 μL of TeA standard solution (concentration 100 mg / L). Then, 1%-5% of the intracellular crude extract of *Trichoderma MM14-1* (400 μL) was added, and the flask was incubated at 25℃ in a constant temperature shaker (the liquid composition of the control group CK and the experimental group is shown in Table 6). After 3 days, Alternaria toxin was detected using the QuEChERS method combined with liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS). Each group was repeated three times, and the degradation rate was calculated according to formula (1) in Example 1. The test results are shown in Table 7. Figure 5 and Figure 6 .

[0041] In the degradation experiments of TeA in different tomato matrices, all treatment groups showed significant degradation effects, and their degradation efficiency varied significantly depending on the type of matrices. Figure 5 Thick-skinned Trichoderma ( Trichoderma crassum The mass spectrum of the degradation of TeA in tomato products by the intracellular crude extract of MM14-1 is shown. The peak area of ​​TeA in the experimental group was significantly lower than that in the control group. The horizontal axis represents retention time, and the vertical axis represents the mass spectrometry peak response value. Figure 6 As shown, it is Trichoderma ( Trichoderma thick The degradation efficiency of TeA in tomato products by MM14 intracellular crude extract is shown in the graph. The horizontal axis represents the sample type of tomato product, and the vertical axis represents the degradation rate of TeA. Fresh tomato pulp showed the most significant effect, with the peak area of ​​TeA decreasing dramatically from 1.38E+07 in the control group to 9.22E+05, achieving a degradation rate of 90.78%. Tomato powder also exhibited strong degradation ability, with a degradation rate of 70.49% and a peak area decreasing from 2.25E+07 to 6.64E+06. In comparison, while the degradation effect of tomato sauce was slightly less, the degradation rate still reached 64.81%, and the peak area of ​​TeA decreased from 2.39E+07 to 8.41E+06. The overall results indicate that this degradation method is applicable to various tomato products, and is particularly effective in fresh tomato pulp matrix.

[0042] Table 6. Trichoderma ( Trichoderma crassum Experimental grouping of intracellular crude extract of MM14-1 in tomato products

[0043] Table 7. Trichoderma ( Trichoderma crassum Degradation of TeA in tomato products by MM14-1

[0044] Example 7: Application of Trichoderma in the preparation of biocontrol agents for controlling Alternaria tomato toxin The MM14-1 strain achieved a 98.04% degradation rate of TeA under optimal laboratory conditions, and a degradation rate exceeding 80% in tomato products, with stable degradation characteristics, meeting the needs of large-scale production and qualifying for use as a biocontrol agent. The active ingredient in the biocontrol agent is *Trichoderma harzianum* (…). Trichoderma crassum MM14-1 intracellular crude extract can degrade Alternaria toxin. The biocontrol agents are available in liquid, powder, wettable powder, or wettable granules. Thick-skinned Trichoderma (…) is a component of the biocontrol agent. Trichoderma crassum The final concentration of the crude intracellular extract of MM14-1 is 10⁷ CFU / mL to 10⁸ CFU / mL. Preferably, considering cost savings, the biocontrol agent is preferably prepared in liquid form.

[0045] The above embodiments are only for illustrating the technical concept and features of the present invention in a specific scenario. Their purpose is to enable those who need this technology to understand the content of the present invention and implement it. They do not limit the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A type of Trichoderma ( Trichoderma crassum MM14-1.

2. A type of Trichoderma as described in claim 1 ( Trichoderma crassum Application of MM14-1 in the degradation of Alternaria toxin.

3. A type of Trichoderma as described in claim 1 ( Trichoderma crassum Application of MM14-1 in the preparation of products that degrade Alternaria toxin.

4. The application as described in claim 2, characterized in that, The Alternaria toxin is Alternaria ketoacid.

5. The application as described in claim 3, characterized in that, The Alternaria toxin is Alternaria ketoacid.

6. A degradation agent for Alternaria toxin, characterized in that, The degradation agent contains *Trichoderma* as described in claim 1. Trichoderma crassum MM14-1, its culture or its intracellular crude extract, or at least one of them.

Images