Compositions and methods for gene modification of CD70

Abstract

Compositions and methods for editing, e.g., altering, DNA sequences within the CD70 gene are provided. Compositions and methods for reducing or eliminating CD70 protein expression in a cell are provided. Compositions and methods for immunotherapy are provided.

Description

I. Cross-referencing of related applications

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 519,495, filed August 14, 2023, and U.S. Provisional Application No. 63 / 610,531, filed December 15, 2023, pursuant to 35 USC 119(e), the contents of each of which are incorporated herein by reference in their entirety.

[0002] II. Reference to Electronic Sequence Lists This application contains a sequence list submitted electronically in XML file format and hereby incorporated in its entirety by reference. The XML file was created on August 12, 2024, named "01155-0058-00PCT.xml", and has a size of 3,315,072 bytes. Summary of the Invention

[0003] This disclosure relates to the CRISPR / Cas9 genome editing system. In particular, this disclosure relates to gene modification of the CD70 gene.

[0004] Differentiation cluster 70 (CD70) is a cytokine belonging to the tumor necrosis factor (TNF) family (Goodwin et al., 1993). CD70 is a transmembrane protein that is transiently expressed on the surface of CD4+ and CD8+ T cells, regulatory T cells (Tregs), B cells, antigen-presenting cells (such as dendritic cells), and natural killer (NK) cells in response to immune activation.

[0005] CD70 is a known ligand of CD27, a protein in the TNF receptor superfamily. Upon binding to CD27, CD70 triggers an intracellular signaling cascade, ultimately leading to a variety of outcomes, including T cell expansion and B cell differentiation. While transient CD70 expression plays a crucial role in promoting normal immune responses, chronic CD70 expression is associated with T cell exhaustion, a broad term used to describe T cell responses to chronic antigen stimulation (van Gisbergen et al. 2009; Yang et al. 2014). This was first observed in the context of chronic viral infection but has also been investigated in immune responses to tumors. The characteristics and features of T cell exhaustion mechanisms may have a crucial impact on the success of checkpoint blockade and adoptive T cell transfer therapies.

[0006] Therefore, there is a need for improved methods and compositions for modifying cells to overcome the problems of chronic CD70-mediated abnormal immune responses (such as T cell exhaustion) and to further enhance the immune response.

[0007] This document provides compounds, compositions, systems, and methods for genetically modifying CD70. For example, compositions and methods for editing CD70 target sequences (e.g., insertions, deletions, or substitutions of nucleosides) are provided. Cells with genetic modifications in CD70 are also covered. Methods for promoting immune responses and treating cancer and infectious diseases using the provided compositions are also provided.

[0008] This disclosure relates to cell populations, including cells with genetic modifications in the CD70 sequence as provided herein. These cells can be used in adoptive T-cell transfer therapy.

[0009] This disclosure relates to compositions and uses of genetically modified cells having a CD70 sequence, which are used in therapies such as cancer therapy and immunotherapy. This disclosure relates to and provides gRNA molecules, CRISPR systems, cells, and methods for use in cellular genome editing.

[0010] This article provides an engineered cell that contains gene modifications in the CD70 sequence within the genomic coordinates chr19:6586002-6591015.

[0011] In some embodiments, this disclosure provides engineered cells in which the surface expression of the CD70 protein is reduced or eliminated due to genetic modifications in the CD70 gene. Engineered cell compositions produced by the methods disclosed herein have desired properties, including, for example, reduced or eliminated CD70 protein expression, reduced chronic CD70-mediated aberrant immune responses (such as T cell exhaustion), thereby enhancing immune responses.

[0012] The use of any of the aforementioned embodiments of the cell composition or formulation for preparing a medicament for treating a subject is also disclosed. The subject may be a human or an animal (e.g., a human or a non-human animal, such as a cynomolgus monkey). Preferably, the subject is a human.

[0013] Also disclosed are any of the aforementioned compositions or formulations for generating CD70 gene sequences using gene modifications (e.g., insertions, substitutions, or deletions). In some embodiments, the intra-sequence gene modification results in a change in the nucleic acid sequence that prevents the translation of the full-length protein prior to the gene modification at the genomic locus, for example, by forming frameshift or nonsense mutations, causing premature termination of translation. Gene modifications may include insertions, substitutions, or deletions at splice sites (i.e., splice acceptor sites or splice donor sites), such that aberrant splicing results in frameshift, nonsense, or truncated mRNA, thereby causing premature termination of translation. Gene modifications may also disrupt the translation or folding of the protein encoding the protein, leading to premature termination of translation.

[0014] In another aspect, this disclosure provides a method for treating a subject, the method comprising administering cells (e.g., a cell population) prepared by a cell preparation method described herein, such as any of the foregoing aspects and embodiments of the cell preparation method.

[0015] Also disclosed are any of the aforementioned compositions or preparations for generating gene modifications (e.g., insertions, substitutions, or deletions) in the CD70 sequence. In some embodiments, the gene modification within the sequence results in a change in the nucleic acid sequence that prevents the translation of the full-length protein prior to the gene modification at the genomic locus, for example, by forming frameshift or nonsense mutations, causing premature termination of translation. Gene modifications may include insertions, substitutions, or deletions at splice sites (i.e., splice acceptor sites or splice donor sites), such that aberrant splicing results in frameshift, nonsense, or truncated mRNA, thereby causing premature termination of translation. Gene modifications may also disrupt the translation or folding of the protein encoding the protein, leading to premature termination of translation.

[0016] In another aspect, this disclosure provides a method for providing enhanced immunotherapy to a subject, the method comprising administering to the subject an effective amount of cells as described herein, such as cells of any of the foregoing cell aspects and embodiments.

[0017] In some embodiments, this disclosure provides an engineered cell comprising gene modifications within genomic coordinates chr19:6586002-6591015. In some embodiments, this disclosure provides an engineered cell having reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and comprising gene modifications within genomic coordinates chr19:6586002-6591015.

[0018] In some embodiments, the engineered cells contain gene modifications within any of the genomic coordinates listed in Table 2A. In some embodiments, the gene modifications are within genomic coordinates targeted by a CD70 guide RNA containing a guide sequence of any of SEQ ID NO: 1-38.

[0019] In some embodiments, the engineered cells contain gene modifications within any of the genomic coordinates listed in Table 3A. In some embodiments, the gene modifications are within genomic coordinates targeted by a CD70 guide RNA containing a guide sequence of any of SEQ ID NO: 101-169.

[0020] Further embodiments are provided throughout and described in the claims and drawings. Attached Figure Description

[0021] Figure 1 The average insertion / deletion (indel) percentage and the average percentage of CD70 negative cells after editing are shown.

[0022] Figure 2A-2C The average insertion / deletion ratio after CD70 gene editing is shown.

[0023] Figure 3 The average percentage of edited data and the average percentage of CD70-negative T cells are shown.

[0024] Figure 4A It displays the average percentage of edits created after editing and the average percentage of stop codons.

[0025] Figure 4B The average percentage of CD70-negative T cells after editing is shown.

[0026] Figures 5A-5D The effects of dual (DKO) versus single (SKO) IEE (immunoenhanced editing) knockout using constructs 5719, 5718, or 4645 on the 786-O tumor cell line are shown, measured as the percentage of remaining viable tumor cells. Unedited cells served as a control. Constructs 5719 and 5718, with CD70 SKO alone and CD70+ TGFβR2 DKO, were tested. Figure 5A The percentage of tumor cell viability in construct 5719 in the absence of TGFβ is shown, and Figure 5B The results for construct 5719 in the presence of TGFβ are shown. Figure 5C The percentage of tumor cell viability in construct 5718 in the absence of TGFβ is shown, and Figure 5D The results for construct 5718 in the presence of TGFβ are shown.

[0027] Figure 6A -D shows the in vitro re-attack of the 768-O tumor cell line against four CD70 constructs, individually or with SKO or DKO IEE editing, based on tumor cell area (mm²). 2 The construct was measured against the baseline construct 4645 and the standalone TRAC KO. Figure 6A The results of constructor 5719 are shown. Figure 6B The results of constructor 5281 are shown. Figure 6C The results for constructor 5715 are shown, and Figure 6D The results of constructor 6115 are displayed.

[0028] Figures 7A-7DFour CD70 constructs, individually or with SKO or DKO IEE editing, were shown to demonstrate in vitro re-attack against ACHN tumor cell lines, based on tumor cell area (mm²). 2 The construct was measured against the baseline construct 4645 and the standalone TRAC KO. Figure 7A The results of constructor 5719 are shown. Figure 7B The results of constructor 5281 are shown. Figure 7C The results for constructor 5715 are shown, and Figure 7D The results of constructor 6115 are displayed.

[0029] Figures 8A-8C The efficacy of three CD70 CAR constructs, individually with SKO or with DKO IEE editing, relative to the baseline construct 4645, was demonstrated in a 786-O mouse tumor cell model, based on tumor volume (mm²). 3 To measure. Figure 8A The results of constructor 5719 are shown. Figure 8B The results for constructor 5715 are shown, and Figure 8C The results of constructor 5281 are displayed.

[0030] Figures 9A-9D Shown in Figures 8A-8C The results of re-attack on CD70CAR constructs with SKO or DKO IEE editing that completely control tumor growth were determined by tumor volume (mm). 3 The construct was measured using [method name missing]. It was compared to mice with only tumors. Figure 9A The results of the re-attack on construct 5719 + CD70 KO are shown. Figure 9B The results of the re-attack on the construct 5715 + CD70 + TGFβR2 DKO are shown. Figure 9C The results of the re-attack on the construct 5281 + CD70 + TGFβR2 DKO are shown. Figure 9D The results of the re-attack on the construct 5719 + CD70 + TGFβR2 DKO are shown.

[0031] Figure 10 The percentage of allogeneic CD70 CAR-T cell editing per edit is shown for each of the three donors, as assessed by flow cytometry or genome sequencing (results from each donor are shown as solid dots).

[0032] Figure 11A-11C The percentage of CAR T cells presenting the specified activation markers is displayed. Figure 11A The percentage of CAR T cells that are positive for CD69 is shown. Figure 11BThe percentage of CAR T cells that are positive for CD107a is shown, and Figure 11C The percentage of CAR T cells that are positive for CD25 is shown.

[0033] Figure 12A-12B The results of re-attacks with three different batches of CAR-T cells against tumor cell lines with high and moderate CD70 expression are shown, as measured by the number of tumor cells. Figure 12A The results of re-attack with T cells targeting the 786-O tumor cell line were shown, and Figure 12B The results of re-attack with T cells targeting the ACHN tumor cell line are shown.

[0034] Figure 13 This study demonstrates the efficacy of two different batches of T cells against 786-O tumor cells at three different doses (10e6, 3e6, 1e6) over a 115-day period, as shown by changes in tumor volume (mm). 3 ) was measured.

[0035] Figure 14 The study demonstrated the efficacy of engineered T cells against 11 different PDX tumor models over a 42-day period, as shown by tumor volume (mm²). 3 ) was measured.

[0036] Figure 15 This section displays karyotype analysis data comparing edited cells with donor-matched unedited controls. Two hundred cell spreads were analyzed for each sample (N = 3 donors). Statistical analysis for each indicator aberration was performed donor-by-donor using Fisher's Exact Test. * indicates p < 0.05 for any donor group. Bars represent the mean + / - SD from three matched donors (points).

[0037] Figures 16A-16B The average percentage of engineered donor T cells killed by host NK cells normalized to individual CAR groups (all donors in the B2M CD70-CAR T cell group or all donors in the allogeneic CD70-CAR T cell group) after treatment with host NK cells that were either genotype mismatched or HLA-C matched is shown. Figure 16A The results of the genotype mismatch system were shown, and Figure 16B The results of the HLA-C matching system are shown.

[0038] Figures 17A-17CThe average percentage of proliferation of engineered donor T cells (all donors in the CAR group alone (solid circles) or all donors in the allogeneic CD70 CAR T cell group (solid squares)) compared to normalized values ​​after treatment with host PBMCs that were either genotype mismatched or C-matched. Figure 17A The results of the genotype mismatch system were shown, and Figure 17B The results of the C matching system are displayed. Figure 17C The average percentage of proliferation of engineered donor T cells in the presence of autologous PBMCs is shown. Detailed Implementation

[0039] Reference will now be made in detail to certain embodiments of this disclosure, examples of which are illustrated in the accompanying drawings. While this doctrine has been described in conjunction with various embodiments, it is not intended to limit this doctrine to those embodiments. Rather, as those skilled in the art will understand, this doctrine encompasses various alternatives, modifications, and equivalents.

[0040] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter in any way. In the event of any material incorporated by reference that contradicts any terminology defined herein or any other express content herein, this specification shall prevail.

[0041] This document provides the following numbered implementation schemes: Implementation scheme 1 is an engineered cell containing gene modifications within the genomic coordinates chr19:6586002-6591015.

[0042] Implementation scheme 2 is an engineered cell that has reduced or eliminated surface expression of CD70 protein compared to unmodified cells, and contains gene modifications within the genomic coordinates chr19:6586002-6591015.

[0043] Implementation scheme 3 is an engineered cell as described in implementation scheme 1 or 2, wherein the gene modification is within genomic coordinates targeted by a CD70 guide RNA, the guide RNA comprising a guide sequence of any of SEQ ID NO: 1-38.

[0044] Implementation scheme 4 is an engineered cell as described in any one of implementation schemes 1-3, said engineered cell having reduced or eliminated CD70 surface expression relative to unmodified cells, and containing gene modifications within any of the genomic coordinates listed in Table 2A.

[0045] Implementation scheme 5 is an engineered cell as described in any one of implementation schemes 1-4, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590121-6590145; chr19:6586002-6586026; chr19:6586003-6586027; chr19:6586013-6586037; chr19:6586357-6586381; chr19:6586365-6586389; chr19:6586376-6586400; chr19:6590988-65910 12;chr19:6590991-6591015;chr19:6590862-6590886;chr19:6586396-6586420;chr19:6586372-6586396;chr19:6586371-65863 95;chr19:6586360-6586384;chr19:6586355-6586379;chr19:6586268-6586292;chr19:6586259-6586283;chr19:6586256-658628 0;chr19:6586142-6586166;chr19:6586141-6586165;chr19:6586135-6586159;chr19:6586128-6586152;chr19:6586127-658615 1;chr19:6586126-6586150;chr19:6586121-6586145;chr19:6586120-6586144;chr19:6586096-6586120;chr19:6586055-6586079 ;chr19:6586029-6586053; chr19:6586023-6586047; chr19:6586312-6586336; chr19:6586151-6586175; chr19:6586145-6586169; chr19:6586100-6586124; chr19:6586030-6586054; chr19:6586028-6586052; chr19:6586395-6586419; and chr19:6586394-6586418.

[0046] Implementation scheme 6 is an engineered cell as described in any one of implementation schemes 1-5, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590121-6590145 and chr19:6586268-6586292.

[0047] Embodiment 7 is an engineered cell as described in any one of Embodiments 1-6, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of SEQ ID NO: 1 or 16.

[0048] Embodiment 8 is an engineered cell as described in Embodiment 1 or 2, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of any of SEQ ID NO: 101-169.

[0049] Implementation scheme 9 is an engineered cell as described in any one of implementation schemes 1, 2 and 8, said engineered cell having reduced or eliminated CD70 surface expression relative to unmodified cells, and containing gene modifications within any of the genomic coordinates listed in Table 3A.

[0050] Implementation scheme 10 is an engineered cell as described in any one of implementation schemes 1, 2, 8 and 9, wherein the gene modification is within the genomic coordinates selected from the following: (a) chr19:6590998-6591018; chr19:6590995-6591015; chr19:6590992-6591012; chr19:6590991-6591011; chr19:6590987-6591007; chr19:6590986-6591006; chr19:6590985-6591005; chr19:6590977-6590997; chr19:6590972-6590992; chr19:6590966-6590 986;chr19:6590958-6590978;chr19:6590957-6590977;chr19:6590945-6590965;chr19:6590944-6590964;chr19:6590940-65 90960;chr19:6590939-6590959;chr19:6590935-6590955;chr19:6590926-6590946;chr19:6590920-6590940;chr19:6590919- 6590939;chr19:6590914-6590934;chr19:6590908-6590928;chr19:6590907-6590927;chr19:6590899-6590919;chr19:659087 5-6590895;chr19:6590866-6590886;chr19:6590844-6590864;chr19:6590843-6590863;chr19:6586374-6586394;chr19:6586 368-6586388; chr19:6586288-6586308; chr19:6586285-6586305; chr19:6586276-6586296; chr19:6586267-6586287; chr19:6586199-6586219; chr19:6586172-6586192; chr19:6586138-6586158; chr19:6586099-6586119; and chr19:6586050-6586070; and (b) chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863;chr19:6590835-6590855; chr19:6590104-6590124; chr19:6590096-6590116; chr19:6590095-6590115; chr19:65 90094-6590114;chr19:6590093-6590113;chr19:6590087-6590107;chr19:6590084-6590104;chr19:6590083-65 90103;chr19:6590078-6590098;chr19:6586368-6586388;chr19:6586299-6586319;chr19:6586267-6586287;ch r19:6590842-6590862; chr19:6590139-6590159; chr19:6590138-6590158; chr19:6590135-6590155; chr19:65900 79-6590099;chr19:6590077-6590097;chr19:6586412-6586432;chr19:6586404-6586424;chr19:6586403-65864 23;chr19:6586396-6586416;chr19:6586396-6586416;chr19:6586395-6586415;chr19:6586388-6586408;chr19: 6586380-6586400;chr19:6586379-6586399;chr19:6586375-6586395;chr19:6586369-6586389;chr19:6586367- 6586387; chr19:6586360-6586380; chr19:6586359-6586379; chr19:6586120-6586140; and chr19:6586028-6586048. ;

[0051] Embodiment 11 is an engineered cell as described in any one of Embodiments 1, 2 and 8-10, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116 and 123.

[0052] Implementation scheme 12 is an engineered cell as described in any one of implementation schemes 1, 2 and 8-11, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927.

[0053] Embodiment 13 is an engineered cell as described in any one of Embodiments 1, 2 and 8-10, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164 and 168.

[0054] Implementation scheme 14 is an engineered cell as described in any one of implementation schemes 1, 2, 8-10 and 13, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590875-6590895; chr19:6586396-6586416; chr19:6586388-6586408; chr19:6586379-6586399; chr19:6586369-6586389; and chr19:6586120-6586140.

[0055] Embodiment 15 is a composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises a. a guide sequence selected from SEQ ID NO: 1-38; b. a guide sequence of at least 20, 21, 22, 23, 24, or 25 consecutive nucleotides selected from SEQ ID NO: 1-38; c. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 1-38; d. a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of genomic coordinates listed in Table 2A; e. at least 20, 21, 22, 23, or 24 consecutive nucleotides from the sequence (d); or f. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from (d).

[0056] Embodiment 16 is a composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NO: 101-169; b. a guide sequence of at least 17, 18, 19, or 20 consecutive nucleotides selected from SEQ ID NO: 101-169; c. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 101-169; d. a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of genomic coordinates listed in Table 3A; e. at least 17, 18, 19, or 20 consecutive nucleotides from the sequence (d); or f. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from (d).

[0057] Embodiment 17 is a composition as described in Embodiment 15 or 16, said composition being used to alter the DNA sequence within the CD70 gene in a cell.

[0058] Embodiment 18 is a pharmaceutical composition comprising the composition described in Embodiment 15 or 16, or the use of the composition described in Embodiment 15 or 16 for inducing double-strand breaks or single-strand breaks in the CD70 gene in cells, altering the nucleic acid sequence of the CD70 gene in cells, or reducing the expression of the CD70 gene in cells.

[0059] Embodiment 19 is a method for manufacturing engineered human cells having reduced or eliminated surface expression of the CD70 protein compared to unmodified cells, the method comprising contacting the cells with a composition as described in Embodiment 15 or 16.

[0060] Implementation Scheme 20 is a method for reducing the surface expression of CD70 protein in cells relative to unmodified cells, the method comprising contacting cells with a composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises a. a guide sequence selected from SEQ ID NO: 1-38; b. a guide sequence of at least 20, 21, 22, 23, 24, or 25 consecutive nucleotides selected from SEQ ID NO: 1-38; c. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 1-38; d. a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of genomic coordinates listed in Table 2A; e. at least 20, 21, 22, 23, 24, or 25 consecutive nucleotides from the sequence (d); or f. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from (d).

[0061] Embodiment 21 is a composition, use, or method as described in any one of Embodiments 15 and 17-20, wherein the guide RNA comprises the guide sequence of SEQ ID NO: 1 or 16.

[0062] Implementation Scheme 22 is a method for reducing the surface expression of CD70 protein in cells relative to unmodified cells, the method comprising contacting cells with a composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NO: 101-169; b. a guide sequence of at least 17, 18, 19, or 20 consecutive nucleotides selected from SEQ ID NO: 101-169; c. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 101-169; d. a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of genomic coordinates listed in Table 3A; e. at least 17, 18, 19, or 20 consecutive nucleotides from the sequence (d); or f. a guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from (d).

[0063] Embodiment 23 is a composition, use, or method as described in any one of embodiments 16-19 and 22, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116, and 123.

[0064] Embodiment 24 is a composition, use, or method as described in any one of Embodiments 15-23, wherein the RNA-guided DNA binder is a lysin.

[0065] Embodiment 25 is a composition, use, or method as described in any one of Embodiments 16-19, 22, and 24, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164, and 168.

[0066] Embodiment 26 is a composition, use, or method as described in any one of Embodiments 15-25, wherein the RNA-guided DNA binder is a base editor.

[0067] Embodiment 27 is a cell population comprising engineered cells as described in any one of Embodiments 1-14, or engineered cells produced by using a composition as described in any one of Embodiments 15-18, 21 and 23-26, or a method as described in any one of Embodiments 19-26.

[0068] Embodiment 28 is a pharmaceutical composition comprising (a) engineered cells as described in any one of Embodiments 1-14, or engineered cells produced by a composition or method as described in any one of Embodiments 15-26; or (b) a cell population as described in Embodiment 27.

[0069] Embodiment 29 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-28, wherein the genetic modification comprises at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinates.

[0070] Embodiment 30 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-29, wherein the genetic modification comprises at least 5, 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinates.

[0071] Embodiment 31 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-30, wherein the gene modification comprises insertion, deletion, or substitution.

[0072] Embodiment 32 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-31, wherein the gene modification comprises an insertion / deletion, C-to-T substitution, or A-to-G substitution within the genomic coordinates.

[0073] Embodiment 33 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-32, wherein the gene modification comprises an insertion / deletion.

[0074] Embodiment 34 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 1-33, wherein the gene modification comprises the insertion of a heterologous coding sequence.

[0075] Embodiment 35 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-34, wherein the gene modification comprises substitution.

[0076] Embodiment 36 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-35, wherein the gene modification comprises A to G substitutions.

[0077] Embodiment 37 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-36, wherein the gene modification comprises a C to T substitution.

[0078] Implementation scheme 38 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of implementation schemes 1-37, wherein the cell is engineered using a genome editing system.

[0079] Embodiment 39 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 38, wherein the genome editing system comprises an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0080] Embodiment 40 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 39, wherein the nucleic acid encoding the RNA-guided DNA binder comprises mRNA, and the mRNA comprises an open reading frame (ORF) encoding the RNA-guided DNA binder.

[0081] Embodiment 41 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 39 or 40, wherein the RNA-guided DNA binder or the RNA-guided DNA binder encoded by the nucleic acid comprises a Cas9 nuclease.

[0082] Embodiment 42 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 39-41, wherein the RNA-guided DNA binder is a nuclease.

[0083] Embodiment 43 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 39-42, wherein the RNA-guided DNA binder is a Cas9 nuclease.

[0084] Embodiment 44 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 43, wherein the Cas9 is Streptococcus pyogenes (Streptococcus pyogenes). S. pyogenes Cas9.

[0085] Embodiment 45 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 44, wherein the Streptococcus pyogenes Cas9 comprises an amino acid sequence having at least 90% identity with a sequence selected from SEQ ID NO: 853-857, or an ORF encoding Streptococcus pyogenes Cas9 having at least 90% identity with a sequence selected from SEQ ID NO: 853-857.

[0086] Embodiment 46 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 45, wherein the ORF encoding the amino acid sequence has at least 85% identity with a sequence selected from SEQ ID NO: 813, 814, and 816-819.

[0087] Embodiment 47 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 43, wherein the Cas9 is Neisseria meningitidis ( N. meningitidis Cas9 (NmeCas9).

[0088] Embodiment 48 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 47, wherein the NmeCas9 comprises an amino acid sequence having at least 90% identity with a sequence selected from SEQ ID NO: 832-834, or an ORF encoding NmeCas9 having at least 90% identity with a sequence selected from SEQ ID NO: 832-834.

[0089] Embodiment 49 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 48, wherein the ORF encoding the amino acid sequence has at least 85% identity with a sequence selected from SEQ ID NO: 802, 803, and 805-807.

[0090] Embodiment 50 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 41-49, wherein the nuclease has double-stranded endonuclease activity.

[0091] Embodiment 51 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 41-49, wherein the nuclease has nicking enzyme activity.

[0092] Embodiment 52 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 41-49, wherein the nuclease is non-catalytically active.

[0093] Embodiment 53 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 41-52, wherein the nuclease further comprises a heterologous functional domain.

[0094] Embodiment 54 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 53, wherein the nuclease is a nicking enzyme and the heterologous functional domain is a deaminase.

[0095] Embodiment 55 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 54, wherein the deaminase is cytidine deaminase or adenine deaminase.

[0096] Embodiment 56 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 55, wherein the deaminase is a cytidine deaminase.

[0097] Embodiment 57 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 56, wherein the deaminase is an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.

[0098] Embodiment 58 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 54-57, wherein the nuclease and the deaminase comprise an amino acid sequence having at least 90% identity with a sequence selected from: 831, 835-838, 851, 852, and 858, or an ORF encoding an amino acid sequence having at least 90% identity with a sequence selected from SEQ ID NO: 831, 835-838, 851, 852, and 858.

[0099] Embodiment 59 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 58, wherein the ORF encoding the amino acid sequence has at least 85% identity with a sequence selected from SEQ ID NO: 801, 804, 811, 812, and 815.

[0100] Embodiment 60 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 56-59, wherein the engineered cell, cell population, pharmaceutical composition, or method further comprises a uracil glycosidase inhibitor (UGI) or a nucleic acid encoding UGI, wherein the nuclease does not contain UGI, or the nucleic acid encoding the nuclease does not encode UGI.

[0101] Embodiment 61 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 60, wherein the UGI comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 859, or an ORF encoding an amino acid sequence having at least 90% identity with the sequence of SEQ ID NO: 859.

[0102] Embodiment 62 is an engineered cell, cell population, pharmaceutical composition or method as described in Embodiment 61, wherein the ORF encoding the amino acid sequence has at least 85% identity with any one of SEQ ID NO: 823-826, optionally SEQ ID NO: 823.

[0103] Embodiment 63 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 40-62, wherein the ORF is a modified ORF.

[0104] Embodiment 64 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 41-63, wherein the nuclease has nicking enzyme activity.

[0105] Embodiment 65 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 41-64, wherein the nuclease or the nuclease encoded by the nucleic acid comprises Neisseria meningitidis Cas9 (NmeCas9).

[0106] Implementation scheme 66 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 65, wherein NmeCas9 comprises Nme2Cas9.

[0107] Embodiment 67 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 65 or 66, wherein the nucleic acid encoding Nme2Cas9 is mRNA, and the mRNA comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, or 100% identity with SEQ ID NO: 834.

[0108] Embodiment 68 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 58-67, wherein the nucleic acid encoding the base editor comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, or 100% identity with SEQ ID NO: 801.

[0109] Embodiment 69 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 41-64, wherein the Cas9 nuclease comprises Streptococcus pyogenes (Spy) Cas9.

[0110] Embodiment 70 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 69, wherein the nucleic acid encoding an RNA-guided DNA binder is mRNA, and the mRNA comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, or 100% identity with SEQ ID NO: 813.

[0111] Embodiment 71 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 70, wherein the nucleic acid encoding the base editor comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, or 100% identity with SEQ ID NO: 811.

[0112] Embodiment 72 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 3-71, wherein the guide RNA is a dual guide RNA (dgRNA).

[0113] Embodiment 73 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 3-71, wherein the guide RNA is a single guide RNA (sgRNA).

[0114] Embodiment 74 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 73, wherein the sgRNA is Spy sgRNA.

[0115] Embodiment 75 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 74, wherein the Spy sgRNA further comprises one or more of the following: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein at least one of the following nucleotide pairs in hairpin 1 is substituted by a Watson-Crick pairing nucleotide: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region optionally lacks a. a. any one or both of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides in hairpin region 1; or 2. the shortened hairpin region 1 is missing 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions H1-1, H1-2, or H1-3 are missing or substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601), or b. one or more of positions H1-6 to H1-10 are missing relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601). 601) is substituted; or 3. The shortened hairpin region 1 is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12 or n are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or B. The shortened upper stem region is missing 1-6 nucleotides and the 6, 7, 8, 9, 10 or 11 nucleotides of the shortened upper stem region include fewer than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or C. At any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601). Substitution of 601), wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or D. an exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region.

[0116] Implementation scheme 76 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 75, wherein the guide RNA lacks 6 nucleotides in the shortened hairpin 1.

[0117] Implementation scheme 77 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 75, wherein the guide RNA lacks 8 nucleotides in the shortened hairpin 1.

[0118] Embodiment 78 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 75-77, wherein H-1 and H-3 are missing.

[0119] Embodiment 79 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 75-78, wherein the guide RNA further comprises a 3' tail.

[0120] Embodiment 80 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 79, wherein the 3' tail is 1-4 nucleotides in length, optionally 1 nucleotide in length.

[0121] Embodiment 81 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 75-80, wherein the guide RNA comprises an upper stem region comprising modifications to any one or more of US1-US12 in the upper stem region.

[0122] Embodiment 82 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 73 or 74, wherein the sgRNA comprises a nucleotide sequence selected from the sequences in Tables 4A-5B.

[0123] Embodiment 83 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 73 or 74, wherein the guide RNA comprises a modified nucleotide sequence selected from the modified Spy guide scaffold sequences in Table 5A, wherein the modified nucleotide sequence is at the 3' of the guide sequence.

[0124] Embodiment 84 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 83, wherein the guide RNA is modified according to a pattern of nucleotide sequences selected from modified Spy guide RNA sequences in Table 5B.

[0125] Embodiment 85 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 73-84, wherein the guide comprises a nucleotide sequence selected from unmodified Spy guide RNA sequences in Table 4B, wherein N20 together is the guide sequence as described in Embodiment 3.

[0126] Implementation scheme 86 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 85, wherein each nucleotide of the unmodified Spy guide RNA sequence in Tables 4A-4B is any natural or non-natural nucleotide.

[0127] Embodiment 87 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 73-86, wherein the guide RNA is modified according to a pattern selected from the modification patterns in Table 5B, wherein (mN*)3N17 refers to the guide sequence, wherein the first three nucleotides contain a 2'-O-Me modification and a phosphate thioester bond.

[0128] Embodiment 88 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 73 or 74, wherein the engineered cell, cell population, pharmaceutical composition, or method comprises a sequence or modification pattern selected from SEQ ID NO: 620, 630-641, and 658-669.

[0129] Embodiment 89 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 73 or 74, wherein the engineered cell, cell population, pharmaceutical composition, or method comprises a sequence or modification pattern selected from SEQ ID NO: 641 and 669.

[0130] Embodiment 90 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 73, wherein the sgRNA is an Nme sgRNA comprising a guide region and a conserved region.

[0131] Embodiment 91 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 90, wherein the conserved region comprises one or more of the following: (a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region is missing 2-24 nucleotides relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 37-48 and 53-64 are missing relative to SEQ ID NO: 700 and optionally one or more of nucleotides 37-64 are substituted relative to SEQ ID NO: 700; and (ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or (b) a shortened hairpin 1 region, wherein the shortened hairpin 1 is missing 2-10 nucleotides, optionally 2-8 nucleotides, relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 82-86 and 91-95 are missing relative to SEQ ID NO: 700 and optionally one or more of positions 82-96 are missing relative to SEQ ID NO: 700. 700 is substituted; and (ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or (c) a shortened hairpin 2 region, wherein the shortened hairpin 2 is missing 2-18 nucleotides relative to SEQ ID NO: 700, optionally 2-16 nucleotides, wherein (i) one or more of nucleotides 113-121 and 126-134 is missing relative to SEQ ID NO: 700 and optionally one or more of nucleotides 113-134 is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; one or two nucleotides 144-145 are optionally missing relative to SEQ ID NO: 700; optionally, wherein at least 10 nucleotides are modified nucleotides.

[0132] Embodiment 92 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 90 or 91, wherein the conserved region comprises a modified nucleotide sequence selected from the modified conserved region Nme guide RNA motif in Table 6, and wherein the conserved region is located at the 3' of the guide region.

[0133] Embodiment 93 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 90-92, wherein the guide RNA comprises a nucleotide sequence selected from any one of SEQ ID NO: 700-706, 1018, 1019, and 720-732, or any other modified sequence shown in Tables 7A-7B, wherein N represents a guide sequence of any one of SEQ ID NO: 1-38.

[0134] Implementation scheme 94 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 93, wherein each nucleotide is any natural or non-natural nucleotide.

[0135] Embodiment 95 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 93 or 94, wherein the guide RNA is modified according to a pattern selected from SEQ ID NO: 720-732, wherein N is a guide sequence of any of SEQ ID NO: 1-38, N, A, C, G, and U are ribonucleotides (2'-OH), "m" indicates 2'-O-Me modification, "f" indicates 2'-fluorine modification, and "*" indicates phosphate thioester linkage between nucleotides.

[0136] Embodiment 96 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 3-95, wherein the guide RNA comprises at least one end modification.

[0137] Embodiment 97 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 96, wherein the modification includes a 5' end modification.

[0138] Embodiment 98 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 96 or 97, wherein the modification includes a 3' end modification.

[0139] Embodiment 99 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 96-98, wherein the guide RNA comprises a modification in a hairpin region.

[0140] Implementation scheme 100 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 99, wherein the modification in the hairpin region is also an end modification.

[0141] Embodiment 101 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 96-100, wherein the modification comprises a nucleotide modified with 2'-O-methyl (2'-O-Me).

[0142] Embodiment 102 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of embodiments 96-101, wherein the modification comprises a phosphate thioester (PS) bond between nucleotides.

[0143] Embodiment 103 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 96-102, wherein the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide linked to a 3' adjacent nucleotide by a phosphate thioester (PS) bond.

[0144] Embodiment 104 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 96-103, wherein the modification comprises a 2'-fluorine (2'F) modified nucleotide.

[0145] Embodiment 105 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 97-104, wherein the 5' end modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide at nucleotides 1-3 at the 5' end of the guide sequence, linked to the 3' adjacent nucleotide by a phosphate thioester (PS) bond.

[0146] Embodiment 106 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 3-105, wherein the guide RNA is associated with lipid nanoparticles (LNPs).

[0147] Embodiment 107 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 106, wherein the LNP comprises cationic lipids, accessory lipids, neutral lipids, occult lipids, or a combination of two or more thereof.

[0148] Embodiment 108 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 107, wherein the cationic lipid is octadecano-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, also known as (9Z,12Z)-octadecano-9,12-dienoic acid 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester.

[0149] Embodiment 109 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 107 or 108, wherein the auxiliary lipid is cholesterol.

[0150] Embodiment 110 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 107-109, wherein the neutral lipid is 1,2-distearate-sn-glycerol-3-phosphocholine (DSPC).

[0151] Embodiment 111 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 107-110, wherein the elusive lipid is 1,2-dimyristoyl-racemic-glycerol-3-methoxy polyethylene glycol 2000 (PEG2k-DMG).

[0152] Embodiment 112 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 107-111, wherein the LNP comprises octadecano-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, also known as (9Z,12Z)-octadecano-9,12-dienoic acid 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester; DSPC; cholesterol; and PEG2k-DMG.

[0153] Embodiment 113 is a pharmaceutical composition comprising engineered cells as described in any one of Embodiments 1-112.

[0154] Embodiment 114 is a cell population comprising engineered cells as described in any one of Embodiments 1-112.

[0155] Embodiment 115 is a pharmaceutical composition comprising a cell population, wherein the cell population comprises a plurality of engineered cells as described in any one of Embodiments 1-112.

[0156] Embodiment 116 is a pharmaceutical composition as described in Embodiment 113 or 115, wherein the pharmaceutical composition further comprises a pharmaceutical excipient.

[0157] Implementation scheme 117 is a method of administering engineered cells, cell populations or pharmaceutical compositions as described in any one of implementation schemes 1-116 to a subject in need.

[0158] Implementation scheme 118 is a method of administering engineered cells, cell populations or pharmaceutical compositions as described in any one of implementation schemes 1-116 to a subject as adoptive cell transfer (ACT) therapy.

[0159] Implementation scheme 119 is a method of administering engineered cells, cell populations or pharmaceutical compositions as described in any one of implementation schemes 1-116 to a subject as an immunotherapy.

[0160] Embodiment 120 is an engineered cell, cell population, or pharmaceutical composition as described in any one of Embodiments 1-116, wherein the engineered cell, cell population, or pharmaceutical composition is used as an ACT therapy.

[0161] Implementation scheme 121 is a method for treating a disease or condition, the method comprising administering to a subject in need an engineered cell, cell population or pharmaceutical composition as described in any one of implementation schemes 1-116.

[0162] Embodiment 122 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 3-121, wherein the guide RNA is provided to the cell in a vector.

[0163] Embodiment 123 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 15-122, wherein the nucleic acid encoding the RNA-guided DNA binder is provided to the cell in the same vector as the guide RNA.

[0164] Embodiment 124 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of embodiments 1-123, wherein an exogenous nucleic acid is provided to the cell, optionally in a carrier.

[0165] Embodiment 125 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 122-124, wherein the vector is a viral vector.

[0166] Implementation scheme 126 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 125, wherein the carrier is AAV.

[0167] Embodiment 127 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-126, wherein the gene modification inhibits the expression of the gene in which the gene modification is present.

[0168] Embodiment 128 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of Embodiments 1-127, wherein the gene modification inhibits the expression of the CD70 gene.

[0169] Embodiment 129 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-128, wherein the engineered cell has reduced surface expression of CD70 protein relative to unmodified cells.

[0170] Implementation scheme 130 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 129, wherein the cell surface expression of CD70 protein is below the detection level.

[0171] Embodiment 131 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-130, wherein the cell comprises an exogenous nucleic acid encoding a target receptor expressed on the surface of the engineered cell.

[0172] Embodiment 132 is an engineered cell, cell population, pharmaceutical composition or method as described in Embodiment 131, wherein the target receptor is a T cell receptor (TCR).

[0173] Embodiment 133 is an engineered cell, cell population, pharmaceutical composition, or cell method as described in Embodiment 132, wherein the target receptor is WT1 TCR.

[0174] Embodiment 134 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 131, wherein the targeted receptor is a chimeric antigen receptor (CAR).

[0175] Embodiment 135 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 134, wherein the targeted receptor is an anti-CD70 CAR.

[0176] Embodiment 136 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-135, wherein the engineered cell further comprises a gene modification in the TGFBR2 gene.

[0177] Implementation scheme 137 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 136, wherein the gene modification in the TGFBR2 gene is located within the genomic coordinates chr3:30674205-30674229.

[0178] Embodiment 138 is an engineered cell, cell population, pharmaceutical composition, or method as described in Embodiment 136 or 137, wherein the genetic modification in the TGFBR2 gene comprises at least one nucleotide within a genomic coordinate targeted by a guide RNA containing the guide sequence of SEQ ID NO: 301.

[0179] Embodiment 139 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-138, wherein the engineered cell further comprises a gene modification of one or more of the CIITA, HLA-A, HLA-B, or TRAC genes.

[0180] Embodiment 140 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-139, wherein the engineered cell further comprises a gene modification of one or more of the genes CIITA, HLA-A, HLA-B, TRAC, or TGFBR2.

[0181] Embodiment 141 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-140, wherein the engineered cells further have reduced surface expression of one or more of MHC class II, HLA-A, HLA-B, TRAC, or TGFBR2 compared to unmodified cells.

[0182] Embodiment 142 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 139-141, wherein the engineered cell comprises: i. gene modifications within genomic coordinates chr6:29942891-29942915 or chr6:29942609-29942633 of the HLA-A gene; ii. gene modifications within genomic coordinates chr6:31355222-31355246, chr6:31355221-31355245, or chr6:31355205-31355229 of the HLA-B gene; iii. Gene modifications within the genomic coordinates chr14:22547524-22547544, chr14:22550574-22550598, or chr14:22550544-22550568 of the TRAC gene; iv. Gene modifications within the genomic coordinates chr16:10906643-10906667 or chr16:10907504-10907528 of the CIITA gene; or v. A combination of two or more of (i)-(iv).

[0183] Embodiment 143 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 139-142, wherein the engineered cell comprises at least one genetic modification, said genetic modification being: (i) within genomic coordinates targeted by an HLA-A guide RNA containing a guide sequence of SEQ ID NO: 403 or 404; (ii) within genomic coordinates targeted by an HLA-B guide RNA containing a guide sequence of SEQ ID NO: 406, 405, or 407; (iii) within genomic coordinates targeted by a TRAC guide RNA containing a guide sequence of SEQ ID NO: 413, 408, or 409; (iv) within genomic coordinates targeted by a CIITA guide RNA containing a guide sequence of SEQ ID NO: 402 or 401; or (v) a combination of two or more of (i)-(iv).

[0184] Embodiment 144 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 139-143, wherein the engineered cell comprises a gene modification within the genomic coordinates chr3:30674205-30674229 or chr3:30671941-30671961 of the TGFBR2 gene.

[0185] Embodiment 145 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 139-144, wherein the engineered cell comprises at least one gene modification within a genomic coordinate region targeted by a guide RNA comprising a guide sequence comprising SEQ ID NO: 301 or 302.

[0186] Implementation scheme 145.1 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of implementation schemes 139-145, wherein the engineered cell comprises gene modifications in the HLA-A gene, gene modifications in the HLA-B gene, gene modifications in the TRAC gene and gene modifications in the CIITA gene.

[0187] Embodiment 145.2 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 139-145 and 145.1, wherein the engineered cell comprises gene modifications in the HLA-A gene, gene modifications in the HLA-B gene, gene modifications in the TRAC gene, gene modifications in the CIITA gene, and gene modifications in the TGFBR2 gene.

[0188] Implementation scheme 145.3 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of implementation schemes 139-145, 145.1, and 145.2, wherein the engineered cell comprises: i. a gene modification within genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. a gene modification within genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. a gene modification within genomic coordinates chr14:22547524-22547544 of the TRAC gene; and iv. a gene modification within genomic coordinates chr16:10906643-10906667 of the CIITA gene.

[0189] Implementation scheme 145.4 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of implementation schemes 139-145 and 145.1-145.3, wherein the engineered cell comprises: i. gene modification within genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. gene modification within genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. gene modification within genomic coordinates chr14:22547524-22547544 of the TRAC gene; iv. gene modification within genomic coordinates chr16:10906643-10906667 of the CIITA gene; and v. gene modification within genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene.

[0190] Implementation scheme 145.5 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of implementation schemes 139-145 and 145.1-145.4, wherein the engineered cell comprises: i. a gene modification in the HLA-A gene within genomic coordinates chr6:29942891-29942915; ii. a gene modification in the HLA-B gene within genomic coordinates chr6:31355222-31355246; iii. the TRAC gene. Gene modifications within the genomic coordinates chr14:22547524-22547544 of the CIITA gene; iv. Gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene; v. Gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene; and vi. Gene modifications within the genomic coordinates chr19:6590121-6590145 of the CD70 gene.

[0191] Implementation scheme 145.6 is an engineered human cell comprising gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene, gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene, gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene, gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene, gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene, and gene modifications within the genomic coordinates chr19:6590121-6590145 of the CD70 gene.

[0192] Embodiment 146 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-145 and 145.1-145.6, wherein the engineered cell is an immune cell.

[0193] Implementation scheme 147 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 146, wherein the engineered cell is a monocyte, macrophage, mast cell, dendritic cell or granulocyte.

[0194] Implementation scheme 148 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 146, wherein the engineered cell is a lymphocyte.

[0195] Implementation scheme 149 is an engineered cell, cell population, pharmaceutical composition or method as described in implementation scheme 148, wherein the engineered cell is a T cell.

[0196] Embodiment 150 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-149 and 145.1-145.6, wherein the cell is a CD4+ T cell or a CD8+ T cell. Embodiment 151 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-149 and 145.1-145.6, wherein the cell is a memory T cell.

[0197] Embodiment 152 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-151 and 145.1-145.6, wherein the cell is a stem cell memory T cell (Tscm).

[0198] Embodiment 153 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-152 and 145.1-145.6, wherein the cell is a primary cell.

[0199] Embodiment 154 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-153 and 145.1-145.6, wherein the cell is a tissue-specific primary cell.

[0200] Embodiment 155 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-154 and 145.1-145.6, wherein the cell is an activated cell.

[0201] Embodiment 156 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-154 and 145.1-145.6, wherein the cell is an inactive cell.

[0202] Embodiment 157 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-156 and 145.1-145.6, wherein the cell is an allogeneic cell.

[0203] Embodiment 158 ​​is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-145 and 145.1-145.6, wherein the cell is a stem cell.

[0204] Implementation scheme 159 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of implementation schemes 1-158 and 145.1-145.6, said engineered cell, cell population, pharmaceutical composition or method being administered to a subject as an adoptive cell transfer (ACT) therapy.

[0205] Embodiment 160 is an engineered cell, cell population, pharmaceutical composition, or method as described in any one of Embodiments 1-158 and 145.1-145.6, wherein the engineered cell, cell population, pharmaceutical composition, or method is used to treat a subject suffering from cancer.

[0206] Implementation scheme 161 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of implementation schemes 1-158 and 145.1-145.6, said engineered cell, cell population, pharmaceutical composition or method being used to treat a subject suffering from an infectious disease.

[0207] Implementation scheme 162 is an engineered cell, cell population, pharmaceutical composition or method as described in any one of implementation schemes 1-158 and 145.1-145.6, wherein the engineered cell, cell population, pharmaceutical composition or method is used to treat a subject suffering from an autoimmune disease.

[0208] Embodiment 163 is a cell population or pharmaceutical composition as described in any one of Embodiments 27-162, wherein, as measured by flow cytometry, at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the cell population is CD70 negative.

[0209] Embodiment 164 is a cell population or pharmaceutical composition as described in any one of Embodiments 27-163, wherein, as measured by next-generation sequencing (NGS), at least 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cell population contains the genetic modification in the CD70 gene.

[0210] Implementation scheme 165 is an engineered cell comprising gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, the CIITA gene, and / or the CD70 gene, wherein the gene modification in the HLA-A gene is located within genomic coordinates chr6:29942891-29942915; the gene modification in the HLA-B gene is located within genomic coordinates chr6:31355222-31355246; the gene modification in the TRAC gene is located within genomic coordinates chr14:22547524-22547544; the gene modification in the CIITA gene is located within genomic coordinates chr16:10906643-10906667; and the gene modification in the CD70 gene is located within genomic coordinates chr19:6590121-6590145.

[0211] Implementation scheme 166 is an engineered cell comprising gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, the CIITA gene, the TGFBR2 gene, and / or the CD70 gene, wherein the gene modification in the HLA-A gene is located within genomic coordinates chr6:29942891-29942915; and wherein the gene modification in the HLA-B gene is located within genomic coordinates chr6:31355222-31355. Within 246; wherein the gene modification in the TRAC gene is within the genomic coordinates chr14:22547524-22547544; wherein the gene modification in the CIITA gene is within the genomic coordinates chr16:10906643-10906667; wherein the gene modification in the TGFBR2 gene is within the genomic coordinates chr3:30674205-30674229; and wherein the gene modification in the CD70 gene is within the genomic coordinates chr19:6590121-6590145.

[0212] definition Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings: As used herein, the term "or combinations thereof" refers to all permutations and combinations of the items listed preceding the term. For example, "A, B, C, or combinations thereof" is intended to include at least one of the following: A, B, C, AB, AC, BC, or ABC, and also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB if the order is important in the particular context. Continuing this example, it explicitly includes combinations containing repetitions of one or more items or items, such as BB, AAA, AAB, BBC, CBBA, CABA, etc. Those skilled in the art will understand that, unless the context otherwise makes it obvious, there is generally no limit to the number of items or items in any combination.

[0213] As used herein, the term “kit” refers to a package of related components, such as one or more polynucleotides or compositions, and one or more related materials, such as delivery devices (e.g., syringes), solvents, solutions, buffers, instructions, or desiccants.

[0214] As used herein, an "allogeneic" cell refers to a cell derived from a donor subject of the same species as the recipient subject, wherein the donor and recipient subjects are genetically different, for example, having different genes at one or more loci. Thus, for example, the cell is allogeneic to the subject to which the cell is to be administered. As used herein, cells removed or separated from a donor and not reintroduced into the original donor are considered allogeneic cells.

[0215] As used herein, "autologous" cells refer to cells derived from the same subject into whom the material is later reintroduced. Therefore, for example, if cells are removed from a subject and then reintroduced into the same subject, the cells are considered autologous.

[0216] As used in the context of CD70 protein, the term "CD70" refers to a cytokine belonging to the tumor necrosis factor (TNF) ligand family. As used in the context of nucleic acids, "CD70" refers to the gene encoding the CD70 protein molecule. The Human Genome Project has the accession number NC_000019.10 (6581648..6591150).

[0217] As used herein, the term "within genomic coordinates" includes the boundaries of a given range of genomic coordinates. For example, if chr6:29942854-chr6:29942913 is given, then the coordinates chr6:29942854-chr6:29942913 are covered. Throughout this application, the genomic coordinates referenced are based on genomic annotations from the human genome GRCh38 (also known as hg38) assembly from the Genome Reference Consortium, available on the website of the National Center for Biotechnology Information. Tools and methods for converting genomic coordinates between assemblies are known in the art and can be used to convert genomic coordinates provided herein to corresponding coordinates in another assembly of the human genome, including conversion to earlier assemblies generated by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion to assemblies generated by different institutions or algorithms (e.g., from GRCh38 to NCBI33, generated by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, the NCBIGENome Remapping Service, available at the National Center for Biotechnology Information; UCSC LiftOver, available at the UCSC Genome Brower; and Assembly Converter, available at Ensembl.org.

[0218] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds containing nucleosides or nucleoside analogs having nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers as analogs thereof. The nucleic acid "backbone" can consist of a variety of bonds, including one or more sugar-phosphodiester bonds, peptide-nucleic acid bonds ("peptide nucleic acid" or PNA; PCT No. WO 95 / 32305), thiophosphate bonds, methylphosphonate bonds, or combinations thereof. The sugar moiety of a nucleic acid can be ribose, deoxyribose, or a similar compound with substitutions, such as 2'-methoxy, 2'-halogen, or 2'-O-(2-methoxyethyl)(2'-O-moe) substitutions. RNA can contain one or more deoxyribonucleotides, for example as modifications, and similarly, DNA can contain one or more ribonucleotides. The nitrogenous base can be a conventional base (A, G, C, T, U), its analogues (e.g., modified uridines, such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine or others); inosine; or a derivative of a purine or pyrimidine (e.g., N...).4 -Methyldeoxyguanosine, denitropurine or azapurine, denitropyrimidine or azapyrimidine, pyrimidine bases with substituents at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with substituents at the 2, 6 or 8 position, 2-amino-6-methylaminopurine, O 6 -Methylguanine, 4-thiopyrimidine, 4-aminopyrimidine, 4-dimethylhydrazine-pyrimidine and O 4 -alkyl-pyrimidine; US Patent No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion, see [link to general discussion]. The Biochemistry of the Nucleic Acids 5-36, Adams et al., eds., 11th ed., 1992. Nucleic acids may include one or more “base-free” residues, wherein the backbone does not include nitrogenous bases at one or more positions of the polymer (US Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may include conventional components and substitutions (e.g., conventional nucleosides with a 2'-methoxy substituent, or polymers containing conventional nucleosides and one or more nucleoside analogs). Nucleic acids include “locked nucleic acids” (LNAs), which are analogs containing one or more LNA nucleotide monomers in which a bicyclic furanose unit is locked in RNA in a sugar-mimicking conformation, which enhances hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004). Biochemistry 43(42):13233-41). Nucleic acids include “non-locked nucleic acids”, which are capable of regulating thermodynamic stability and also provide nuclease stability. RNA and DNA have different sugar moieties and may differ due to the presence of uracil or its analogues in RNA and thymine or its analogues in DNA.

[0219] As used herein, "peptide" refers to a polymeric compound containing amino acid residues that can adopt a three-dimensional conformation. Peptides include, but are not limited to, enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid-binding proteins, and antibodies. Peptides may, but do not necessarily, contain post-translational modifications, non-natural amino acids, or prosthetic groups.

[0220] The terms “guide RNA,” “gRNA,” and simply “guide RNA” are used interchangeably in this document to refer to a single guide RNA, or a combination of crRNA and trRNA (also known as tracrRNA). crRNA and trRNA can associate as a single RNA strand (as a single guide RNA, sgRNA) or, for example, as two separate RNA strands (dgRNA). “Guide RNA” or “gRNA” refers to each type. trRNA can be a naturally occurring sequence or a modified or mutated trRNA sequence.

[0221] As used in this article, "guide sequence" refers to a sequence within the guide RNA that is complementary to the target sequence and has the function of guiding the guide RNA to the target sequence for binding or modification (e.g., cleavage) via an RNA-guided DNA binder.

[0222] In Neisseria meningitidis ( Neisseria meningitides In the case of Cas9 (i.e., NmeCas9 (NmeCas9)) and related Cas9 homologs / orthologs, the guide sequence may be 19, 20, 21, preferably 22, 23, or 24 nucleotides long, or 20-25 nucleotides long. In some embodiments, for example, the target sequence is located in a gene or on a chromosome and is complementary to the guide sequence. In some embodiments, the complementarity or identity between the guide sequence and its corresponding target sequence is at least 80%, 85%, preferably 90%, or 95%. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one different or non-complementary nucleotide, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1-2, preferably no more than 1 mismatch, wherein the total length of the target sequence is 19, 20, 21, 22, preferably 23, or 24 nucleotides, or more. In some embodiments, the guide sequence and target region may contain one to two mismatches, wherein the guide sequence contains at least 24 or more nucleotides. In some embodiments, the guide sequence and target region may contain one to two mismatches, wherein the guide sequence contains 24 nucleotides. That is, the guide sequence and target region may form a double-stranded region having at least 2X or more base pairs. In some embodiments, the double-stranded region may include one to two mismatches such that the guide strand and target sequence are not perfectly complementary. Mismatch locations are known in the art, and as provided, for example, distal mismatches in PAM tend to be more tolerant than proximal matches in PAM. Mismatch tolerance at other locations is known in the art (see, for example, Edraki et al., 2019. Mol. Cell, 73:1-13).

[0223] For example, the Nme guide sequence can be 19, 20, 21, preferably 22, 23, or 24 nucleotides long, such that in some embodiments, the Nme Cas9 guide sequence comprises at least 22, 23, or 24 consecutive nucleotides of the sequence provided in Table 2A. In some embodiments, the guide sequence and the target sequence can be 100% complementary or identical. In other embodiments, the guide sequence and the target sequence can contain at least one mismatch, i.e., one different or non-complementary nucleotide, depending on the reference sequence. For example, the guide sequence and the target sequence can contain 1-2, preferably no more than 1, mismatch, wherein the total length of the target sequence is 19, 20, 21, 22, preferably 23, or 24 nucleotides, or more. In some embodiments, the guide sequence and the target region can contain 1 to 2 mismatches, wherein the guide sequence comprises at least 24 or more nucleotides. In some embodiments, the guide sequence and the target sequence can contain 1-2 mismatches, wherein the guide sequence comprises 24 nucleotides. In other words, the guide sequence and the target sequence can form a double-stranded region with 24 or more base pairs. In some embodiments, the double-stranded region may include one or two mismatches, such that the guide sequence and the target sequence are not perfectly complementary. Mismatch locations are known in the art; for example, distal mismatches in PAM tend to be more tolerant than proximal matches. Mismatch tolerance at other locations is known in the art (see, for example, Edraki et al., 2019. Mol. Cell, 73:1-13).

[0224] For example, the SpyCas9 guide sequence can be 16, 17, preferably 18, 19, or 20 nucleotides long, such that in some embodiments, the SpyCas9 guide sequence comprises 16, 17, 18, 19, or 20 consecutive nucleotides of the guide sequences provided in Tables 3A-3B, or their reverse complementary sequences. In some embodiments, the guide sequences are complementary to each other. In some embodiments, the complementarity or identity between the guide sequence and its corresponding target sequence in the genome is at least 80%, 85%, preferably 90% or 95%, or 100%. For example, in some embodiments, the guide sequence comprises 20 consecutive nucleotides that are at least 80%, 85%, preferably 90% or 95%, or 100% identical or complementary to its corresponding target sequence. In other embodiments, the guide sequence and its corresponding target sequence may contain at least one mismatch, i.e., one non-identical or non-complementary nucleotide, depending on the reference sequence. For example, the double-stranded region formed between the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, wherein the total length of the target sequence is 16, 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target sequence may contain 1-4 mismatches, wherein the guide sequence contains at least 20 nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches, wherein the guide sequence contains 20 nucleotides. That is, the guide sequence and the target region may form a double-stranded region with 16, 17, 18, 19, 20, or more base pairs. In some embodiments, the double-stranded region may include 1, 2, 3, or 4 mismatches, such that the guide strand and the target sequence are not perfectly complementary. For example, the guide strand and the target sequence may be complementary within a 20-nucleotide region, including 2 mismatches, such that the guide sequence and the target sequence are 90% complementary, thereby providing a double-stranded region of 18 base pairs out of 20 base pairs. More tolerable mismatch locations are known in the art; for example, PAM distal mismatches are often more tolerable than PAM proximal matches. Mismatch tolerance at other locations is known in the art (see, for example, Sternberg et al., 2015, Nature:527:110-113).

[0225] As defined by the guide sequence of the guide RNA, the target sequence of the RNA-guided DNA binder can be present on either the positive or negative strand. The tables and other disclosures provided herein may list genomic coordinates or locations within the nucleotide sequence that serve as the target sequence. It should be understood that, as defined by the genomic coordinates or locations within the nucleotide sequence, the guide can be complementary to either the positive or negative strand of the DNA. The sequence complementary to the guide depends on the presence of the appropriate PAM of the RNA-guided DNA-binding protein on the opposite strand. Thus, in some embodiments, when the guide sequence binds to the inverse complementary sequence of the target sequence, i.e., the guide sequence is identical to certain nucleotides of the sense (positive) strand of the target sequence (when the PAM is present in the sense strand), but the T in the guide sequence is replaced by U.

[0226] As used herein, "RNA-guided DNA binder" means a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and dependent on the presence of PAM and the sequence of the guide RNA. Exemplary RNA-guided DNA binders include Cas lysins / nicking enzymes and their inactivated forms ("dCas DNA binders"). As used herein, "Cas nuclease" or "Cas9 protein" encompasses Cas lysins, Cas nicking enzymes, and dCas DNA binders. dCas DNA binders can be dead nucleases containing non-functional nuclease domains (RuvC or HNH domains). In some embodiments, Cas lysins or Cas nicking enzymes encompass dCas DNA binders modified to allow DNA cleavage (e.g., via fusion with a FokI domain). Cas lysins / nicking enzymes and dCas DNA binders include the Csm or Cmr complex of the type III CRISPR system, its Cas10, Csm1 or Cmr2 subunits, the cascade complex of the type I CRISPR system, its Cas3 subunit, and type II Cas nucleases.

[0227] As used herein, “class 2 Cas nucleases” are single-stranded polypeptides with RNA-guided DNA-binding activity. Class 2 Cas nucleases include class 2 Cas lyases / nicking enzymes (e.g., H840A or D10A variants of Spy Cas9, and D16A and H588A of Nme Cas9 (e.g., Nme2Cas9)) that further have RNA-guided DNA lyase or nicking enzyme activity; and class 2 dCas DNA binders in which the lyase / nicking enzyme activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and their modifications. The Cpf1 protein (Zetsche et al., Cell, 163: 1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. Zetsche's Cpf1 sequence is incorporated in its entirety by reference. See, for example, Zetsche, Tables S1 and S3. See, for example, Makarova et al., NatRev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0228] Several Cas9 orthologs have been obtained from Neisseria meningitidis (Esvelt et al., NAT. METHODS, Vol. 10, 2013, 1116-1121; Hou et al., PNAS, Vol. 110, 2013, pp. 15644-15649) (Nme1Cas9, Nme2Cas9, and Nme3Cas9). The Nme2Cas9 ortholog functions effectively in mammalian cells, recognizes N4CC PAM, and can be used for in vivo editing using homologous gRNAs (Ran et al., NATURE, Vol. 520, 2015, pp. 186-191; Kim et al., NAT. COMMUN., Vol. 8, 2017, p. 14500). Nme2Cas9 can be specific and selective, for example, capable of low-off-target editing (Lee et al., MOL. THER., Vol. 24, 2016, pp. 645–654; Kim et al., 2017). See also WO / 2020081568 (e.g., pp. 28 and 42), which describes the Nme2Cas9 D16A nickase, the contents of which are hereby incorporated in their entirety by reference. Throughout this text, “NmeCas9” or “NmeCas9” is generic and encompasses any type of NmeCas9, including Nme1Cas9, Nme2Cas9, and Nme3Cas9.

[0229] Exemplary nucleotide and polypeptide sequences of the Cas9 molecule are provided below. Methods for identifying alternative nucleotide sequences (including alternative naturally occurring variants) encoding the Cas9 polypeptide sequence are known in the art. Sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any of the Cas9 nucleic acid sequences or nucleic acid sequences encoding amino acid sequences provided herein are also covered. In some embodiments, the nucleotide sequence encoding the Cas9 amino acid sequence is not a naturally occurring Cas9 nucleotide sequence. Sequences having at least 95%, 96%, 97%, 98%, or 99% identity with any of the Cas9 amino acid sequences provided herein are also covered. In some embodiments, the Cas9 amino acid sequence is not a naturally occurring Cas9 sequence.

[0230] Table 10 provides exemplary open reading frames and amino acid sequences for Cas9 (SEQ ID NO: 802-810, 813, 814, 816-819, 832-834, 853-857) and uracil glycosidase inhibitors (SEQ ID NO: 823-826, 859, 860).

[0231] As used herein, the term "editor" refers to an agent containing a polypeptide capable of modifying a DNA sequence. In some embodiments, the editor is a lysin, such as Cas9 lysin. In some embodiments, the editor is capable of deaminating bases within a DNA molecule, and it may be referred to as a base editor. In some embodiments, the editor is capable of deaminating cytosine (C) in DNA. In some embodiments, the editor is a fusion protein containing an RNA-guided nicking enzyme fused to cytidine deaminase. In some embodiments, the editor is a fusion protein containing an RNA-guided nicking enzyme fused to APOBEC3A deaminase (A3A). In some embodiments, the editor contains a Cas9 nicking enzyme fused to APOBEC3A deaminase (A3A). In some embodiments, the editor is a fusion protein containing an RNA-guided nicking enzyme fused to both cytidine deaminase and UGI. In some embodiments, the editor lacks UGI. The exemplary editor used in this document can be described in WO2022125968, published on June 16, 2022, the contents of which are incorporated herein by reference. The exemplary editor may be a single polypeptide containing Homo sapiens ( ) linked via an XTEN linker to the Neisseria meningitidis-D16A Cas9 nickase. H. sapiens APOBEC3A. This document provides an mRNA encoding the above (e.g., SEQ ID NO: 801), or an exemplary editor may be a single polypeptide comprising a single polypeptide containing Homo sapiens APOBEC3A linked to the Streptococcus pyogenes-D10A Cas9 nickase via an XTEN linker. This document provides an mRNA encoding the above (e.g., SEQ ID NO: 811).

[0232] As used herein, “cytidine deaminase” refers to a polypeptide or polypeptide complex that possesses cytidine deaminase activity, catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically producing uridine or deoxyuridine. Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and particularly enzymes of the APOBEC family (enzymes of the APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (see, for example, Conticello et al., Mol. Biol. Evol. 22:367-77, (2005); Conticello, Genome Biol. 9:229, (2008); Muramatsu et al., J. Biol. Chem. 274: 18470-6, (1999); and Carrington et al., Cells9:1690 (2020)).

[0233] As used herein, the term "APOBEC3" refers to the APOBEC3 protein, such as the APOBEC3 protein expressed by any of the seven genes (A3A-A3H) at the human APOBEC3 locus. APOBEC3 can have catalytic DNA or RNA editing activity. The amino acid sequence of APOBEC3A has been described (UniPROT Accession ID: p31941) and is included herein as SEQ ID NO: 850. In some embodiments, the APOBEC3 protein is the human APOBEC3 protein or the wild-type protein. Variants include proteins having sequences that differ from the wild-type APOBEC3 protein due to one or more mutations (i.e., substitution, deletion, insertion), such as one or more single-point substitutions. For example, a shortened APOBEC3 sequence may be used, for instance, by deleting several N-terminal or C-terminal amino acids, preferably deleting one to four amino acids from the C-terminus of the sequence. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial mutants homologous to the APOBEC3 reference sequence. The variant is "functional" because it exhibits catalytic activity for DNA editing. In some embodiments, APOBEC3 (such as human APOBEC3A) has wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, APOBEC3 (such as human APOBEC3A) has asparagine at amino acid position 57 (as numbered in the wild-type sequence).

[0234] As used herein, a “nicking enzyme” is an enzyme that produces single-strand breaks (also called “nicks”) in double-stranded DNA (i.e., cuts one strand of the DNA double helix but not the other). As used herein, “RNA-guided DNA nicking enzyme” means a polypeptide or polypeptide complex having DNA nicking enzyme activity, wherein the DNA nicking enzyme activity is sequence-specific and depends on the RNA sequence. Exemplary RNA-guided DNA nicking enzymes include Cas nicking enzymes. Cas nicking enzymes include the Csm or Cmr complex of a type III CRISPR system, its Cas10, Csm1, or Cmr2 subunits, the cascade complex of a type I CRISPR system, its Cas3 subunit, and nicking enzyme forms of class 2 Cas nucleases. Class 2 Cas nicking enzymes include variants in which only one of the two catalytic domains is inactivated, said variants having RNA-guided DNA nicking enzyme activity. Class 2 Cas nickases include polypeptides in which the HNH or RuvC catalytic domain is inactivated, such as Cas9, for example Cas9 (e.g., H840A, D10A or N863A variants of SpyCas9 or D16A variant of NmeCas9). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domains or RuvC or RuvC-like domains of Neisseria meningitidis include Nme2Cas9 D16A (HNH nickase) and Nme2Cas9 H588A (RuvC nickase), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., variants N497A, R661A, Q695A, Q926A), HypaCas9 (e.g., variants N692A, M694A, Q695A, H698A), eSPCas9(1.0) (e.g., variants K810A, K1003A, R1060A), and eSPCas9(1.1) (e.g., variants K848A, K1003A, R1060A) proteins and their modifications. The Cpf1 protein (Zetsche et al., Cell, 163: 1-13 (2015)) is homologous to Cas9 and contains a RuvC-like protein domain. Zetsche's Cpf1 sequence is incorporated in its entirety by reference. See, for example, Zetsche, Tables S1 and S3. "Cas9" encompasses Streptococcus pyogenes (Spy) Cas9, the Cas9 variants listed herein, and their equivalents. See, for example, Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0235] As used herein, the term "fusion protein" refers to a hybrid polypeptide comprising polypeptides derived from at least two different proteins or sources. A polypeptide may be located at the N-terminal (N-terminal) portion or the C-terminal (C-terminal) portion of the fusion protein, thereby forming an "N-terminal fusion protein" or a "C-terminal fusion protein," respectively. Any protein presented herein can be produced by any method known in the art. For example, the proteins presented herein can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods for recombinant protein expression and purification are well known and include those described in Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0236] As used herein, the term "linker" refers to a chemical group or molecule that connects two adjacent molecules or portions. Typically, linkers are located between or on either side of two groups, molecules, or other portions and are linked to each other via covalent bonds. In some embodiments, the linker is one or more amino acids (e.g., peptides or proteins), such as the 16-amino acid residue "XTEN" linker or a variant thereof (see, for example, examples; and Schellenberger et al., A recombinant polypeptide extends the in vivo Half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequences SGSETPGTSESATPES (SEQ ID NO: 901), SGSETPGTSESA (SEQ ID NO: 902), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 903).

[0237] As used herein, the terms “uracil glycosidase inhibitor,” “uracil-DNA glycosidase inhibitor,” or “UGI” refer to proteins that inhibit the uracil-DNA glycosidase (UDG) base excision repair enzyme (e.g., UniPROT ID: P14739; SEQ ID NO: 859).

[0238] As used herein, an "open reading frame" or "ORF" of a gene refers to a sequence of codons that specify the amino acid sequence of the protein encoded by the gene. An ORF begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon (e.g., TAA, TAG, or TGA in DNA or UAA, UAG, or UGA in RNA).

[0239] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA along with an RNA-guided DNA binder, such as a Cas nuclease, for example a Cas lyase, a Cas nickase, or a dCas DNA binder (e.g., Cas9). In some embodiments, the guide RNA directs the RNA-guided DNA binder (such as Cas9) to a target sequence, and the guide RNA hybridizes to the target sequence and the binder binds to the target sequence; where the binder is a lyase or a nickase, cleavage or nicking can occur after binding.

[0240] As used herein, a first sequence is considered to "contain a sequence with at least X% identity to the second sequence" if an alignment of the first and second sequences shows that X% or more positions in the entire second sequence match the first sequence. For example, the sequence AAGA contains a sequence with 100% identity to the sequence AAG because the alignment would result in 100% identity due to matching all three positions in the second sequence. Differences between RNA and DNA (generally uridine exchanged for thymidine and vice versa) and the presence of nucleoside analogs (such as modified uridine) do not result in differences in identity or complementarity between polynucleotides, provided that the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., for all of thymidine, uridine, or modified uridine, it is adenosine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complement). Therefore, for example, the sequence 5'-AXG (where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered to have 100% identity with AUG because both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand which algorithm and parameter settings are suitable for a given sequence pair to be aligned; for sequences generally of similar length and expected identity (>50% for amino acids or >75% for nucleotides), the Needleman-Wunsch algorithm with its preset settings provided by EBI on the www.ebi.ac.uk web server is generally appropriate.

[0241] In this document, “mRNA” refers to a polynucleotide that contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation into ribosomes and aminoacylated tRNA). mRNA may contain a phosphate-sugar backbone comprising ribose residues or analogues thereof, such as 2'-methoxyribose residues. In some embodiments, the sugars in the mRNA phosphate-sugar backbone are substantially composed of ribose residues, 2'-methoxyribose residues, or combinations thereof.

[0242] As used herein, “insertion / deletion” refers to an insertion or deletion mutation consisting of multiple nucleotides that are inserted, deleted, or inserted and deleted in a target nucleic acid, such as at a double-strand break (DSB) site. As used herein, when an insertion / deletion results in an insertion, the insertion is a random insertion at a DSB site and is generally not guided by or based on a template sequence.

[0243] As used herein, “reduced or eliminated” expression of a protein on a cell refers to a partial or complete loss of protein expression relative to unmodified cells. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry, and “reduced” or “eliminated” surface expression relative to unmodified cells is demonstrated by a reduction in fluorescence signal after staining with the same antibody targeting the protein. Cells that show “reduced” or “eliminated” surface expression of a protein relative to unmodified cells by flow cytometry can be described as having “negative” expression for that protein, as demonstrated by a fluorescence signal similar to that of cells stained with an isotype control antibody. The “reduction” or “elimination” of protein expression can be measured using other techniques known in the art, utilizing appropriate controls known to those skilled in the art.

[0244] As used herein, “knockdown” refers to, for example, a reduction in the expression of a specific gene product (e.g., protein, mRNA, or both) compared to the expression of an unedited target sequence. Protein knockdown can be measured by detecting the total cellular amount of protein from a sample (such as a tissue, fluid, or cell population of interest). Protein knockdown can also be measured by measuring protein substitutes, markers, or activities. Methods for measuring mRNA knockdown are known and involve analyzing mRNA isolated from the sample of interest. In some embodiments, “knockdown” can refer to some loss of expression of a specific gene product, such as a reduction in the amount of transcribed mRNA or a reduction in the amount of protein expressed by cells or cell populations (including in vivo populations, such as those found in tissues).

[0245] As used in this article, "knockout" or "KO" refers to the loss of expression of a specific gene or protein in a cell. Knockout can cause expression to drop below the detectable level. Knockout can be measured by detecting the total amount of protein in a cell, tissue, or cell population.

[0246] As used herein, "target sequence" or "genomic target sequence" refers to a nucleic acid sequence in a target gene that is complementary to the guide sequence of the gRNA. The interaction between the target sequence and the guide sequence directs the binding of an RNA-guided DNA binder within the target sequence and potentially causes cleavage or splitting (depending on the activity of the binder).

[0247] As used herein, the term “subject” is intended to include living organisms that can elicit an immune response, including, for example, mammals, primates, and humans.

[0248] As used herein, “treatment” means any administration or application of a therapeutic agent to a subject’s disease or condition, and includes suppressing the disease, halting the progression of the disease, alleviating one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease (including recurrence of symptoms).

[0249] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention has been described in conjunction with the illustrated embodiments, it will be understood that it is not intended to limit the invention to those embodiments. Rather, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the invention as defined in the appended claims and the included embodiments.

[0250] Before describing this doctrine in detail, it should be understood that this disclosure is not limited to specific compositions or process steps, as they can vary. It should be noted that, unless the context clearly indicates otherwise, the singular forms “a / an” and “described” as used in this specification and the appended claims include plural references. Thus, for example, reference to “a conjugate” includes multiple conjugates, and reference to “a cell” includes multiple cells (e.g., a cell population), etc.

[0251] Numerical ranges include the numerical values ​​that define the range. Taking into account significant figures and measurement-related errors, measured and measurable values ​​should be understood as approximate values.

[0252] Furthermore, the use of "comprise / comprises / comprising," "contain / contains / containing," and "include / includes / including" is not intended to be limiting. It should be understood that the foregoing general and detailed descriptions are merely exemplary and illustrative, and not doctrinal limitations. Unless specifically indicated in the specification, embodiments described as "comprise" various components are also contemplated as consisting of "by" or "substantially by" the components described; embodiments described as consisting of various components are also contemplated as "containing" or "substantially by" the components described; and embodiments described as "substantially by" various components are also contemplated as "by" or "containing" the components described (this interchangeability does not apply to the use of these terms in the claims).

[0253] Unless the context clearly indicates otherwise, the term "or" is used in the inclusive sense, that is, equivalent to "and / or".

[0254] When used before a list, the term "about" modifies each member of the list. The term "about" should be understood to cover variations or errors permissible in the art, such as a deviation of 2 standard deviations from the average or sensitivity of the method used to make the measurement. When "about" appears before the first value in a series, it can be understood to modify each value in said series.

[0255] The range should be understood to include the numerical value at the end of the range and all logical values ​​in between. For example, 5-10 nucleotides should be understood as 5, 6, 7, 8, 9, or 10 nucleotides, while 5-10% should be understood as containing 5% and all possible values ​​up to 10%.

[0256] It will be clearly understood that, even without a specific upper limit, at least 17 nucleotides in a 20-nucleotide sequence should be understood to include 17, 18, 19, or 20 nucleotides of the provided sequence, thus providing an upper limit. Similarly, even without a specific lower limit, at most 3 nucleotides will be understood to cover 0, 1, 2, or 3 nucleotides, thus providing a lower limit. When “at least,” “at most,” or other similar language modifies a numerical value, it can be understood to modify each value in the series.

[0257] As used herein, “not greater than” or “less than” should be understood as a value adjacent to a phrase and a logically low value or integer, logically to zero in context. For example, the double-stranded region of “not greater than 2 nucleotide base pairs” has 2, 1, or 0 nucleotide base pairs. When “not greater than” or “less than” appears before a series of values ​​or ranges, it should be understood as modifying each value in the series or range.

[0258] As used in this article, the range includes both the upper and lower limits.

[0259] If there is a conflict between the sequence in this application and the specified accession number or position in the accession number, the sequence in this application shall prevail.

[0260] As used herein, it should be understood that when the maximum value is expressed as 100% (e.g., 100% inhibition or 100% encapsulation), the value is limited by the detection method. For example, 100% inhibition should be understood as inhibition to a level below the detection level to be determined, and 100% encapsulation should be understood as the encapsulated material not being detectable outside the vesicle.

[0261] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter in any way. In the event of any material incorporated by reference that contradicts any terminology defined in this specification or any other express content herein, this specification shall prevail. While this doctrine has been described in conjunction with various embodiments, it is not intended to limit this doctrine to such embodiments. Rather, as those skilled in the art will understand, this doctrine encompasses various alternatives, modifications, and equivalents.

[0262] Genetically modified cells 1. Engineered cell composition This disclosure provides engineered cell compositions having reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and containing gene modifications in the CD70 gene.

[0263] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and comprising a gene modification in the CD70 gene, wherein the gene modification is located within genomic coordinates chr19:586028-6591018. In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and comprising a gene modification in the CD70 gene, wherein the gene modification comprises at least one nucleotide within genomic coordinates chr19:6586002-6591015. In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and comprising a gene modification in the CD70 gene, wherein the gene modification is located within genomic coordinates chr19:586028-6591018.

[0264] In some implementations, for each given range of genomic coordinates, the range may cover + / - 10 nucleotides at both ends of the specified coordinates. For example, if chr19:6590121-6590145 is given, in some implementations, the genomic target sequence or gene modification may be located within chr19:6590121-6590145. In some implementations, for each given range of genomic coordinates, the range may cover + / - 5 nucleotides at either end of the range.

[0265] In some implementations, a given range of genomic coordinates may include target sequences on both strands of DNA (i.e., the positive (+) strand and the negative (+) strand).

[0266] Genetic modifications in the CD70 gene are further described herein. In some embodiments, genetic modifications in the CD70 gene include any one or more of the insertion, deletion, substitution, or deamination of at least one nucleotide in the target sequence.

[0267] The engineered cells described in this article can contain gene modifications in any CD70 allele of the CD70 gene. The CD70 gene is located on chromosome 19.

[0268] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and containing genetic modifications in the CD70 gene, wherein the genetic modifications include insertions / deletions, C-to-T substitutions, or A-to-G substitutions within any of the genomic coordinates listed in Tables 2A and 3A.

[0269] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and containing genetic modifications in the CD70 gene, wherein the genetic modifications comprise insertions / deletions, C-to-T substitutions, or A-to-G substitutions within any of the genomic coordinates listed in Tables 2A and 3A, wherein the genetic modifications comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinates.

[0270] In some embodiments, the gene modification comprises at least 5 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 1 consecutive nucleotide within the genomic coordinate system. In some embodiments, the gene modification comprises at least 2 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 3 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 4 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 5 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 6 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 7 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 8 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 9 consecutive nucleotides within the genomic coordinate system. In some embodiments, the gene modification comprises at least 10 consecutive nucleotides within the genomic coordinate system.

[0271] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and containing genetic modifications in the CD70 gene, wherein the genetic modifications include insertions / deletions, C-to-T substitutions, or A-to-G substitutions within any of the genomic coordinates listed in Tables 2A and 3A, wherein the genetic modifications include at least one C-to-T substitution or at least one A-to-G substitution within the genomic coordinates.

[0272] In some embodiments, an engineered cell is provided in which CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 consecutive nucleotides within any of the genomic coordinates listed in Tables 2A and 3A. In some embodiments, the CD70 genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binder, such as Streptococcus pyogenes Cas9, Neisseria meningitidis Cas9, or a base editor comprising a Streptococcus pyogenes or Neisseria meningitidis Cas9 nickase.

[0273] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and includes a gene modification in the CD70 gene, wherein the gene modification is located within the following genomic coordinates: chr19:6590121-6590145; chr19:6586002-6586026; chr19:6586003-6586027; chr19:6586013-6586037; chr19:6586357-6586381; chr19:6586365-6586389; chr19: 6586376-6586400;chr19:6590988-6591012;chr19:6590991-6591015;chr19:6590862-6590886;chr19:6586396-6586420;chr19:658637 2-6586396;chr19:6586371-6586395;chr19:6586360-6586384;chr19:6586355-6586379;chr19:6586268-6586292;chr19:6586259-65862 83;chr19:6586256-6586280;chr19:6586142-6586166;chr19:6586141-6586165;chr19:6586135-6586159;chr19:6586128-6586152;chr 19:6586127-6586151;chr19:6586126-6586150;chr19:6586121-6586145;chr19:6586120-6586144;chr19:6586096-6586120;chr19:6586 055-6586079;chr19:6586029-6586053;chr19:6586023-6586047;chr19:6586312-6586336;chr19:6586151-6586175;chr19:6586145-65 86169; chr19:6586100-6586124; chr19:6586030-6586054; chr19:6586028-6586052; chr19:6586395-6586419; and chr19:6586394-6586418.In some embodiments, an engineered cell is provided in which CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least five consecutive nucleotides selected from the following genomic coordinates: chr19:6590121-6590145; chr19:6586002-6586026; chr19:6586003-6586027; chr19:6586013-6586037; chr19:6586357-6586381; chr19:6586365-6586389; chr19:6586376. -6586400;chr19:6590988-6591012;chr19:6590991-6591015;chr19:6590862-6590886;chr19:6586396-6586420;chr19:6586372-6586 396;chr19:6586371-6586395;chr19:6586360-6586384;chr19:6586355-6586379;chr19:6586268-6586292;chr19:6586259-6586283;ch r19:6586256-6586280; chr19:6586142-6586166; chr19:6586141-6586165; chr19:6586135-6586159; chr19:6586128-6586152; chr19:6 586127-6586151;chr19:6586126-6586150;chr19:6586121-6586145;chr19:6586120-6586144;chr19:6586096-6586120;chr19:658605 5-6586079;chr19:6586029-6586053;chr19:6586023-6586047;chr19:6586312-6586336;chr19:6586151-6586175;chr19:6586145-658 6169; chr19:6586100-6586124; chr19:6586030-6586054; chr19:6586028-6586052; chr19:6586395-6586419; and chr19:6586394-6586418. In some implementations, the gene modification is within the genomic coordinates selected from the following: chr19:6590121-6590145 and chr19:6586268-6586292.In some embodiments, the CD70 genomic target sequence comprises at least 10 consecutive nucleotides within genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 consecutive nucleotides within genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binder, such as... Nme Cas9.

[0274] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and includes a genetic modification of the CD70 gene, wherein the genetic modification is located within the following genomic coordinates: chr19:6590998-6591018; chr19:6590995-6591015; chr19:6590992-6591012; chr19:6590991-6591011; chr19:6590987-6591007; chr19:6590986-6591006; chr19:659098 5-6591005;chr19:6590977-6590997;chr19:6590972-6590992;chr19:6590966-6590986;chr19:6590958-6590978;chr19:6590957-6590977 ;chr19:6590945-6590965;chr19:6590944-6590964;chr19:6590940-6590960;chr19:6590939-6590959;chr19:6590935-6590955;chr19:65 90926-6590946;chr19:6590920-6590940;chr19:6590919-6590939;chr19:6590914-6590934;chr19:6590908-6590928;chr19:6590907-659 0927;chr19:6590899-6590919;chr19:6590875-6590895;chr19:6590866-6590886;chr19:6590844-6590864;chr19:6590843-6590863;chr1 9:6586374-6586394; chr19:6586368-6586388; chr19:6586288-6586308; chr19:6586285-6586305; chr19:6586276-6586296; chr19:6586267 -6586287; chr19:6586199-6586219; chr19:6586172-6586192; chr19:6586138-6586158; chr19:6586099-6586119; and chr19:6586050-6586070.In some embodiments, an engineered cell is provided in which CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least five consecutive nucleotides selected from the following genomic coordinates: chr19:6590998-6591018; chr19:6590995-6591015; chr19:6590992-6591012; chr19:6590991-6591011; chr19:6590987-6591007; chr19:6590986-6591006; chr19:6590985-65910 05;chr19:6590977-6590997;chr19:6590972-6590992;chr19:6590966-6590986;chr19:6590958-6590978;chr19:6590957-6590977;chr19 :6590945-6590965;chr19:6590944-6590964;chr19:6590940-6590960;chr19:6590939-6590959;chr19:6590935-6590955;chr19:6590926 -6590946;chr19:6590920-6590940;chr19:6590919-6590939;chr19:6590914-6590934;chr19:6590908-6590928;chr19:6590907-6590927 ;chr19:6590899-6590919;chr19:6590875-6590895;chr19:6590866-6590886;chr19:6590844-6590864;chr19:6590843-6590863;chr19:6 586374-6586394;chr19:6586368-6586388;chr19:6586288-6586308;chr19:6586285-6586305;chr19:6586276-6586296;chr19:6586267-6 586287; chr19:6586199-6586219; chr19:6586172-6586192; chr19:6586138-6586158; chr19:6586099-6586119; and chr19:6586050-6586070.In some embodiments, the gene modification is performed within the following genomic coordinates: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927. In some embodiments, the CD70 genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binder, such as Streptococcus pyogenes Cas9.

[0275] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, and includes a gene modification in the CD70 gene, wherein the gene modification is located within the following genomic coordinates: chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863; chr19:6590835-6590855; chr19:6590104-6590124; chr19:6590096-6590116; chr19: 6590095-6590115;chr19:6590094-6590114;chr19:6590093-6590113;chr19:6590087-6590107;chr19:6590084-6590104;chr19:659008 3-6590103;chr19:6590078-6590098;chr19:6586368-6586388;chr19:6586299-6586319;chr19:6586267-6586287;chr19:6590842-65908 62;chr19:6590139-6590159;chr19:6590138-6590158;chr19:6590135-6590155;chr19:6590079-6590099;chr19:6590077-6590097;chr 19:6586412-6586432;chr19:6586404-6586424;chr19:6586403-6586423;chr19:6586396-6586416;chr19:6586396-6586416;chr19:6586 395-6586415;chr19:6586388-6586408;chr19:6586380-6586400;chr19:6586379-6586399;chr19:6586375-6586395;chr19:6586369-65 86389; chr19:6586367-6586387; chr19:6586360-6586380; chr19:6586359-6586379; chr19:6586120-6586140; and chr19:6586028-6586048.In some embodiments, an engineered cell is provided in which CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least five consecutive nucleotides selected from the following genomic coordinates: chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863; chr19:6590835-6590855; chr19:6590104-6590124; chr19:6590096-6590116; chr19:6590095 -6590115;chr19:6590094-6590114;chr19:6590093-6590113;chr19:6590087-6590107;chr19:6590084-6590104;chr19:6590083-6590 103;chr19:6590078-6590098;chr19:6586368-6586388;chr19:6586299-6586319;chr19:6586267-6586287;chr19:6590842-6590862;ch r19:6590139-6590159; chr19:6590138-6590158; chr19:6590135-6590155; chr19:6590079-6590099; chr19:6590077-6590097; chr19:6 586412-6586432;chr19:6586404-6586424;chr19:6586403-6586423;chr19:6586396-6586416;chr19:6586396-6586416;chr19:658639 5-6586415;chr19:6586388-6586408;chr19:6586380-6586400;chr19:6586379-6586399;chr19:6586375-6586395;chr19:6586369-658 6389; chr19:6586367-6586387; chr19:6586360-6586380; chr19:6586359-6586379; chr19:6586120-6586140; and chr19:6586028-6586048.In some embodiments, the gene modification is performed within the following genomic coordinates: chr19:6590875-6590895; chr19:6586396-6586416; chr19:6586388-6586408; chr19:6586379-6586399; chr19:6586369-6586389; and chr19:6586120-6586140. In some embodiments, the CD70 genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binder, such as a base editor comprising cytidine deaminase and Streptococcus pyogenes Cas9 nickase.

[0276] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and comprising a genetic modification of the CD70 gene, wherein the genetic modification is located within the following genomic coordinates: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927. In some embodiments, an engineered cell is provided in which CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least five consecutive nucleotides selected from the following genomic coordinates: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927.

[0277] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and comprising a gene modification in the CD70 gene, wherein the gene modification is located within the following genomic coordinates: chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863; chr19:6586368-6586388; and chr19:6586267-658628. In some embodiments, an engineered cell is provided in which CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least five consecutive nucleotides selected from the following genomic coordinates: chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863; chr19:6586368-6586388; and chr19:6586267-658628.

[0278] In some embodiments, the CD70 genomic target sequence comprises at least 10 consecutive nucleotides within genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 consecutive nucleotides within genomic coordinates.

[0279] In some implementations, the CD70 genomic target sequence contains at least 20, 21, 22, 23, or 24 consecutive nucleotides within genomic coordinates.

[0280] In some implementations, the CD70 genomic target sequence contains at least 17, 18, 19, or 20 consecutive nucleotides within genomic coordinates.

[0281] In some embodiments, the gene editing system includes a transcription activator-like effector nuclease (TALEN). In some embodiments, the gene editing system includes a zinc finger nuclease. In some embodiments, the gene editing system includes a CRISPR / Cas system, such as a class 2 system. In some embodiments, the gene editing system includes an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0282] Exemplary RNA-guided DNA binders are shown in Table 1 below.

[0283] Table 1. Exemplary RNA-guided DNA binders.

[0284] *Exemplary base editors based on deaminase-SpyCas9 nicking enzyme or deaminase-NmeCas9 nicking enzyme. It is evident that the specificity of the base editor (including PAM) will vary depending on its nicking enzyme.

[0285] In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder comprises the Cas9 protein. In some embodiments, the RNA-guided DNA binder is selected from one of the following: Streptococcus pyogenes Cas9, Neisseria meningitidis Cas9 (e.g., Nme2Cas9), Streptococcus thermophilus Cas9, Staphylococcus aureus Cas9, Neoculcium fragilis Cpf1, Aminococcus spp. Cpf1, Trichophyton spp. Cpf1, C-to-T base editor, A-to-G base editor, Cas12a, Mad7 nuclease, ARCUS nuclease, and CasX. In some implementations, the RNA-guided DNA binder comprises a polypeptide selected from the following: Streptococcus pyogenes Cas9, Neisseria meningitidis Cas9 (e.g., Nme2Cas9), Streptococcus thermophilus Cas9, Staphylococcus aureus Cas9, Francisella neonicotinoides Cpf1, Aminococcus spp. Cpf1, Trichophyton spp. Cpf1, C-to-T base editor, A-to-G base editor, Cas12a, and CasX.

[0286] In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is *Streptococcus pyogenes* Cas9. In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is *Neisseria meningitidis* Cas9, such as Nme2Cas9.

[0287] In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is *Streptococcus thermophilus* Cas9. In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is *Staphylococcus aureus* Cas9. In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is derived from *Francisella catarrhalis* (a novel culprit). F. novicidaThe RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is Cpf1 from the genus *C.* In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is Cpf1 from *C.* ND2006 of *C.* In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is Cas12a. In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is CasX.

[0288] In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is a C-to-T base editor. In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is an A-to-G base editor. In some embodiments, the base editor comprises a deaminase and an RNA-guided nicking enzyme. In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder comprises APOBEC3A deaminase (A3A) and an RNA-guided nicking enzyme. In some embodiments, the RNA-guided nicking enzyme is a SpyCas9 nicking enzyme. In some embodiments, the RNA-guided nicking enzyme comprises an NmeCas9 nicking enzyme.

[0289] In any of the above embodiments, the genome editing system comprises an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder comprises Cas9. In some embodiments, the RNA-guided DNA binder is *Streptococcus pyogenes* Cas9. In some embodiments, the RNA-guided DNA binder is a base editor. In some embodiments, the base editor comprises a C-to-T deaminase and an RNA-guided nicking enzyme, such as *Streptococcus pyogenes* Cas9 nicking enzyme. In some embodiments, the base editor comprises an A-to-G deaminase and an RNA-guided nicking enzyme, such as *Streptococcus pyogenes* Cas9 nicking enzyme.

[0290] In any of the above embodiments, the gene editing system comprises an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder comprises Cas9. In some embodiments, the RNA-guided DNA binder is Neisseria meningitidis or Nme2 Cas9. In some embodiments, the RNA-guided DNA binder is a base editor. In some embodiments, the base editor comprises a C-to-T deaminase and an RNA-guided nicking enzyme, such as Neisseria meningitidis or Nme2 Cas9 nicking enzyme. In some embodiments, the base editor comprises an A-to-G deaminase and an RNA-guided nicking enzyme, such as Neisseria meningitidis or Nme2 Cas9 nicking enzyme.

[0291] In some embodiments, the gene editing system further comprises a uracil glycosidase inhibitor (UGI), and the UGI and base editor are contained in a single polypeptide. In some embodiments, the gene editing system comprises a UGI, and the UGI and base editor are contained in different polypeptides. In some embodiments, the base editor comprises cytidine deaminase and an RNA-guided nickase. In some embodiments, cytidine deaminase, RNA-guided nickase, and UGI are contained in a single polypeptide. In some embodiments, cytidine deaminase, RNA-guided nickase, and UGI are contained in different polypeptides. In some embodiments, cytidine deaminase and RNA-guided nickase are contained in a single polypeptide, and wherein the UGI is contained in different polypeptides.

[0292] Engineered cells can be any of the exemplary cell types disclosed herein.

[0293] In some embodiments, this disclosure provides a pharmaceutical composition comprising any of the engineered cells disclosed herein. In some embodiments, the pharmaceutical composition comprises a population of any of the engineered cells disclosed herein. In some embodiments, as measured by flow cytometry, at least 40%, 45%, 50%, 55%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cell population is CD70 negative. In some embodiments, as measured by next-generation sequencing (NGS), at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cell population contains a genetic modification of the CD70 gene.

[0294] Methods and compositions for reducing or eliminating CD70 surface expression This disclosure provides methods and compositions for reducing or eliminating the surface expression of the CD70 protein relative to unmodified cells by genetically modifying the CD70 gene. The resulting genetically modified cells may also be referred to herein as engineered cells. In some embodiments, the genetically modified (or engineered) cells may be starting cells for further genetic modification using the methods or compositions provided herein. In some embodiments, the cells are allogeneic cells. In some embodiments, cells with reduced or eliminated surface expression of the CD70 protein can be used for immunotherapy. In some embodiments, cells with reduced or eliminated surface expression of the CD70 protein can be used for adoptive cell transfer therapy. In some embodiments, editing of the CD70 gene is combined with additional genetic modifications to produce cells suitable for allogeneic transplantation purposes.

[0295] In some embodiments, the method includes reducing the surface expression of the CD70 protein in cells relative to unmodified cells, comprising contacting the cells with a composition comprising: (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NO: 1-38; or (ii) at least 19, 20, 21, 22, 23, preferably 24 or 25 consecutive nucleotides of a sequence selected from SEQ ID NO: 1-38; or (iii) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from SEQ ID NO: 1-38; or (iv) a guide sequence that binds to a target site comprising a genomic region listed in Table 2A; or (v) a guide sequence complementary to at least 19, 20, 21, 22, 23, preferably 24 or 25 consecutive nucleotides of a genomic region listed in Table 2A; or (vi) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from (v); and optionally (b) RNA-guided DNA binders or nucleic acids encoding RNA-guided DNA binders.

[0296] In some embodiments, the method includes reducing the surface expression of the CD70 protein in cells relative to unmodified cells, comprising contacting the cells with a composition comprising: (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NO: 101-169; or (ii) at least 17, 18, 19, or 20 consecutive nucleotides selected from SEQ ID NO: 101-169; or (iii) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from SEQ ID NO: 101-169; or (iv) a guide sequence binding to a target site comprising a genomic region listed in Table 3A; or (v) a guide sequence complementary to at least 17, 18, 19, or 20 consecutive nucleotides of a genomic region listed in Table 3A; or (vi) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from (v); and optionally (b) an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0297] In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder comprises the Cas9 protein.

[0298] In some embodiments, the RNA-guided DNA binder is Neisseria meningitidis Cas9, such as Nme2Cas9. In some embodiments, the guide RNA is Nme Cas9 guide RNA. In some embodiments, the RNA-guided DNA binder is Streptococcus pyogenes Cas9. In some embodiments, the guide RNA is Streptococcus pyogenes Cas9 guide RNA.

[0299] In some implementations, the RNA-guided DNA binder contains a deaminase domain.

[0300] In some embodiments, the RNA-guided DNA binder is a C-to-T base editor. In some embodiments, the RNA-guided DNA binder is an A-to-G base editor. In some embodiments, the base editor comprises a deaminase and an RNA-guided nicking enzyme. In some embodiments, the RNA-guided DNA binder comprises APOBEC3A deaminase (A3A) and an RNA-guided nicking enzyme. In some embodiments, the RNA-guided nicking enzyme is a SpyCas9 nicking enzyme. In some embodiments, the RNA-guided nicking enzyme comprises an NmeCas9 nicking enzyme.

[0301] In some implementations, the surface expression of the CD70 protein (i.e., engineered cells) is thereby reduced or eliminated.

[0302] In some embodiments, the method includes manufacturing engineered human cells having reduced or eliminated surface expression of CD70 protein relative to unmodified cells, comprising contacting the cells with a composition comprising: (a) a guide RNA, the guide RNA comprising (i) a guide sequence selected from SEQ ID NO: 1-38; or (ii) at least 19, 20, 21, 22, 23, preferably 24 or 25 consecutive nucleotides selected from sequences selected from SEQ ID NO: 1-38; or (iii) a sequence selected from SEQ ID NO: 1-38. The sequence 1-38 has at least 95%, 90%, or 85% identity with the guide sequence; or (iv) a guide sequence binding to a target site comprising a genomic region listed in Table 2A; or (v) a guide sequence complementary to at least 19, 20, 21, 22, 23, preferably 24, or 25 consecutive nucleotides of a genomic region listed in Table 2A; or (vi) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from (v); and optionally (b) an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder. In some embodiments, the method further includes contacting the cell with the RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder is Cas9. In some embodiments, the RNA-guided DNA binder is NmeCas9. In some embodiments, the guide RNA is... Nme Guide RNA. In some embodiments, the RNA-guided DNA binder comprises a deaminase domain. In some embodiments, the RNA-guided DNA binder comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0303] In some embodiments, the method includes manufacturing engineered human cells having reduced or eliminated surface expression of the CD70 protein relative to unmodified cells, comprising contacting the cells with a composition comprising: (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NO: 101-169; or (ii) at least 17, 18, 19, or 20 consecutive nucleotides selected from SEQ ID NO: 101-169; or (iii) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from SEQ ID NO: 101-169; or (iv) a guide sequence binding to a target site comprising a genomic region listed in Table 3A; or (v) a guide sequence complementary to at least 17, 18, 19, or 20 consecutive nucleotides of a genomic region listed in Table 3A; or (vi) a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from (v); and optionally (b) an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder is SpyCas9. In some embodiments, the guide RNA is... Spy Guide RNA. In some embodiments, the RNA-guided DNA binder comprises a deaminase domain. In some embodiments, the RNA-guided DNA binder comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0304] In some embodiments, the composition further comprises a uracil glycosidase inhibitor (UGI). In some embodiments, the composition comprises an RNA-guided DNA binder that converts cytosine (C) of a CD70 genomic target sequence to thymine (T). In some embodiments, the composition comprises an RNA-guided DNA binder that converts adenosine (A) of a CD70 genomic target sequence to guanine (G).

[0305] In some implementations, the surface expression of the CD70 protein (i.e., engineered cells) is thereby reduced or eliminated.

[0306] In some embodiments, an engineered cell is provided, said engineered cell being produced by the methods described herein. In some embodiments, the compositions disclosed herein further comprise a pharmaceutically acceptable carrier. In some embodiments, a cell is provided, said cell being produced by a composition disclosed herein comprising a pharmaceutically acceptable carrier. In some embodiments, a composition comprising the cells disclosed herein is provided.

[0307] 2. CD70 guide RNA The methods and compositions provided herein disclose guide RNAs that can be used to reduce or eliminate surface expression of the CD70 protein. In some embodiments, such guide RNAs direct an RNA-guided DNA binder to a CD70 genomic target sequence and may be referred to herein as "CD70 guide RNAs". In some embodiments, CD70 guide RNAs direct an RNA-guided DNA binder to a human CD70 genomic target sequence. In some embodiments, CD70 guide RNAs comprise guide sequences selected from SEQ ID NO: 1-38 and 101-169. In some embodiments, CD70 guide RNAs comprise guide sequences selected from SEQ ID NO: 1-38.

[0308] In some embodiments, a composition is provided comprising the guide RNA and RNA-guided DNA binder described herein, or a nucleic acid encoding an RNA-guided DNA binder.

[0309] In some embodiments, a composition is provided comprising a single-guide RNA (sgRNA) comprising a guide sequence selected from SEQ ID NO: 1-38 and 101-169. In some embodiments, a composition is provided comprising the CD70 sgRNA described herein and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0310] In some embodiments, a composition is provided comprising a CD70 dual guide RNA (dgRNA) comprising a guide sequence selected from SEQ ID NO: 1-38 and 101-169. In some embodiments, a composition is provided comprising the CD70 dgRNA described herein and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0311] In some embodiments, the CD70 gRNA includes a guide sequence selected from any of SEQ ID NO: 1-38 and 101-169. Exemplary CD70 target sequences and guide sequences are shown in Table 2A (SEQ ID NO: 1-38) and Table 3A (SEQ ID NO: 101-169) below. The guide sequences disclosed in these tables may be unmodified, modified with the exemplary modification patterns shown in the tables, or modified with different modification patterns disclosed herein or available in the art.

[0312] Table 2A. Exemplary CD70 Nme guide RNA genomic coordinates and guide sequence

[0313] Table 2B. Exemplary complete and modified Nme guide RNAs

[0314] Table 3A. Exemplary CD70 Spy guide RNA target coordinates and guide sequences

[0315] Table 3B. Exemplary complete and modified Spy guide RNAs

[0316] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any of SEQ ID NO: 1-38 and 101-169.

[0317] In some embodiments, the CD70 guide RNA comprises SEQ ID NO: 1. In some embodiments, the CD70 guide RNA comprises the sequence of any of the guide RNA sequences shown in Table 2B.

[0318] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any of SEQ ID NO: 1-38. In some embodiments, the CD70 guide RNA comprises a guide sequence of at least 20, 21, 22, 23, 24, or 25 consecutive nucleotides of a sequence selected from SEQ ID NO: 1-38. In some embodiments, the CD70 guide RNA comprises a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from SEQ ID NO: 1-38. In some embodiments, the CD70 guide RNA comprises a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from SEQ ID NO: 1-38.

[0319] In some implementations, the gene modification is within genomic coordinates targeted by a guide RNA, which contains a guide sequence of SEQ ID NO: 1 or 16.

[0320] In some embodiments, the CD70 guide RNA comprises a guide sequence comprising at least 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2A. As used herein, at least 10 consecutive nucleotides ± 10 nucleotides of genomic coordinates means, for example, at least 10 consecutive nucleotides within genomic coordinates, wherein genomic coordinates include 10 nucleotides in the 5' direction and 10 nucleotides in the 3' direction within the range listed in Table 2A. In some embodiments, the CD70 guide RNA comprises a guide sequence of at least 20, 21, 22, 23, 24, or 25 consecutive nucleotides of a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2A. In some embodiments, the CD70 guide RNA comprises a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from sequences comprising 20, 21, 22, 23, 24, or 25 consecutive nucleotides of a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2A. In some implementations, the CD70 guide RNA comprises a guide sequence comprising at least 20 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2A.

[0321] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any of SEQ ID NO: 101-139. In some embodiments, the CD70 gRNA comprises a guide sequence selected from any of SEQ ID NO: 125, 127, 128, 134, and 140-169. In some embodiments, the CD70 guide RNA comprises a guide sequence of at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NO: 101-169. In some embodiments, the CD70 guide RNA comprises a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from SEQ ID NO: 101-169. In some embodiments, the CD70 guide RNA comprises a guide sequence having at least 95% identity with a sequence selected from SEQ ID NO: 101-169. In some embodiments, the guide RNA comprises a sequence of any of the guide RNA sequences shown in Table 3B.

[0322] In some embodiments, the guide RNA comprises a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116, and 123. In some embodiments, the guide RNA comprises a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164, and 168.

[0323] In some embodiments, the CD70 guide RNA comprises a guide sequence comprising at least 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 3A. As used herein, at least 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates means, for example, at least 10 consecutive nucleotides within genomic coordinates, wherein the genomic coordinates include 10 nucleotides in the 5' direction and 10 nucleotides in the 3' direction within the range listed in Table 3A. For example, a CD70 guide RNA may comprise 10 consecutive nucleotides within the following genomic coordinates: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927, including the boundary nucleotides of these ranges. In some embodiments, the CD70 guide RNA comprises a guide sequence of at least 17, 18, 19, or 20 consecutive nucleotides of a sequence comprising 10 consecutive nucleotides ± 10 nucleotides within the genomic coordinates listed in Table 3A. In some embodiments, the CD70 guide RNA comprises a guide sequence having at least 95%, 90%, or 85% identity with a sequence selected from the following sequences: sequences of 17, 18, 19, or 20 consecutive nucleotides containing 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 3A.

[0324] In some embodiments, the guide RNA in Table 3A includes a guide sequence comprising at least 15 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 3A. In some embodiments, the CD70 guide RNA includes a guide sequence comprising at least 20 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 3A.

[0325] This document provides additional implementations of CD70 guide RNA, including, for example, exemplary modifications to the guide RNA.

[0326] 3. Gene modification of CD70 In some embodiments, the methods and compositions disclosed herein genetically modify at least one nucleotide in the CD70 gene in a cell. Genetic modification encompasses modified populations generated through contact with a gene editing system (e.g., edited populations generated by Cas9 and CD70 guide RNA, or edited populations generated by a base editor and CD70 guide RNA).

[0327] In some embodiments, the gene modification is located within the genomic coordinates chr19:586028-6591018. In some embodiments, the gene modification comprises at least one nucleotide within the genomic coordinates chr19:586028-6591018.

[0328] In some embodiments, the gene modification is within any of the genomic coordinates listed in Tables 2A and 3A. In some embodiments, the gene modification comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides within any of the genomic coordinates listed in Tables 2A and 3A.

[0329] In some embodiments, the gene modification comprises at least one nucleotide selected from the following genomic coordinates: chr19:6590121-6590145; chr19:6586002-6586026; chr19:6586003-6586027; chr19:6586013-6586037; chr19:6586357-6586381; chr19:6586365-6586389; chr19:6586376-6586400; chr19:6590988-6591012; chr19:6 590991-6591015;chr19:6590862-6590886;chr19:6586396-6586420;chr19:6586372-6586396;chr19:6586371-6586395;chr19: 6586360-6586384;chr19:6586355-6586379;chr19:6586268-6586292;chr19:6586259-6586283;chr19:6586256-6586280;chr19 :6586142-6586166;chr19:6586141-6586165;chr19:6586135-6586159;chr19:6586128-6586152;chr19:6586127-6586151;chr1 9:6586126-6586150;chr19:6586121-6586145;chr19:6586120-6586144;chr19:6586096-6586120;chr19:6586055-6586079;chr 19:6586029-6586053;chr19:6586023-6586047;chr19:6586312-6586336;chr19:6586151-6586175;chr19:6586145-6586169;ch r19:6586100-6586124; chr19:6586030-6586054; chr19:6586028-6586052; chr19:6586395-6586419; and chr19:6586394-6586418. In some implementations, the gene modification comprises at least one nucleotide selected from the following genomic coordinates: chr19:6590121-6590145 and chr19:6586268-6586292.

[0330] In some embodiments, the gene modification comprises at least one nucleotide selected from the following genomic coordinates: chr19:6590998-6591018; chr19:6590995-6591015; chr19:6590992-6591012; chr19:6590991-6591011; chr19:6590987-6591007; chr19:6590986-6591006; chr19:6590985-6591005; chr19:6590977-6590997; chr19:659097 2-6590992;chr19:6590966-6590986;chr19:6590958-6590978;chr19:6590957-6590977;chr19:6590945-6590965;chr19:6590944- 6590964;chr19:6590940-6590960;chr19:6590939-6590959;chr19:6590935-6590955;chr19:6590926-6590946;chr19:6590920-65 90940;chr19:6590919-6590939;chr19:6590914-6590934;chr19:6590908-6590928;chr19:6590907-6590927;chr19:6590899-659 0919;chr19:6590875-6590895;chr19:6590866-6590886;chr19:6590844-6590864;chr19:6590843-6590863;chr19:6586374-65863 94;chr19:6586368-6586388;chr19:6586288-6586308;chr19:6586285-6586305;chr19:6586276-6586296;chr19:6586267-6586287 ; chr19:6586199-6586219; chr19:6586172-6586192; chr19:6586138-6586158; chr19:6586099-6586119; and chr19:6586050-6586070.

[0331] In some embodiments, the gene modification comprises at least one nucleotide selected from the following genomic coordinates: chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863; chr19:6590835-6590855; chr19:6590104-6590124; chr19:6590096-6590116; chr19:6590095-6590115; chr19:6590094-6590114; chr19:6 590093-6590113;chr19:6590087-6590107;chr19:6590084-6590104;chr19:6590083-6590103;chr19:6590078-6590098;chr19: 6586368-6586388;chr19:6586299-6586319;chr19:6586267-6586287;chr19:6590842-6590862;chr19:6590139-6590159;chr19 :6590138-6590158;chr19:6590135-6590155;chr19:6590079-6590099;chr19:6590077-6590097;chr19:6586412-6586432;chr1 9:6586404-6586424;chr19:6586403-6586423;chr19:6586396-6586416;chr19:6586396-6586416;chr19:6586395-6586415;chr 19:6586388-6586408;chr19:6586380-6586400;chr19:6586379-6586399;chr19:6586375-6586395;chr19:6586369-6586389;ch r19:6586367-6586387; chr19:6586360-6586380; chr19:6586359-6586379; chr19:6586120-6586140; and chr19:6586028-6586048.

[0332] In some embodiments, the gene modification comprises at least one nucleotide selected from the following genomic coordinates: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927.

[0333] In some embodiments, the gene modification comprises at least one nucleotide selected from the following genomic coordinates: chr19:6590875-6590895; chr19:6590844-6590864; chr19:6590843-6590863; chr19:6586368-6586388; and chr19:6586267-658628.

[0334] In some embodiments, modification of CD70 comprises any one or more of the insertion, deletion, substitution, or deamination of at least one nucleotide in the target sequence. In some embodiments, modification of CD70 comprises the insertion of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In some embodiments, modification of CD70 comprises the deletion of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In other embodiments, modification of CD70 comprises the insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In other embodiments, modification of CD70 comprises the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In some embodiments, modification of CD70 comprises insertion / deletion, which is generally defined in the art as an insertion or deletion of less than 1000 base pairs (bp). In some embodiments, modification of CD70 involves insertion / deletion, resulting in a frameshift mutation in the target sequence. In some embodiments, modification of CD70 involves the substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In some embodiments, modification of CD70 involves one or more of the insertion, deletion, or substitution of nucleotides, thereby incorporating them into the template nucleic acid. In some embodiments, modification of CD70 involves the insertion of a donor nucleic acid into the target sequence. In some embodiments, modification of CD70 is not transient.

[0335] In some implementations, the genetic modification results in a change in the nucleic acid sequence, which prevents the translation of the full-length protein having the amino acid sequence of the full-length protein before the genetic modification.

[0336] In some embodiments, gene modification results in changes to the nucleic acid sequence, leading to premature stop codons in the coding sequence of the full-length protein. In some embodiments, gene modification results in changes to the nucleic acid sequence, leading to changes in the splicing of pre-mRNA from genomic loci. In some embodiments, repression results in reduced cell surface expression of proteins from genes containing gene modifications.

[0337] 4. The efficacy of guide RNA The efficacy of CD70 guide RNA can be determined using techniques available in the art that assess the editing efficiency of the guide RNA and the surface expression of the CD70 protein. In some embodiments, the reduction or elimination of the surface expression of the CD70 protein can be determined by comparison with unmodified cells (or "relative to unmodified cells"). Engineered cells or cell populations can also be compared with unmodified cell populations.

[0338] "Unmodified cells" (or "multiple unmodified cells") refer to control cells (or multiple cells) of the same type used in an experiment or test, wherein the "unmodified" control cells have not yet been contacted with the CD70 guide RNA. Therefore, unmodified cells (or multiple cells) can be cells that have not yet been contacted with the guide RNA, or cells that have been contacted with guide RNA that does not target CD70.

[0339] In some embodiments, the efficacy of the CD70 guide RNA is determined by measuring the surface expression level of the CD70 protein. In some embodiments, the CD70 protein level is measured by flow cytometry (e.g., using an antibody against CD70). The surface expression of the CD70 protein can be measured by flow cytometry as is commonly known in the art. Those skilled in the art will be familiar with techniques for measuring the surface expression of proteins such as CD70 by flow cytometry. Exemplary measurements of the surface expression level of the CD70 protein by flow cytometry are discussed in Examples 1-6. In some embodiments, as measured by flow cytometry, the cell population is enriched (e.g., by FACS or MACS) relative to an unmodified cell population and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% CD70 negative. In some embodiments, as measured by flow cytometry, the cell population is not enriched (e.g., by FACS or MACS) relative to an unmodified cell population and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% CD70 negative. In some embodiments, as measured by flow cytometry, at least 65% of the cell population is CD70 negative relative to the unmodified cell population. In some embodiments, as measured by flow cytometry, at least 70% of the cell population is CD70 negative relative to the unmodified cell population. In some embodiments, as measured by flow cytometry, at least 80% of the cell population is CD70 negative relative to the unmodified cell population. In some embodiments, as measured by flow cytometry, at least 90% of the cell population is CD70 negative relative to the unmodified cell population. In some embodiments, as measured by flow cytometry, at least 100% of the cell population is CD70 negative relative to the unmodified cell population.

[0340] Methods and compositions for additional gene modification In some embodiments, multiplex gene editing can be performed in cells. In some embodiments, the method includes reducing or eliminating surface expression of the CD70 protein, which includes genetic modification of the CD70 gene, said genetic modification including contacting the cell with a composition comprising: the CD70 guide RNA disclosed herein; and optionally an RNA-guided DNA binder or nucleic acid encoding the RNA-guided DNA binder, said method further including contacting with one or more compositions selected from: (a) a guide RNA that directs the RNA-guided DNA binder to the TGFBR2 gene; (b) a guide RNA that directs the RNA-guided DNA binder to a locus in the cell genome other than CD70; and (c) a donor nucleic acid for insertion into the cell genome.

[0341] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and further has reduced or eliminated surface expression of one or more of MHC class II proteins, MHC-I proteins, TRAC, or TRBC. Such methods and compositions for reducing or eliminating surface expression of one or more of MHC class II proteins, MHC-I proteins, TRAC, or TRBC are further described, for example, in International Publications WO2020 / 081613, WO 2022 / 125982, WO 2022 / 140586, and WO 2022 / 140587 and International Applications PCT / US2023 / 068498 and PCT / US2023 / 068499, the contents of each of which are hereby incorporated in their entirety. For example, a further detailed description of guide RNAs for reducing or eliminating TRBC and / or TRAC protein expression and for genetic modification of TRBC and / or TRAC is provided in International Publication No. WO 2020 / 081613, the entire contents of which are incorporated herein by reference. For example, a further detailed description of guide RNAs for reducing or eliminating HLA-A and / or CIITA protein expression and for genetic modification of HLA-A and / or CIITA is provided in International Publication No. WO 2022 / 125982, the entire contents of which are incorporated herein by reference. For example, a further detailed description of guide RNAs for reducing or eliminating HLA-A protein expression and for genetic modification of HLA-A is provided in International Publication No. WO2022 / 140586, the entire contents of which are incorporated herein by reference. For example, a further detailed description of guide RNAs for reducing or eliminating HLA-A and / or CIITA protein expression and for genetic modification of HLA-A and / or CIITA is provided in International Publication No. WO 2022 / 140587, the entire contents of which are incorporated herein by reference. For example, a further detailed description of guide RNAs for reducing or eliminating HLA-A and / or HLA-B protein expression and for genetic modification of HLA-A and / or HLA-B is provided in International Application No. PCT / US2023 / 068498, the entire contents of which are incorporated herein by reference. For example, a further detailed description of guide RNAs for reducing or eliminating HLA-A, TRAC, TRBC, and / or CIITA protein expression and for genetic modification of HLA-A, TRAC, TRBC, and / or CIITA is provided in International Application No. PCT / US2023 / 068499, the entire contents of which are incorporated herein by reference.

[0342] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and containing a gene modification in the CD70 gene, wherein the gene modification contains at least one nucleotide in any of the genomic coordinates shown in Tables 2A and 3A, and wherein the engineered cell further contains a gene modification in one or more of the CIITA, HLA-A, HLA-B, TRAC, or TRBC genes.

[0343] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and comprising a genetic modification of the CD70 gene, wherein the genetic modification comprises at least one nucleotide within any of the genomic coordinates shown in Tables 2A and 3A, and wherein the engineered cell further comprises a genetic modification of the TGFBR2 gene. In some embodiments, the genetic modification of the TGFBR2 gene is located within the genomic coordinates chr3:30674205-30674229. In some embodiments, the genetic modification of the TGFBR2 gene comprises at least one nucleotide within the genomic coordinates targeted by a TGFBR2 guide RNA, wherein the guide RNA comprises the guide sequence of SEQ ID NO: 301.

[0344] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and containing a gene modification in the CD70 gene, wherein the gene modification contains at least one nucleotide in any of the genomic coordinates shown in Tables 2A and 3A, and wherein the engineered cell further contains a gene modification in one or more of the TGFBR2, CIITA, HLA-A, HLA-B, TRAC, or TRBC genes.

[0345] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and containing a gene modification in the CD70 gene, wherein the gene modification contains at least one nucleotide in any of the genomic coordinates shown in Tables 2A and 3A, and wherein the engineered cell further contains a gene modification in one or more of the TGFBR2, CIITA, HLA-A, HLA-B, or TRAC genes.

[0346] In some embodiments, the methods and compositions include genetically modifying CD70 using a gene editing system to reduce or eliminate surface expression of the CD70 protein, and genetically modifying the insertion of exogenous nucleic acids encoding target receptors or other polypeptides (expressed or secreted on the cell surface) into the cell.

[0347] In some embodiments, an engineered cell is provided having reduced or eliminated surface expression of the CD70 protein relative to an unmodified cell, and comprising a gene modification of the CD70 gene, wherein the gene modification comprises at least one nucleotide within either of the genomic coordinates shown in Tables 2A and 3A, and wherein the engineered cell further comprises a foreign nucleic acid. In some embodiments, the engineered cell comprises a foreign nucleic acid encoding a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a CAR or a universal CAR. In some embodiments, the targeting receptor is an anti-CD70 CAR. In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a ligand of a receptor. In some embodiments, the targeting receptor is a heterozygous CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of the TCR. In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR).

[0348] In some embodiments, the engineered cells also contain exogenous nucleic acids encoding polypeptides (i.e., soluble polypeptides) secreted by the engineered cells. In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the secreted polypeptide is an antibody. In some embodiments, the secreted polypeptide is an enzyme. In some embodiments, the exogenous nucleic acid encodes an antibody that encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0349] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and further has reduced or eliminated surface expression of MHC class II proteins. In some embodiments, the engineered cell has genetic modifications in its genes that reduce or eliminate the surface expression of MHC class II proteins.

[0350] In some embodiments, methods are provided for reducing or eliminating the surface expression of CD70 by genetic modification as disclosed herein, wherein said methods and compositions further provide for reducing or eliminating the surface expression of MHC class II proteins relative to unmodified cells. In some embodiments, the expression of MHC class II proteins is reduced or eliminated by contacting cells with CIITA guide RNA.

[0351] MHC class II expression is influenced by a variety of proteins. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of genes selected from the following: CIITA, HLA-DR, HLA-DQ, HLA-DP, RFX5, RFXB / ANK, RFXAP, CREB, NF-YA, NF-YB, and NF-YC. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the CIITA gene.

[0352] In some embodiments, the engineered cells have a gene modification in the CIITA gene. In some embodiments, the engineered cells have a gene modification in the HLA-DR gene. In some embodiments, the engineered cells have a gene modification in the HLA-DQ gene. In some embodiments, the engineered cells have a gene modification in the HLA-DP gene. In some embodiments, the engineered cells have a gene modification in the RFX gene. In some embodiments, the engineered cells have a gene modification in the CREB gene. In some embodiments, the engineered cells have a gene modification in the nuclear factor (NF)-γ gene.

[0353] In some embodiments, a method is provided for manufacturing engineered cells having reduced or eliminated expression of CD70 protein relative to unmodified cells, the method further comprising reducing or eliminating surface expression of MHC class II proteins in the cells relative to unmodified cells. In some embodiments, the method includes contacting the cells with CIITA guide RNA.

[0354] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and further has reduced or eliminated surface expression of TRAC protein. In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and further has reduced or eliminated surface expression of TRBC protein.

[0355] In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and further has reduced or eliminated surface expression of HLA-A protein. In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and further has reduced or eliminated surface expression of HLA-B protein.

[0356] In some embodiments, the engineered cells also contain gene modifications in one or more of the HLA-A, HLA-B, TRAC, TRBC, or CIITA genes. In some embodiments, the gene modifications in the HLA-A gene are located within the HLA-A target genomic coordinates shown in Tables 10A-10B (e.g., chr6:29942891-29942915, chr6:29942609-29942633, or chr6:29942864-29942884). In some embodiments, the gene modifications in the HLA-B gene are located within the HLA-B target genomic coordinates shown in Tables 10A-10B (e.g., chr6:31355222-31355246, chr6:31355221-31355245, or chr6:31355205-31355229). In some embodiments, gene modifications in the TRAC gene are located within the TRAC target genome coordinates shown in Tables 10A-10B (e.g., chr14:22547524-22547544, chr14:22550574-22550598, or chr14:22550544-22550568). In some embodiments, gene modifications in the CIITA gene are located within the CIITA target genome coordinates shown in Tables 10A-10B (e.g., chr16:10906643-10906667, chr16:10907504-10907528, or chr16:10906853-10906873). In some implementations, the genetic modifications in the TRBC gene are located within the TRBC target genome coordinates shown in Tables 10A-10B (e.g., chr7:142792690-142792714 or chr7:142792047-142792067).

[0357] In some implementations, gene modifications in the TGFBR2 gene are located within the TGFBR2 target genome coordinates shown in Tables 10A-10B (such as chr3:30674205-30674229; chr3:30671674-30671698; chr3:30674167-30674191; chr3:30671941-30671961; chr3:30671739-30671759).

[0358] In some embodiments, the engineered cells further comprise gene modifications of one or more of the HLA-A, HLA-B, TRAC, TRBC, or CIITA genes. In some embodiments, the gene modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate targeted by an HLA-A guide RNA, said guide RNA comprising the guide sequence of SEQ ID NO: 403 or 404. In some embodiments, the gene modification in the HLA-B gene comprises at least one nucleotide within a genomic coordinate targeted by an HLA-B guide RNA, said guide RNA comprising the guide sequence of SEQ ID NO: 406, 405, or 407. In some embodiments, the gene modification in the TRAC gene comprises at least one nucleotide within a genomic coordinate targeted by a TRAC guide RNA, said guide RNA comprising the guide sequence of SEQ ID NO: 413, 408, or 409. In some embodiments, the gene modification in the CIITA gene comprises at least one nucleotide within a genomic coordinate targeted by a CIITA guide RNA, said guide RNA comprising the guide sequence of SEQ ID NO: 402 or 401. In some embodiments, the genetic modification in the TRBC includes at least one nucleotide within a genomic coordinate targeted by the TRBC guide RNA, said guide RNA comprising the guide sequence of SEQ ID NO:410 or 414.

[0359] In some embodiments, the genetic modification in the TGFBR2 gene includes at least one nucleotide within a genomic coordinate targeted by the TGFBR2 guide RNA, said guide RNA comprising the guide sequence of SEQ ID NO: 301 or 302.

[0360] In some embodiments, in any of the methods and compositions disclosed herein, the HLA-A guide RNA is an HLA-A guide RNA comprising guide sequences disclosed in Tables 10A-10B, such as guide sequences selected from SEQ ID NO: 403, 404, and 412. In some embodiments, in any of the methods and compositions disclosed herein, the HLA-B guide RNA is an HLA-B guide RNA comprising guide sequences disclosed in Tables 10A-10B, such as guide sequences selected from SEQ ID NO: 405-407. In some embodiments, in any of the methods and compositions disclosed herein, the TRAC guide RNA is a TRAC guide RNA comprising guide sequences disclosed in Tables 10A-10B, such as guide sequences selected from SEQ ID NO: 413, 408, and 409. In some embodiments, in any of the methods and compositions disclosed herein, the CIITA guide RNA is a CIITA guide RNA comprising a guide sequence disclosed in Tables 10A-10B, such as a guide sequence selected from SEQ ID NO: 402, 401, and 411. In some embodiments, in any of the methods and compositions disclosed herein, the TRBC guide RNA is a TRBC guide RNA comprising a guide sequence disclosed in Tables 10A-10B, such as a guide sequence selected from SEQ ID NO: 410 and 414.

[0361] In some embodiments, in any of the methods and compositions disclosed herein, the TGFBR2 guide RNA is a TGFBR2 guide RNA comprising the guide sequences disclosed in Tables 10A-10B, such as guide sequences selected from SEQ ID NO: 301, 302, 303, 371 and 372.

[0362] In some embodiments, in any of the methods and compositions disclosed herein, the HLA-A guide RNA disclosed herein is a single guide RNA targeting HLA-A and comprising the sequences disclosed in Tables 10A-10B. In some embodiments, in any of the methods and compositions disclosed herein, the HLA-B guide RNA disclosed herein is a single guide RNA targeting HLA-B and comprising the sequences disclosed in Tables 10A-10B. In some embodiments, in any of the methods and compositions disclosed herein, the CIITA guide RNA disclosed herein is a single guide RNA targeting CIITA and comprising the sequences disclosed in Tables 10A-10B. In some embodiments, in any of the methods and compositions disclosed herein, the TRAC guide RNA disclosed herein is a single guide RNA targeting TRAC and comprising the sequences disclosed in Tables 10A-10B. In some embodiments, in any of the methods and compositions disclosed herein, the TRBC guide RNA disclosed herein is a single guide RNA targeting TRBC and comprising the sequences disclosed in Tables 10A-10B. In some embodiments, in any of the methods and compositions disclosed herein, the TGFBR2 guide RNA disclosed herein is a single guide RNA that targets TGFBR2 and includes the sequences disclosed in Tables 10A-10B.

[0363] In some embodiments, the guide RNA disclosed herein comprises a single guide RNA comprising the guide sequence disclosed in Table 10A and modified according to a pattern selected from SEQ ID NO: 710-732, wherein N is a common guide sequence. In some embodiments, the guide RNA disclosed herein comprises a single guide RNA comprising the guide sequence disclosed in Table 10B and modified according to a pattern selected from SEQ ID NO: 620, 641, 658 and 669, wherein N is a common guide sequence.

[0364] In some embodiments, an engineered cell is provided having gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, the CIITA gene, and the CD70 gene, wherein the gene modification in the HLA-A gene is located within genomic coordinates chr6:29942891-29942915; the gene modification in the HLA-B gene is located within genomic coordinates chr6:31355222-31355246; the gene modification in the TRAC gene is located within genomic coordinates chr14:22547524-22547544; the gene modification in the CIITA gene is located within genomic coordinates chr16:10906643-10906667; and the gene modification in the CD70 gene is located within genomic coordinates chr19:6590121-6590145.

[0365] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising one or more of the following, or the compositions provided herein comprise one or more of the following: HLA-A guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 403; HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 406; CIITA guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 402; CD70 guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1; and HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1; and HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1. 413 TRAC guide RNAs with guide sequences having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0366] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising: gRNA targeting the HLA-A locus containing the guide sequence of SEQ ID NO: 403, gRNA targeting the HLA-B locus containing the guide sequence of SEQ ID NO: 406, gRNA targeting the CIITA locus containing the guide sequence of SEQ ID NO: 402, gRNA targeting the CD70 locus containing the guide sequence of SEQ ID NO: 1, and gRNA targeting the TRAC locus containing the guide sequence of SEQ ID NO: 413.

[0367] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising one or more of the following, or the compositions provided herein comprise one or more of the following: gRNA targeting the HLA-A locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 446; gRNA targeting the HLA-B locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 452; gRNA targeting the CIITA locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 444; and gRNA targeting the HLA-B locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 452; and gRNA targeting the CIITA locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 452. 52 gRNAs targeting the CD70 locus with a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity, and gRNAs targeting the TRAC locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 464.

[0368] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising: a guide RNA comprising the sequence of SEQ ID NO: 446, a gRNA comprising the sequence of SEQ ID NO: 452, a gRNA comprising the sequence of SEQ ID NO: 444, a gRNA comprising the sequence of SEQ ID NO: 52, and a gRNA comprising the sequence of SEQ ID NO: 464.

[0369] In some embodiments, an engineered cell is provided, the engineered cell comprising gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, the TGFBR2 gene, and / or the CD70 gene, wherein the gene modification in the HLA-A gene is located within genomic coordinates chr6:29942891-29942915; and wherein the gene modification in the HLA-B gene is located within genomic coordinates chr6:31355222-31355246. The gene modification in the TRAC gene is located within the genomic coordinates chr14:22547524-22547544; the gene modification in the CIITA gene is located within the genomic coordinates chr16:10906643-10906667; the gene modification in the TGFBR2 gene is located within the genomic coordinates chr3:30674205-30674229; and the gene modification in the CD70 gene is located within the genomic coordinates chr19:6590121-6590145.

[0370] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising one or more of the following, or the compositions provided herein comprise one or more of the following: HLA-A guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 403; HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 406; CIITA guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 402; TGFBR2 guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 301; and HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 402; and HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 403; and HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 402; and HLA-C guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 40 1. A CD70 guide RNA having a guide sequence with at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity, and a TRAC guide RNA containing a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 413.

[0371] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising the following, or the compositions provided herein comprise the following: gRNA targeting the HLA-A locus containing the guide sequence of SEQ ID NO: 403, gRNA targeting the HLA-B locus containing the guide sequence of SEQ ID NO: 406, gRNA targeting the CIITA locus containing the guide sequence of SEQ ID NO: 402, gRNA targeting the TGFBR2 locus containing the guide sequence of SEQ ID NO: 301, gRNA targeting the CD70 locus containing the guide sequence of SEQ ID NO: 1, and gRNA targeting the TRAC locus containing the guide sequence of SEQ ID NO: 413.

[0372] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising one or more of the following, or the compositions provided herein comprise one or more of the following: gRNA targeting the HLA-A locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 446; gRNA targeting the HLA-B locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 452; gRNA targeting the CIITA locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 444; gRNA targeting the CIITA locus containing a sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 444; gRNA targeting the HLA-B ... 342 gRNAs targeting the TGFBR2 locus with sequences having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the sequence in SEQ ID NO: 52, gRNAs targeting the CD70 locus with sequences having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the sequence in SEQ ID NO: 464, and gRNAs targeting the TRAC locus with sequences having at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the sequence in SEQ ID NO: 464.

[0373] In some embodiments, the engineered cells provided herein are generated by a genome editing system comprising the following, or the compositions provided herein comprise the following: a guide RNA comprising the sequence of SEQ ID NO: 446, a gRNA comprising the sequence of SEQ ID NO: 452, a gRNA comprising the sequence of SEQ ID NO: 444, a gRNA comprising the sequence of SEQ ID NO: 342, a gRNA comprising the sequence of SEQ ID NO: 52, and a gRNA comprising the sequence of SEQ ID NO: 464.

[0374] In some embodiments, in any of the engineered cells provided herein, the engineered cells comprise gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, and the CIITA gene. In some embodiments, the engineered cells comprise gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, the CIITA gene, and the TGFBR2 gene.

[0375] In some implementations, the engineered cells include: i. gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene; and iv. gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene. In some implementations, the engineered cells include: i. gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene; iv. gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene; and v. gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene. In some implementations, the engineered human cells include: i. gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene; iv. gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene; v. gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene; and vi. gene modifications within the genomic coordinates chr19:6590121-6590145 of the CD70 gene.

[0376] In some embodiments, this document provides an engineered human cell comprising gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene, gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene, gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene, gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene, gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene, and gene modifications within the genomic coordinates chr19:6590121-6590145 of the CD70 gene.

[0377] Exogenous nucleic acid knock-in In some embodiments, this disclosure provides methods and compositions for reducing or eliminating the surface expression of CD70 protein by genetically modifying CD70, as disclosed herein, wherein said methods and compositions further provide the expression of proteins encoded by exogenous nucleic acids (e.g., antibodies, chimeric antigen receptors (CARs), T-cell receptors (TCRs), cytokines or cytokine receptors, chemokines or chemokine receptors, enzymes, fusion proteins, or other types of cell surface-binding peptides or soluble peptides). In some embodiments, the exogenous nucleic acid encodes a protein expressed on the cell surface. For example, in some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the cell surface (further described herein). In some embodiments, the genetically modified cell can act as a “cell factory” for expressing secretory peptides encoded by the exogenous nucleic acid, for example, as a source of continuous in vivo peptide production (as further described herein). In some embodiments, the cell is an allogeneic cell.

[0378] In some embodiments, the method includes reducing the surface expression of the CD70 protein, which includes genetically modifying the CD70 gene, said genetic modification including contacting cells with a composition containing the CD70 guide RNA disclosed herein, and said method further includes contacting cells with exogenous nucleic acids.

[0379] In some embodiments, the method includes reducing or eliminating the surface expression of the CD70 protein, which includes genetically modifying cells with one or more compositions comprising a CD70 guide RNA as disclosed herein, an exogenous nucleic acid encoding a polypeptide (e.g., a target receptor), and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0380] In some embodiments, the method includes reducing or eliminating the surface expression of CD70 protein and MHC class II protein, which includes genetically modifying cells with one or more compositions comprising CD70 guide RNA, CIITA guide RNA, exogenous nucleic acid encoding a polypeptide (e.g., a target receptor) as disclosed herein, and RNA-guided DNA binders or nucleic acids encoding RNA-guided DNA binders.

[0381] In some embodiments, the exogenous nucleic acid encodes a polypeptide expressed on the cell surface. In some embodiments, the exogenous nucleic acid encodes a soluble polypeptide. As used herein, a "soluble" polypeptide refers to a polypeptide secreted by cells. In some embodiments, the soluble polypeptide is a therapeutic polypeptide. In some embodiments, the soluble polypeptide is an antibody. In some embodiments, the soluble polypeptide is an enzyme. In some embodiments, the soluble polypeptide is a cytokine. In some embodiments, the soluble polypeptide is a chemokine. In some embodiments, the soluble polypeptide is a fusion protein.

[0382] In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an antibody fragment (e.g., Fab, Fab2). In some embodiments, the exogenous nucleic acid encodes a full-length antibody. In some embodiments, the exogenous nucleic acid encodes a single-chain antibody (e.g., scFv). In some embodiments, the antibody is IgG, IgM, IgD, IgA, or IgE. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG4 antibody. In some embodiments, the heavy chain constant region contains a mutation known to reduce effector function. In some embodiments, the heavy chain constant region contains a mutation known to enhance effector function. In some embodiments, the antibody is a bispecific antibody. In some embodiments, the antibody is a single-domain antibody (e.g., a VH domain-only antibody).

[0383] In some embodiments, the exogenous nucleic acid encodes a neutralizing antibody. A neutralizing antibody neutralizes the activity of its target antigen. In some embodiments, the antibody is a neutralizing antibody against a viral antigen. In some embodiments, the antibody neutralizes the target viral antigen, thereby blocking the virus's ability to infect cells. In some embodiments, the neutralizing activity of the antibody can be measured using a cell-based neutralization assay. The specific cells and readings will depend on the target antigen of the neutralizing antibody. The half-maximum effective concentration (CMC) of the antibody... 50 It can be measured in cell-based neutralization assays, where lower EC50 values ​​are... 50 Indicates a strong neutralizing antibody.

[0384] In some implementations, the exogenous nucleic acid encodes an antibody that binds to an antigen associated with a disease or condition (see, for example, the diseases and conditions described in section XI).

[0385] In some embodiments, the exogenous nucleic acid encodes a polypeptide (i.e., a cell surface binding protein) expressed on the cell surface. In some embodiments, the exogenous nucleic acid encodes a targeting receptor. A “targeting receptor” is a receptor present on the surface of a cell (e.g., a T cell) to allow the cell to bind to a target site (e.g., a specific cell or tissue in an organism). In some embodiments, the targeting receptor is a CAR. In some embodiments, the targeting receptor is a universal CAR (UniCAR). In some embodiments, the targeting receptor is an aplastic proliferation ligand (APRIL). In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is a TruC. In some embodiments, the targeting receptor is a B cell receptor (BCR) (e.g., expressed on B cells). In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a cytokine receptor.

[0386] In some embodiments, the target receptor includes a chimeric antigen receptor (CAR), a T-cell receptor (TCR), and a receptor for a cell surface molecule, said receptor being operatively linked via at least one transmembrane domain in an internal signaling domain capable of activating T cells upon binding to an extracellular receptor portion. In some embodiments, CAR refers to an extracellular antigen recognition domain, such as scFv, VHH, or nanobodies; which is operatively linked to an intracellular signaling domain that activates T cells upon binding to an antigen. A CAR consists of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T-cell signaling domain. Such receptors are well known in the art (see, for example, WO2020092057, WO2019191114, WO2019147805, WO2018208837). This also covers universal CARs (UniCARs) for recognizing a variety of antigens (see, for example, EP 2 990 416A1) and reverse universal CARs (RevCARs) that facilitate the binding of immune cells to target cells via adaptor molecules (see, for example, WO2019238722). CARs can target any antigen that can generate antibodies and are typically targeted at molecules displayed on the surface of the cells or tissues to be targeted. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of the TCR (e.g., TruC). (See Baeuerle et al., Nature Communications 2087 (2019)). In some embodiments, the exogenous nucleic acid encodes a TCR. In some embodiments, the exogenous nucleic acid encodes a gene-modified TCR. In some embodiments, the exogenous nucleic acid encodes a gene-modified TCR that is specific to a polypeptide expressed by cancer cells. In some embodiments, the exogenous nucleic acid encodes a targeting receptor specifically targeting the Wilms' tumor gene (WT1) antigen. In some embodiments, the exogenous nucleic acid encodes a WT1-specific TCR (see, for example, WO2020 / 081613A1).

[0387] In some embodiments, exogenous nucleic acids are inserted into the genome of the target cell. In some embodiments, exogenous nucleic acids are integrated into the genome of the target cell. In some embodiments, exogenous nucleic acids are integrated into the genome of the target cell via homologous recombination (HR). In some embodiments, exogenous nucleic acids are integrated into the genome of the target cell via blunt-end insertion. In some embodiments, exogenous nucleic acids are integrated into the genome of the target cell via non-homologous end joining. In some embodiments, exogenous nucleic acids are integrated into a safe harbor locus in the cell genome. In some embodiments, exogenous nucleic acids are integrated into one of the TRAC locus, B2M locus, AAVS1 locus, or CIITA locus. In some embodiments, the lipid-nucleic acid assembly composition is lipid nanoparticles (LNPs).

[0388] In some embodiments, the method produces a composition comprising engineered cells having reduced or eliminated surface expression of CD70 protein and containing exogenous nucleic acids. In some embodiments, the method produces a composition comprising engineered cells having reduced or eliminated surface expression of CD70 protein and secreting or expressing polypeptides encoded by exogenous nucleic acids integrated into the cell's genome. In some embodiments, the method produces a composition comprising engineered cells having reduced or eliminated surface expression of CD70 protein, or reduced or eliminated intranuclear CD70 levels, and having reduced or eliminated surface expression of one or more additional proteins (e.g., HLA-A, HLA-B, CIITA, TRAC, or TRBC), and secreting or expressing polypeptides encoded by exogenous nucleic acids integrated into the cell's genome.

[0389] In some embodiments, this disclosure provides methods for reducing or eliminating the surface expression of the CD70 protein by genetically modifying CD70 as disclosed herein, wherein said methods further provide for reducing the expression of one or more additional target genes (e.g., HLA-A, HLA-B, CIITA, TRAC, or TRBC). In some embodiments, the additional genetic modification provides further advantages for the use of genetically modified cells in adoptive cell transfer applications.

[0390] In some embodiments, the method includes reducing or eliminating the surface expression of the CD70 protein, comprising genetically modifying cells with one or more compositions comprising a CD70 guide RNA as disclosed herein; a CIITA guide RNA; a foreign nucleic acid encoding a polypeptide (e.g., a target receptor); a guide RNA that directs an RNA-guided DNA binder to a target sequence located in another gene, thereby reducing or eliminating the expression of said other gene; and an RNA-guided DNA binder or nucleic acid encoding an RNA-guided DNA binder. In some embodiments, an additional target gene is TRAC. In some embodiments, an additional target gene is TRBC.

[0391] Exemplary genome editing system The engineered cells disclosed herein can be created using a variety of suitable gene editing systems, including but not limited to CRISPR / Cas systems; zinc finger nuclease (ZFN) systems; and transcription activator-like effector nuclease (TALEN) systems. Generally, gene editing systems involve the use of engineered cleavage systems to induce double-strand breaks (DSBs) or nicks (e.g., single-strand breaks or SSBs) in a target DNA sequence. Cleavage or nicks can occur via the use of specific nucleases (such as engineered ZFNs, TALENs) or by using CRISPR / Cas systems with engineered guide RNAs to guide specific cleavage or nicks of the target DNA sequence. Furthermore, targeted nucleases based on Argonaute systems (e.g., from *T. thermophilus*, referred to as 'TtAgo', see Swarts et al. (2014) Nature 507(7491): 258-261) are being developed, which may also have potential for use in gene editing and gene therapy.

[0392] In some implementations, the gene editing system is a TALEN system. A transcription activator-like effector nuclease (TALEN) is a restriction enzyme that can be engineered to cleave specific DNA sequences. This nuclease is prepared by fusing a TAL effector DNA-binding domain with a DNA-cleaving domain (a nuclease that cuts the DNA strand). Transcription activator-like effectors (TALEs) can be engineered to bind to desired DNA sequences, thereby promoting DNA cleavage at a specific location (see, for example, Boch, 2011, Nature Biotech). Restriction enzymes can be introduced into cells for gene editing or for in situ gene editing; this technique is known as gene editing using engineered nucleases. Such methods and compositions used therein are known in the art. See, for example, WO2019147805, WO2014040370, and WO2018073393, the contents of which are hereby incorporated in their entirety.

[0393] In some implementations, the gene editing system is a zinc finger system. Zinc finger nucleases (ZFNs) are artificial restriction enzymes created by fusing a zinc finger DNA-binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target specific desired DNA sequences, enabling the zinc finger nuclease to target unique sequences within a complex genome. Non-specific cleavage domains derived from the type II restriction endonuclease FokI are commonly used as cleavage domains in ZFNs. Cleavage is repaired by endogenous DNA repair mechanisms, allowing the ZFN to precisely alter the genome of higher organisms. Such methods and compositions used therein are known in the art. See, for example, WO2011091324, the contents of which are hereby incorporated in their entirety.

[0394] In some embodiments, the gene editing system is a CRISPR / Cas system, comprising, for example, a guide sequence and an RNA-guided DNA binder, and a CRISPR guide RNA further described herein. In some embodiments, the gene editing system comprises a base editor containing a deaminase and an RNA-guided nicking enzyme. In some embodiments, the gene editing system comprises a base editor containing a cytidine deaminase and an RNA-guided nicking enzyme. In some embodiments, the gene editing system comprises a DNA polymerase. Further descriptions of gene editing system methods and compositions used therein are known in the art. See, for example, WO2019 / 067910, WO2021 / 188840A1, WO2019 / 051097 and PCT / US2021 / 062922, filed December 10, 2021, and U.S. Provisional Application No. 63 / 275,425, filed November 3, 2021, the contents of each of which are hereby incorporated in their entirety. Exemplary nucleotide and polypeptide sequences of the gene editing systems disclosed herein are provided in Table 10 below. Methods for identifying alternative nucleotide sequences (including naturally occurring variants of the alternatives) encoding the polypeptide sequences provided herein are known in the art. Also covered are sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with either the nucleic acid sequence or the nucleic acid sequence encoding the amino acid sequence provided herein.

[0395] VI. CRISPR guide RNA This article provides guide sequences that can be used to modify target sequences, for example, by using guide RNA containing the disclosed guide sequences with an RNA-guided DNA binder (e.g., a CRISPR / Cas system).

[0396] In some respects, this document provides a guide RNA comprising: A. a guide sequence comprising at least 20 consecutive nucleotides having at least 80%, 85%, preferably 90% or 95% identity or complementarity with any of the guide sequences in Tables 3A-3B.

[0397] In some embodiments, the guide RNA provided herein also comprises one or more of the following: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1. at least one of the following nucleotide pairs in hairpin 1 is substituted by a Watson-Crick pairing nucleotide: H1-1 with H1-12, H1-2 with H1-11, H1-3 with H1-10, or H1-4 with H1-9, and said hairpin 1 region optionally lacks a. a. any one or both of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides in hairpin region 1; or 2. the shortened hairpin region 1 is missing 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions H1-1, H1-2, or H1-3 are missing or substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601), or b. one or more of positions H1-6 to H1-10 are missing relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601). 601) is substituted; or 3. The shortened hairpin region 1 is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12 or n are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or B. The shortened upper stem region is missing 1-6 nucleotides and the 6, 7, 8, 9, 10 or 11 nucleotides of the shortened upper stem region include fewer than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or C. At any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601). The substitution of NO:601), wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or D. an exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region.

[0398] In some implementations, the guide RNA lacks 6 nucleotides in the shortened hairpin 1.

[0399] In some implementations, the guide RNA lacks 8 nucleotides in the shortened hairpin 1.

[0400] In some implementations, H-1 and H-3 are missing.

[0401] In some implementations, the guide RNA also includes a 3' tail.

[0402] In some implementations, the 3' tail is 1-4 nucleotides long, optionally 1 nucleotide long.

[0403] In some embodiments, the guide RNA includes an upper stem region containing modifications to any one or more of US1-US12 in the upper stem region.

[0404] In some implementations, the guide RNA described herein comprises a nucleotide sequence selected from the sequences in Table 3A.

[0405] In some embodiments, the guide RNA comprises a modified nucleotide sequence selected from the modified Spy guide scaffold sequences in Table 4, wherein the modified nucleotide sequence is at the 3' of the guide sequence.

[0406] In some implementations, the guide RNA described herein is modified according to a pattern of nucleotide sequences selected from the modified Spy guide RNA sequences in Tables 5A-5B.

[0407] In some implementations, the guide comprises a nucleotide sequence selected from the unmodified Spy guide RNA sequences in Table 4B, wherein N20 together form the guide sequence described herein.

[0408] In some implementations, each nucleotide of the unmodified Spy guide RNA sequence in Table 5B is any natural or non-natural nucleotide.

[0409] In some implementations, the guide RNA is modified according to a pattern selected from the modification patterns in Table 5B, where (mN*)3N17 refers to the guide sequence described herein, wherein the first three nucleotides contain a 2'-O-Me modification and a phosphate thioester bond.

[0410] In some implementations, the guide RNA described herein contains the sequences or modification patterns listed in Tables 4A-5B.

[0411] The guide sequence targeting a site adjacent to an appropriate PAM (e.g., SpyCas9 PAM) may also contain additional nucleotides, referred to as scaffold sequences or conserved portions, to form crRNA or crRNA that binds to trRNA to form sgRNA, for example, having the following exemplary nucleotide sequences following the guide sequence at its 3' end (Table 4A). #mer refers to the length of the crRNA or sgRNA when the 20-nucleotide guide sequence is included at the 5' of the scaffold sequence provided in Table 4A.

[0412] In some aspects, a guide RNA (gRNA) comprising a guide region and a conserved region is provided, wherein: A. the guide region comprises a nucleic acid sequence having at least 80%, 85%, preferably 90% or 95% identity or complementarity with any of the guide sequences in Tables 2A-2B for 24 consecutive nucleotides.

[0413] In some embodiments, the conserved region comprises one or more of the following: (a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region is missing 2-24 nucleotides relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 37-48 and 53-64 are missing relative to SEQ ID NO: 700 and optionally one or more of nucleotides 37-64 are substituted relative to SEQ ID NO: 700; and (ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or (b) a shortened hairpin 1 region, wherein the shortened hairpin 1 is missing 2-10 nucleotides, optionally 2-8 nucleotides, relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 82-86 and 91-95 are missing relative to SEQ ID NO: 700 and optionally one or more of positions 82-96 are missing relative to SEQ ID NO: 700. 700 is substituted; and (ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or (c) a shortened hairpin 2 region, wherein the shortened hairpin 2 is missing 2-18 nucleotides relative to SEQ ID NO: 700, optionally 2-16 nucleotides, wherein (i) one or more of nucleotides 113-121 and 126-134 are missing relative to SEQ ID NO: 700 and optionally one or more of nucleotides 113-134 are substituted relative to SEQ ID NO: 700; and (ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein one or two of nucleotides 144-145 are optionally missing relative to SEQ ID NO: 700; optionally, wherein at least 10 nucleotides are modified nucleotides.

[0414] In some implementations, the conserved region contains nucleotide sequences selected from Tables 6A-7B.

[0415] In some implementations, the guide RNA contains at least one end modification.

[0416] In some implementations, the modification includes a 5' end modification.

[0417] In some implementations, the modification includes a 3' end modification.

[0418] In some implementations, the guide RNA includes modifications in the hairpin region.

[0419] In some implementations, the embellishments in the hairpin area are also end embellishments.

[0420] In some implementations, the nucleotide is modified to include a 2'-O-methyl (2'-O-Me) modification.

[0421] In some implementations, the modification involves the phosphate thioester (PS) bond between nucleotides.

[0422] In some implementations, the nucleotide modified to include a 2'-O-methyl (2'-O-Me) modification is linked to a 3' adjacent nucleotide via a phosphate thioester (PS) bond.

[0423] In some implementations, the nucleotides are modified to include 2'-fluorine (2'F) modification.

[0424] In some embodiments, the 5' end modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide at positions 1-3 of the 5' end of the guide sequence, which is linked to the 3' adjacent nucleotide by a phosphate thioester (PS) bond.

[0425] In some embodiments, the conserved region comprises a modified nucleotide sequence selected from the modified conserved region Nme guide RNA motifs in Table 6, and wherein the conserved region is at the 3' of the guide region.

[0426] In some implementations, the guide RNA comprises a nucleotide sequence selected from any of the guide sequences in Tables 2A-2B.

[0427] In some implementations, each nucleotide is any natural or non-natural nucleotide.

[0428] In some embodiments, the guide RNA is modified according to a pattern selected from SEQ ID NO: 710-732, wherein N is the guide sequence described herein, and N, A, C, G and U are ribonucleotides (2'-OH), wherein "m" indicates 2'-O-Me modification, "f" indicates 2'-fluorine modification, and "*" indicates phosphate thioester linkage between nucleotides.

[0429] In some aspects, this document provides a composition comprising the guide RNA described herein.

[0430] Table 4A: Exemplary Unmodified Spy Scaffold Sequences

[0431] In some implementations, the guide RNA comprises a nucleotide sequence selected from unmodified Spy guide RNA sequences in Table 4B, wherein N 20 All of them are any of the guide sequences in Tables 3A-3B. In some embodiments, each nucleotide of the unmodified Spy guide RNA sequence in Table 4B is any natural or non-natural nucleotide.

[0432] Table 4B: Exemplary unmodified Spy guide RNA sequences

[0433] N together form the guide sequence provided in this paper.

[0434] In the case of sgRNA, the guide sequence can be integrated into the following modified guide scaffold motifs (Table 5A). #mer refers to the length of the sgRNA when a 20-nucleotide guide sequence (modified or unmodified) is included at the 5' of the scaffold sequence provided in Table 5A: Table 5A: Exemplary modified Spy wizard scaffold sequences

[0435] Where “m” indicates 2'-O-Me modification, “f” indicates 2'-fluorine modification, and “*” indicates phosphate thioester bond between nucleotides. In the case of modified sequences, no modification indicates RNA (2'-OH) and phosphodiesterase bond.

[0436] The guide sequence is located at the 5' end of the conserved portion of the guide RNA. In some embodiments, the guide sequence is 20-25 nucleotides long, preferably 22-24 nucleotides. In some embodiments, the guide sequence includes one or more chemical modifications, such as modifications at nucleotides 1, 2, and 3 at the 5' end of the guide RNA, optionally modifications at all nucleotides 1, 2, and 3. In some embodiments, the modification includes a 2'-O-Me modification.

[0437] In some embodiments, the guide sequence is a chemically modified sequence. In some embodiments, the chemically modified guide sequence is (mN*)3(N). 13-17 In some implementations, the wizard sequence is (mN*)3(N). 17 That is, mN*mN*mN*NNNNNNNNNNNNNNNNNNN. In some implementations, (N) 13-17 Or (N) 17 Each N is unmodified. In some implementations, (N) 13-17 Or (N) 17 Each N in the N is modified independently, for example, independently by 2'-O-methyl modification.

[0438] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, wherein N is any natural or non-natural nucleotide, and wherein N as a whole constitutes any of the guide sequences disclosed in Tables 3A-3B. In some embodiments, the modified sgRNA comprises the sequences shown in Table 5B.

[0439] Table 5B: Exemplary modified Spy guide RNA sequences

[0440] Wherein “m” indicates 2'-O-Me modification, “f” indicates 2'-fluorine modification, and “*” indicates a phosphate thioester bond between nucleotides, and in the case of a modified sequence, there is no modification indicator RNA (2'-OH), wherein the overall composition of N comprises a guide sequence having at least 85%, preferably 90% or 95% identity or complementarity with at least 17, 18, 19 or 20 consecutive nucleotides of any of the guide sequences disclosed in Tables 3A-3B herein, wherein N is substituted by any of the guide sequences disclosed in Tables 3A-3B herein. In some embodiments, when the overall composition of N constitutes a guide sequence within N17, each N of N17 may be modified independently, for example, by 2'-OMe modification.

[0441] In the case of sgRNA, the guide sequence may also include a SpyCas9 sgRNA scaffold sequence. An example of a SpyCas9 sgRNA scaffold sequence is shown in Table 8A below (SEQ ID NO: 601: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGU GGCACCGAGUCGGUGC - “Exemplary SpyCas9 sgRNA-1”), which is included at the 3' end of the guide sequence and is provided together with the domains shown in the table below. LS is the lower stem. B is the protrusion. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 are collectively referred to as the hairpin region. A model of a structure containing both the guide sequence and the scaffold sequence is in WO2019237069. Figure 10 Provided in A, the references are incorporated herein by reference.

[0442] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can be used as a template sequence for specific chemical modifications, sequence substitutions, and truncations.

[0443] In some embodiments, the gRNA is, for example, sgRNA or dgRNA, and optionally contains chemical modifications. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, such as the exemplary SpyCas9sgRNA-1. The gRNA (such as sgRNA) may include modifications at the 5' end of the guide sequence or the 3' end of the SpyCas9 sgRNA sequence, such as at one or more terminal nucleotides in the exemplary SpyCas9 sgRNA-1, for example at 1, 2, 3, or 4 nucleotides at the 3' or 5' end. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free modified nucleotides, and combinations thereof. In some embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide. In some embodiments, the modified nucleotide includes a PS bond. In some embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide and a PS bond.

[0444] In some implementations, SEQ ID NO: 601 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC "Exemplary SpyCas9 sgRNA-1", see WO2019237069, the contents of which are incorporated herein by reference. The exemplary SpyCas9 sgRNA-1 part and position numbering scheme is listed in Table 11 below.

[0445] As an example, the exemplary SpyCas9 sgRNA-1 also includes one or more of the following: A. A shortened section of the hairpin, or alternatively, a shortened section of the hairpin, wherein... 1. In hairpin 1, at least one of the following nucleotide pairs is replaced by a Watson-Crick pairing nucleotide: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region is optionally missing. a. Any one or both of H1-5 to H1-8 b. One, two, or all of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides in region 1 of the hairpin; or 2. The shortened hairpin region 1 lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. One or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601), or b. One or more of positions H1-6 to H1-10 are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or 3. The shortened hairpin region 1 is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or B. A shortened upper stem region, wherein the shortened upper stem region is missing 1-6 nucleotides and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include fewer than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or C. Substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or D. An exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region, wherein 1. The modified nucleotide is optionally selected from nucleotides modified with 2'-O-methyl (2'-OMe), nucleotides modified with 2'-O-(2-methoxyethyl) (2'-O-moe), nucleotides modified with 2'-fluoro (2'-F), nucleotides with phosphate thioester (PS) bonds between nucleotides and nucleotides without reverse base modification, or combinations thereof; or 2. The modified nucleotides optionally include nucleotides modified with 2'-OMe.

[0446] Guide sequences targeting sites adjacent to a suitable PAM (e.g., NmeCas9 PAM) (e.g., as shown in Table 2A) may also contain additional nucleotides to form crRNA or crRNA that conjugates with trRNA to form sgRNA, for example, with exemplary nucleotide sequences following the guide sequence at its 3' end, as provided in Tables 6A-7B. Exemplary NmeCas9 sgRNA part and position numbering schemes (including both guide sequences and scaffold sequences) are listed in Table 8B below.

[0447] In some implementations, SEQ ID NO: 700 (“Exemplary NmeCas9 sgRNA-1”) is used as an example, and Exemplary NmeCas9 sgRNA-1 includes: A. A guide RNA (gRNA) comprising a guide region and a conserved region, the conserved region comprising one or more of the following: (a) A shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region is missing 2-24 nucleotides, wherein (i) Relative to SEQ ID NO: 700, one or more of nucleotides 37-48 and 53-64 are deleted, and optionally one or more of nucleotides 37-64 are substituted; and (ii) Nucleotide 36 is composed of at least two nucleotides linked to nucleotide 65; or (b) The shortened hairpin 1 region, wherein the shortened hairpin 1 is missing 2-10, optionally 2-8 nucleotides, wherein (i) Relative to SEQ ID NO: 700, one or more of nucleotides 82-86 and 91-95 are deleted, and optionally one or more of positions 82-96 are substituted; and (ii) Nucleotide 81 is linked to nucleotide 96 by at least four nucleotides; or (c) The shortened hairpin 2 region, wherein the shortened hairpin 2 lacks 2-18, optionally 2-16 nucleotides, wherein (i) Relative to SEQ ID NO: 700, one or more of nucleotides 113-121 and 126-134 are deleted, and optionally one or more of nucleotides 113-134 are substituted; and (ii) Nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; One or both of nucleotides 144-145 are optionally deleted relative to SEQ ID NO: 700; Optionally, at least 10 nucleotides are modified nucleotides.

[0448] Exemplary unmodified conserved nucleotide sequences (also known as scaffold sequences) are shown in Table 6A. #mer refers to the length of the sgRNA when the 24-nucleotide guide sequence is included at the 5' of the scaffold sequence provided in Table 6A.

[0449] Table 6A: Exemplary unmodified Nme guide RNA conserved region nucleotide sequence

[0450] In some implementations, the guide RNA comprises a nucleotide sequence selected from unmodified Nme guide RNA sequences in Tables 2A-2B, wherein N 20-25 All of them are any of the guide sequences disclosed in Tables 2A-2B. In some embodiments, each nucleotide in the unmodified Spy guide RNA sequence in Table 6B is any natural or non-natural nucleotide.

[0451] Table 6B: Exemplary unmodified Nme guide RNA nucleotide sequences

[0452] In the case of sgRNA, the modified guide sequence can be integrated into one of the following exemplary modified conserved motifs (Table 7A). #mer refers to the length of the sgRNA when the 24-nucleotide guide sequence (modified or unmodified) is included at the 5' of the scaffold sequence provided in Table 6A or Table 7A: Table 7A: Conserved regions of exemplary modified Nme guide RNAs

[0453] Where “m” indicates 2'-O-Me modification, and “*” indicates phosphate thioester bonding between nucleotides, and in the case of modified sequences, no modification indicates RNA (2'-OH) and phosphate thioester bonding.

[0454] The guide sequence is located at the 5' end of the conserved portion of the guide RNA. In some embodiments, the guide sequence is 20-25 nucleotides long, preferably 22-24 nucleotides. In some embodiments, the guide sequence includes one or more chemical modifications, such as modifications at nucleotides 1, 2, and 3 at the 5' end of the guide RNA, optionally modifications at all nucleotides 1, 2, and 3. In some embodiments, the modification includes a 2'-O-Me modification.

[0455] In some embodiments, the modification includes a 2'-O-Me modification and a phosphate thioester bond to a 3' nucleotide, such as (mN*)3(N). 17-22 , Preferably (mN*)3(N) 21 , where (N)21 Each nucleotide in the portion is either modified or unmodified independently.

[0456] In some embodiments, N as a whole constitutes a GUIDE sequence comprising: (A) a sequence having at least 80%, 85%, preferably at least 90% or 95%, or 100% identity or complementarity to the 24 consecutive nucleotides of the target site provided in Table 2A. For example, N may be substituted with any of the guide sequences disclosed in Table 2A herein. In some embodiments, when N as a whole constitutes (N) 20-25 When the guide sequence is within (N), 20-25 Each N can be modified independently, for example by a 2'-OMe modification, and optionally further by a PS modification, particularly at the 1st, 2nd, or 3rd terminal nucleotide. In some embodiments, (N)20-25 has the following sequence and modification pattern: mN*mN*mN*mNmNNNmNmNNmNNNNmNNNNmNNNNmNNNN.

[0457] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, wherein N is any natural or non-natural nucleotide, and wherein N as a whole constitutes the guide sequences disclosed in Tables 2A-2B. In some embodiments, the modified sgRNA comprises the sequences shown in Table 7B.

[0458] Table 7B: Exemplary modified Nme guide RNA sequences

[0459] Where “m” indicates 2'-O-Me modification, and “*” indicates phosphate thioester bonding between nucleotides, and in the case of modified sequences, no modification indicates RNA (2'-OH) and phosphate thioester bonding.

[0460] In some embodiments, the exemplary SpyCas9 sgRNA-1, exemplary NmeCas9 sgRNA-1, or sgRNA (such as sgRNA containing the exemplary SpyCas9 sgRNA-1) further includes a 3' tail, such as a 3' tail of 1, 2, 3, 4, or more nucleotides. In some embodiments, the tail includes one or more modified nucleotides. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, 2'-deoxy (2'-H-) modified nucleotides, baseless nucleotides, locked nucleic acid (LNA) nucleotides, unlocked nucleic acid (UNA) nucleotides, phosphate thioester (PS) bonds between nucleotides, and terminally reverse baseless nucleotides; or combinations thereof. In some embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide. In some embodiments, the modified nucleotide includes a PS bond between nucleotides. In some implementations, the modified nucleotides include 2'-OMe modified nucleotides and PS bonds between nucleotides.

[0461] In some embodiments, the hairpin region includes one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, and reverse-base-free nucleotides; or combinations thereof. In some embodiments, the modified nucleotides include 2'-OMe modified nucleotides.

[0462] In some embodiments, the upper stem region includes one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, and reverse-base-free nucleotides; or combinations thereof. In some embodiments, the modified nucleotides include 2'-OMe modified nucleotides.

[0463] In some embodiments, the exemplary SpyCas9 sgRNA-1 or the exemplary NmeCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is pyrimidine, and the YA dinucleotide includes a modified nucleotide. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, and reverse-base-free modified nucleotides, or combinations thereof. In some embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide.

[0464] In some embodiments, the exemplary SpyCas9 sgRNA-1 or the exemplary NmeCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is pyrimidine, and the YA dinucleotide includes a sequence-substituted nucleotide in which pyrimidine replaces a purine. In some embodiments, when pyrimidine forms a Watson-Crick base pair in a single guide, the sequence-substituted pyrimidine nucleotide of the Watson-Crick-based nucleotide is substituted to maintain the Watson-Crick base pairing.

[0465] gRNA containing linkers In some implementations, the gRNA contains one or more internal linkers. As used herein, "internal linker" describes a non-nucleotide segment of two nucleotides within the gRNA that binds. If the gRNA contains a spacer region, the internal linker is located outside the spacer region (e.g., within the scaffold or conserved region of the gRNA). For V-shaped guides, it should be understood that the final hairpin is the only hairpin in the structure (i.e., the repeat-anti-repeat region). The length of the internal linker can depend, for example, on the number of nucleotides replaced by the linker and the linker's position within the gRNA. Internal linkers and their use in the gRNA case are provided in WO2022261292.

[0466] The gRNAs disclosed herein may contain internal linkers. Generally, any internal linker compatible with the function of the gRNA can be used. A degree of flexibility in the linker may be desirable. In some embodiments, the internal linker contains at least two, three, four, five, six, or more on-pathway single bonds. A linker is considered on-pathway if it is part of the shortest path between two nucleotides connected to the linker at the 5' and 3' positions.

[0467] As used herein, the length of an internal linker can be defined by its bridging length. As used herein, the “bridging length” of an internal linker refers to the distance or number of atoms in the shortest chain along the pathway from the first atom of the linker (bonded to a 3' substituent of the preceding nucleotide, such as oxygen or phosphate) to the last atom of the linker (bonded to a 5' substituent of the following nucleotide, such as oxygen or phosphate) (e.g., from ~ to # in the structure of formula (I) below). The table below provides approximate predicted bridging lengths for various linkers.

[0468] Exemplary linker lengths predicted by atomic number, number of ethylene glycol units, approximate linker length (in Å) assuming an ethylene glycol monomer length of about 3.7 Å, and suitable positions for at least the entire ring portion of the substituted hairpin structure are provided in Table 8 below. Substitution of two nucleotides requires a linker length of at least about 11 Å. Substitution of at least three nucleotides requires a linker length of at least about 16 Å.

[0469] Table 9A

[0470] In some implementations, the internal connector includes the structure of form (I): ~-L0-L1-L2-# (I) in: ~ indicates a bond with the 3' substituent of the preceding nucleotide; # indicates a bond with the 5' substituent of the following nucleotide; L0 is empty or C 1-3 Aliphatic groups; L1 is -[E 1 -(R 1 )] m -,in Each R 1 C is independent 1-5 Aliphatic groups, optionally surrounded by 1 or 2 E 2 replace, Each E 1 and E 2 It is an independent hydrogen bond acceptor, or each is independently selected from cyclic and heterocyclic hydrocarbons, and Each m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and L2 is empty, C 1-3 Aliphatic groups, or hydrogen bond acceptors.

[0471] In some embodiments, L1 comprises one or more -CH2CH2O-, -CH2OCH2-, or -OCH2CH2- units (“ethylene glycol subunits”). In some embodiments, the number of -CH2CH2O-, -CH2OCH2-, or -OCH2CH2- units is in the range of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0472] In some implementations, m is 1, 2, 3, 4, or 5. In some implementations, m is 1, 2, or 3. In some implementations, m is 6, 7, 8, 9, or 10.

[0473] In some implementations, L0 is empty. In some implementations, L0 is -CH2- or -CH2CH2-.

[0474] In some implementations, L2 is empty. In some implementations, L2 is -O-, -S-, or C. 1-3 Aliphatic group. In some embodiments, L2 is -O-. In some embodiments, L2 is -S-. In some embodiments, L2 is -CH2- or -CH2CH2-.

[0475] In the table of this paper, L1 and L2 are arbitrarily C9 and C18, respectively, as follows: In some embodiments, the internal linker has a bridging length of about 3-30 atoms, optionally 12-21 atoms, and the linker replaces at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 6-18 atoms, optionally about 6-12 atoms, and the linker replaces at least 2 nucleotides of the gRNA. In some embodiments, the internal linker replaces 2-12 nucleotides.

[0476] In some embodiments, the guide RNA comprises the nucleic acid sequence of SEQ ID NO: 601 or SEQ ID NO: 700, including modifications disclosed elsewhere herein. Table 9B shows various embodiments of gRNA structures and types with possible numbers and positions of internal linkers.

[0477] Table 9B.

[0478] In some embodiments, the internal linker is located in the repeat-inverse repeat region of the gRNA. In some embodiments, the internal linker replaces at least four nucleotides in the repeat-inverse repeat region of the gRNA. In some embodiments, the internal linker replaces the loop in the repeat-inverse repeat region of the Spy Cas9 gRNA, corresponding to nucleotides 13-16 in SEQ ID NO: 601. In some embodiments, the internal linker replaces the loop in the repeat-inverse repeat region of the Nme Cas9 gRNA, corresponding to nucleotides 49-52 in SEQ ID NO: 700.

[0479] In some embodiments, the internal linker replaces 2, 3, or 4 nucleotides in the linker region of the gRNA. In some embodiments, the internal linker replaces the loop in the linker region of the SpyCas9 gRNA, corresponding to nucleotides 33-36 of SEQ ID NO: 601.

[0480] In some embodiments, the internal linker is located in the hairpin region of the gRNA. In some embodiments, the internal linker replaces at least four nucleotides in the hairpin region of the gRNA. In some embodiments, the internal linker replaces the loop in hairpin region 1 of the Spy Cas9 gRNA, corresponding to nucleotides 53-56 in SEQ ID NO: 601. In some embodiments, the internal linker replaces the loop in hairpin region 1 of the Nme Cas9 gRNA, corresponding to nucleotides 87-90 in SEQ ID NO: 700. In some embodiments, the internal linker replaces at least four nucleotides in the loop in hairpin region 2 of the Nme Cas9 gRNA, corresponding to nucleotides 122-125 in SEQ ID NO: 700. In some embodiments, the internal linker replaces the loop in hairpin region 1 of the Nme Cas9 gRNA (corresponding to nucleotides 87-90 in SEQ ID NO: 700) and replaces at least four nucleotides in the loop in hairpin region 2 of the Nme Cas9 gRNA (corresponding to nucleotides 122-125 in SEQ ID NO: 700).

[0481] Table 9C. Exemplary SpyCas9 guide RNA containing linkers

[0482] Nucleotide modifications in the modified sequence are indicated in Table 9C as follows: where “m” indicates 2'-O-Me modification, “*” indicates phosphate thioester linkage between nucleotides, and within the individual specified nucleotides, no modification indicates RNA with a phosphodiesterase backbone (2'-OH).

[0483] Table 9D. Exemplary NmeCas9 guide RNAs containing linkers

[0484] Nucleotide modifications in the modified sequence are indicated in Table 9D as follows: where “m” indicates a 2'-O-Me modification, “*” indicates a phosphate thioester bond between nucleotides, and within each individually specified nucleotide, no modification indicates RNA with a phosphodiesterase backbone (2'-OH). Even in the case of modified sequences, each nucleotide of (N)20-25 is optionally modified independently. In some instances, at least the first three nucleotides are modified, for example, (mN*)3(N)17-22.

[0485] In some embodiments, a composition is provided comprising one or more guide RNAs, the guide RNAs comprising a guide sequence of any of those listed in Tables 3A-3B. In some embodiments, a composition is provided comprising one or more guide RNAs, the guide RNAs comprising a guide sequence of any of those listed in Tables 3A-3B, wherein the nucleotide of SEQ ID: 617 follows the guide sequence at its 3' end. In some embodiments, one or more guide RNAs comprising a guide sequence of any of those listed in Tables 3A-3B (wherein the nucleotide of SEQ ID NO: 617 follows the guide sequence at its 3' end) are modified according to a modification pattern of any of the sequences shown in Table 5A (e.g., SEQ ID NO: 641). In some embodiments, one or more guide RNAs comprising a guide sequence of any of those listed in Tables 3A-3B (wherein the nucleotide of SEQ ID NO: 600 follows the guide sequence at its 3' end) are modified according to a modification pattern of any of the sequences shown in Table 5B (e.g., SEQ ID NO: 658).

[0486] In some embodiments, an sgRNA is provided comprising a guide sequence of any of those listed in Tables 3A-3B and any conserved portion of the sgRNAs shown in Tables 5A-5B, optionally having a modification pattern of any of the sgRNAs shown in Table 5B, optionally wherein the sgRNA comprises 5' and 3' end modifications (if not already shown in the constructs in Table 5B).

[0487] In some implementations, the sgRNA comprises any of the modification patterns shown in Table 5B above, where N is any natural or non-natural nucleotide, and where the entirety of N constitutes the guide sequence as described in Table 3A herein. Table 5B does not depict the guide sequence portion of the sgRNA. Although N is replaced by a nucleotide of the guide sequence, the modification remains as shown in Table 5B. That is, although the guide nucleotide replaces "N," the nucleotides are modified as shown in Table 5B.

[0488] In some embodiments, a composition is provided comprising one or more guide RNAs containing a guide sequence of any of the sequences in Tables 2A-2B. In some embodiments, a composition is provided comprising one or more guide RNAs containing a guide sequence of any of the sequences in Tables 2A-2B, wherein the nucleotide of SEQ ID: 706 follows the guide sequence at its 3' end. In some embodiments, one or more guide RNAs containing a guide sequence of any of the sequences in Tables 2A-2B (wherein the nucleotide of SEQ ID NO: 706 follows the guide sequence at its 3' end) are modified according to a modification pattern of any of the sequences in Tables 7A (e.g., SEQ ID NO: 712 or 713). In some embodiments, one or more guide RNAs containing a guide sequence of any of the sequences in Tables 2A-2B (wherein the nucleotide of SEQ ID NO: 706 follows the guide sequence at its 3' end) are modified according to a modification pattern of any of the sequences shown in Table 7A (e.g., SEQ ID NO: 712 or 713). In some embodiments, one or more guide RNAs containing the guide sequence of any of the ones in Tables 2A-2B (wherein the nucleotide of SEQ ID NO: 706 follows the guide sequence at its 3' end) are modified according to the modification pattern of SEQ ID NO: 713.

[0489] In some embodiments, an sgRNA is provided comprising a guide sequence of any of those listed in Tables 2A-2B and any conserved portion of the sgRNAs shown in Tables 7A-7B, optionally having a modification pattern of any of the sgRNAs shown in Table 7B, optionally wherein the sgRNA comprises 5' and 3' end modifications (if not already shown in the constructs in Table 7B).

[0490] In some implementations, the sgRNA contains any of the modification patterns shown in Table 7B below, where N is any natural or non-natural nucleotide, and where the entire N constitutes the guide sequence as described in Table 2A herein. Table 7B does not depict the guide sequence portion of the sgRNA. Although N is replaced by a nucleotide of the guide sequence, the modification remains as shown in Table 7B. That is, although the guide nucleotide replaces "N," the nucleotide is modified as shown in Table 7B.

[0491] In some embodiments, a composition is provided comprising one or more guide RNAs, the guide RNAs comprising a guide sequence of any one of those in Tables 2A-2B. In one aspect, a composition is provided comprising one or more gRNAs, the gRNAs comprising a guide sequence having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identity with any one of the nucleic acids in any one of those in Tables 2A-2B.

[0492] In other embodiments, a composition is provided comprising at least one (e.g., at least two) gRNAs, wherein the at least one gRNA comprises a guide sequence selected from any two or more guide sequences shown in any of Tables 2A-2B. In some embodiments, the composition comprises at least two gRNAs, each of which comprises a guide sequence having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identity with any of the guide sequences shown in any of Tables 2A-2B.

[0493] In some embodiments, the guide RNA compositions of this disclosure are designed to recognize (e.g., hybridize to) a target sequence. For example, the target sequence can be recognized and cleaved by a Cas lysin containing the guide RNA. In some embodiments, an RNA-guided DNA binder (such as a Cas lysin) can be directed by the guide RNA to the target sequence, wherein the guide sequence of the guide RNA hybridizes with the target sequence and the RNA-guided DNA binder (such as a Cas lysin) cleaves the target sequence.

[0494] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the target gene. In some embodiments, compositions containing one or more guide sequences contain guide sequences complementary to the corresponding genomic regions shown in Tables 2A-2B, based on coordinates from the human reference genome hg38. In other embodiments, the guide sequence may be complementary to a sequence within the target gene closely adjacent to the genomic coordinates listed in Tables 2A-2B. For example, in other embodiments, the guide sequence may be complementary to a sequence containing 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Tables 2A-2B. Without being bound by any particular theory, modifications in certain regions of the target gene (e.g., frameshift mutations caused by insertions / deletions, occurring as a result of nuclease-mediated DSBs) may be less permissible than mutations in other regions; therefore, the location of the DSB is an important factor in the amount or type of protein knockdown that may result. In some embodiments, a gRNA complementary to or having complementary properties to the target sequence within the target gene is used to direct an RNA-guided DNA binder to a specific location within the target gene.

[0495] In some embodiments, the guide sequence has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identity with the target sequence present in the target gene. In some embodiments, the guide sequence has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identity with the target sequence present in the human target gene.

[0496] In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, wherein the total length of the guide sequence is 20 nucleotides. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches, wherein the guide sequence is 20 nucleotides long.

[0497] VII. RNA-guided DNA binders In some embodiments, the compositions or formulations disclosed herein comprise mRNA containing an open reading frame (ORF) encoding an RNA-guided DNA binder, such as the Cas nuclease described herein. In some embodiments, mRNA comprising an ORF encoding an RNA-guided DNA binder (such as a Cas nuclease) is provided, used, or administered.

[0498] In some embodiments, the composition further comprises an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0499] In some implementations, the nucleic acid encoding an RNA-guided DNA binder comprises mRNA containing an open reading frame (ORF) encoding an RNA-guided DNA binder.

[0500] In some implementations, the RNA-guided DNA binder is a nuclease.

[0501] In some implementations, the RNA-guided DNA binder is the Cas9 nuclease.

[0502] In some implementations, Cas9 is Streptococcus pyogenes Cas9.

[0503] In some embodiments, *Streptococcus pyogenes* Cas9 comprises an amino acid sequence having at least 90% identity with a sequence selected from SEQ ID NO: 853-857, or an ORF encoding *Streptococcus pyogenes* Cas9 having at least 90% identity with a sequence selected from SEQ ID NO: 853-857. In some embodiments, *Streptococcus pyogenes* Cas9 comprises an amino acid sequence having at least 90% identity with a sequence selected from SEQ ID NO: 853, or an ORF encoding *Streptococcus pyogenes* Cas9 having at least 90% identity with a sequence selected from SEQ ID NO: 853.

[0504] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity with SEQ ID NO: 813, 814, 816-819. In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity with SEQ ID NO: 813.

[0505] In some implementations, Cas9 is Nme Cas9.

[0506] In some embodiments, Nme Cas9 comprises an amino acid sequence having at least 90% identity with the sequence selected from SEQ ID NO: 832-834, or an ORF encoding Nme Cas9 having at least 90% identity with the sequence selected from SEQ ID NO: 832-834. In some embodiments, Nme Cas9 comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 832, or an ORF encoding Nme Cas9 having at least 90% identity with SEQ ID NO: 832.

[0507] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity with the sequence selected from SEQ ID NO: 802-810. In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity with SEQ ID NO: 802.

[0508] In some implementations, the nuclease has double-stranded endonuclease activity.

[0509] In some implementations, the nuclease has nicking enzyme activity.

[0510] In some implementations, the nuclease is non-catalytically active.

[0511] In some implementations, nucleases also include heterologous functional domains.

[0512] In some implementations, the nuclease is a nicking enzyme and the heterologous functional domain is a deaminase.

[0513] In some implementations, the deaminase is cytidine deaminase or adenine deaminase.

[0514] In some implementations, the deaminase is cytidine deaminase.

[0515] In some implementations, the deaminase is an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.

[0516] In some embodiments, the nuclease and deaminase comprise an amino acid sequence having at least 90% identity with the sequence of SEQ ID NO: 831, 835-838, 851, 852 or 858, or an ORF encoding an amino acid sequence having at least 90% identity with the sequence of SEQ ID NO: 831, 835-838, 851, 852 or 858.

[0517] In some implementations, the ORF encoding the amino acid sequence has at least 85% identity with SEQ ID NO: 801, 804, 811, 812 or 815.

[0518] In some embodiments, the compositions described herein further comprise a uracil glycosidase inhibitor (UGI) or a nucleic acid encoding a UGI, wherein the nuclease polypeptide does not contain a UGI, or the nucleic acid encoding the polypeptide does not encode a UGI.

[0519] In some embodiments, the UGI comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 859 or 860, or an ORF encoding an amino acid sequence having at least 90% identity with SEQ ID NO: 859 or 860.

[0520] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity with the sequence selected from SEQ ID NO: 723-726, or optionally SEQ ID NO: 823.

[0521] In some implementations, the ORF is a modified ORF.

[0522] The RNA-guided DNA binders described in this article cover Spy Cas9 and its modified forms and variants.

[0523] The RNA-guided DNA binders described herein cover Neisseria meningitidis Cas9 (NmeCas9) and its modified forms and variants. In some embodiments, NmeCas9 is Nme2 Cas9. In some embodiments, NmeCas9 is Nme1 Cas9. In some embodiments, NmeCas9 is Nme3 Cas9.

[0524] Modifications having an inactive catalytic domain (RuvC or HNH) are called "nicking enzymes." Nicking enzymes cleave only one strand of the target DNA, resulting in a single-strand break. A single-strand break can also be referred to as a "nick." In some embodiments, the compositions and methods comprise a nicking enzyme. In some embodiments, the compositions and methods comprise a nicking enzyme RNA-guided DNA binder, such as a nicking enzyme Cas, for example, nicking enzyme Cas9, which induces a nick rather than a double-strand break in the target DNA.

[0525] In some implementations, the NmeCas9 nuclease can be modified to contain only one functional nuclease domain. For example, the RNA-guided DNA binder can be modified to mutate or completely or partially delete one of the nuclease domains, thereby reducing its nucleic acid cleavage activity.

[0526] In some embodiments, an NmeCas9 nickase with a reduced-activity RuvC domain is used. In some embodiments, an NmeCas9 nickase with an inactive RuvC domain is used. In some embodiments, an NmeCas9 nickase with a reduced-activity HNH domain is used. In some embodiments, an NmeCas9 nickase with an inactive HNH domain is used.

[0527] In some implementations, the nuclease is modified to induce point mutations or base changes, for example, via deamination.

[0528] In some embodiments, the Cas protein comprises a fusion protein containing a Cas nuclease (e.g., NmeCas9) linked to a heterologous functional domain, which is either a nicking enzyme or non-catalytically active. In some embodiments, the Cas protein comprises a fusion protein containing a non-catalytically active Cas nuclease (e.g., NmeCas9) linked to a heterologous functional domain (see, for example, WO2014152432). In some embodiments, the non-catalytically active Cas9 is derived from Neisseria meningitidis Cas9. In some embodiments, the non-catalytically active Cas contains a mutation that deactivates Cas.

[0529] In some implementations, the heterologous functional domain is a domain that modifies gene expression, histones, or DNA. In some implementations, the heterologous functional domain is a transcriptional activation domain or a transcriptional repression domain. In some implementations, the nuclease is a non-catalytically active Cas nuclease, such as dCas9.

[0530] In some embodiments, the heterologous functional domain is a deaminase, such as cytidine deaminase or adenine deaminase. In some embodiments, the heterologous functional domain is a C-to-T base transition enzyme (cytidine deaminase), such as apolipoprotein B mRNA editing enzyme (APOBEC) deaminase. The heterologous functional domain (such as a deaminase) may be part of a fusion protein with a Cas nuclease having nicking enzyme activity or a non-catalytically active Cas nuclease discussed further below.

[0531] The RNA-guided DNA binders disclosed herein may also include base editing domains, such as deaminase domains, which introduce specific modifications into target nucleic acids.

[0532] In some embodiments, a nucleic acid is provided that includes an open reading frame encoding a polypeptide, the polypeptide including a cytidine deaminase (e.g., A3A), a C-terminal NmeCas9 nickase, and a first nuclear localization signal (NLS), wherein the polypeptide does not contain a uracil glycosidase inhibitor (UGI).

[0533] In some embodiments, the second NLS is located at the N-terminus of the NmeCas9 nickase. In some embodiments, the deaminase is located at the N-terminus of the NLS (i.e., the first or second NLS). In some embodiments, the deaminase is located at the N-terminus of all NLS in the polypeptide. In some embodiments, the deaminase is located at the N-terminus of all NLS in the polypeptide, wherein the polypeptide does not contain a uracil glycosidase inhibitor (UGI).

[0534] In some embodiments, the polynucleotide is DNA or RNA. In some embodiments, the polynucleotide is mRNA. In some embodiments, a polypeptide encoded by mRNA is provided.

[0535] In some implementations, the peptide containing A3A and RNA-guided nickase does not contain a uracil glycosidase inhibitor (UGI).

[0536] In some embodiments, a composition is provided comprising a first polypeptide or mRNA encoding the first polypeptide, the first polypeptide comprising a cytidine deaminase, optionally APOBEC3A deaminase (A3A); a C-terminal NmeCas9 nickase; a first nuclear localization signal (NLS); and optionally a second NLS; wherein the first NLS and the second NLS (when present) are located at the N-terminus of the sequence encoding the NmeCas9 nickase, wherein the first polypeptide does not contain a uracil glycosidase inhibitor (UGI); and a second polypeptide or mRNA encoding the second polypeptide, the second polypeptide comprising a uracil glycosidase inhibitor (UGI), wherein the second polypeptide is different from the first polypeptide.

[0537] In some embodiments, a method for modifying a target gene is provided, the method comprising administering the composition described herein. In some embodiments, the method comprises delivering to a cell a first nucleic acid comprising a first open reading frame encoding a first polypeptide, the first polypeptide comprising a cytidine deaminase, optionally APOBEC3A deaminase (A3A); a C-terminal NmeCas9 nickase; a first nuclear localization signal (NLS); and optionally a second NLS; wherein the first NLS and the second NLS (when present) are located at the N-terminus of a sequence encoding the NmeCas9 nickase, wherein the first polypeptide does not contain a uracil glycosidase inhibitor (UGI), and a second nucleic acid comprising a second open reading frame encoding a uracil glycosidase inhibitor (UGI), wherein the second nucleic acid is different from the first nucleic acid.

[0538] In some embodiments, the method includes delivering a polypeptide or a nucleic acid encoding the polypeptide to a cell, the polypeptide comprising a deaminase, optionally APOBEC3A deaminase (A3A); a C-terminal NmeCas9 nickase; a first nuclear localization signal (NLS); and a second NLS; wherein the first NLS and the second NLS are located at the N-terminus of the sequence encoding the NmeCas9 nickase, wherein the first polypeptide does not contain a uracil glycosidase inhibitor (UGI), and delivering a uracil glycosidase inhibitor (UGI) or a nucleic acid encoding the UGI to the cell.

[0539] In some embodiments, the molar ratio of the mRNA encoding UGI to the mRNA encoding APOBEC3A deaminase (A3A) and the RNA-guided nickase is about 1:35 to about 30:1. In some embodiments, the molar ratio of the mRNA encoding UGI to the mRNA encoding APOBEC3A deaminase (A3A) and the RNA-guided nickase is not about 1:1.

[0540] Similarly, in some implementations, if the protein is delivered, the molar ratio of the mRNA encoding the UGI protein discussed above to the mRNA encoding the APOBEC3A deaminase (A3A) and the RNA-guided nickase is similar.

[0541] In some embodiments, the compositions described herein further comprise at least one gRNA. In some embodiments, the compositions described herein further comprise two gRNAs. In some embodiments, a composition is provided comprising the mRNA described herein and at least one gRNA (e.g., two gRNAs). In some embodiments, the gRNA is a single-guide RNA (sgRNA). In some embodiments, the gRNA is a dual-guide RNA (dgRNA).

[0542] In some embodiments, the composition enables genome editing after administration to a subject.

[0543] Cytidine deaminase; APOBEC3A deaminase Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and particularly enzymes of the APOBEC family (enzymes of the APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (see, for example, Conticello et al., Mol. Biol. Evol. 22:367-77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274:18470-6, 1999; and Carrington et al., Cells 9:1690 (2020)).

[0544] In some embodiments, the cytidine deaminases disclosed herein are enzymes of the APOBEC family. In some embodiments, the cytidine deaminases disclosed herein are enzymes of the APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups. In some embodiments, the cytidine deaminases disclosed herein are enzymes of the APOBEC3 subgroup. In some embodiments, the cytidine deaminases disclosed herein are APOBEC3A deaminases (A3A). In some embodiments, the deaminase comprises APOBEC3A deaminase.

[0545] In some embodiments, the APOBEC3A deaminase (A3A) disclosed herein is human A3A. In some embodiments, the A3A is wild-type A3A.

[0546] In some embodiments, A3A is an A3A variant. The A3A variant shares homology with wild-type A3A or fragments thereof. In some embodiments, the A3A variant has at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity with wild-type A3A. In some implementations, the A3A variants may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid variations compared to the wild-type A3A. In some implementations, the A3A variant comprises a fragment of A3A such that the fragment has at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity with the corresponding fragment of wild-type A3A.

[0547] In some embodiments, the A3A variant is a protein having a sequence that differs from the wild-type A3A protein due to one or more mutations (such as substitution, deletion, insertion, or one or more single-point substitutions). In some embodiments, a shortened A3A sequence may be used, for example, by deleting the N-terminus, C-terminus, or internal amino acids. In some embodiments, a shortened A3A sequence is used, wherein one to four amino acids are deleted at the C-terminus of the sequence. In some embodiments, APOBEC3A (such as human APOBEC3A) has wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, APOBEC3A (such as human APOBEC3A) has asparagine at amino acid position 57 (as numbered in the wild-type sequence).

[0548] In some implementations, wild-type A3A is human A3A (UniPROT accession ID: p31941, SEQ ID NO: 850).

[0549] In some embodiments, the A3A disclosed herein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 850. In some embodiments, the identity level is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, A3A comprises an amino acid sequence having at least 87% identity with SEQ ID NO: 850. In some embodiments, A3A comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 850. In some embodiments, A3A comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 850. In some embodiments, A3A comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 850. In some embodiments, A3A comprises an amino acid sequence having at least 99% identity with A3A ID NO: 850. In some embodiments, A3A comprises the amino acid sequence of SEQ ID NO: 850.

[0550] In some embodiments, the cytidine deaminase disclosed herein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 850.

[0551] In some embodiments, any of the aforementioned levels of identity is at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the UGI comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises an amino acid sequence having at least 99% identity with SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises the amino acid sequence of SEQ ID NO: 859 or 860.

[0552] connector In some embodiments, the polypeptide comprising a deaminase and an RNA-guided nickase described herein further comprises a linker connecting the deaminase and the RNA-guided nickase. In some embodiments, the linker is a peptide linker. In some embodiments, the nucleic acid encoding the polypeptide comprising the deaminase and the RNA-guided nickase further comprises a sequence encoding the peptide linker. In some embodiments, mRNA encoding a deaminase-linker-RNA-guided nickase fusion protein is provided.

[0553] In some embodiments, the peptide linker is any amino acid segment having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50 or more amino acids.

[0554] In some embodiments, the peptide linker is a 16-residue “XTEN” linker or a variant thereof (see, for example, examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequences SGSETPGTSESATPES (SEQ ID NO: 901), SGSETPGTSESA (SEQ ID NO: 902), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 903).

[0555] In some embodiments, the peptide linker comprises (GGGGS)n (SEQ ID NO: 931), (G)n, (EAAAK)n (SEQ ID NO: 932), (GGS)n, SGSETPGTSESATPES (SEQ ID NO: 901) motif (see, for example, Guilinger JP, Thompson DB, Liu D R. Fusion of catalytically inactive Cas9to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 2014; 32(6): 577-82; the entire contents are incorporated herein by reference) or (XP)n motif, or a combination of any of these sequences, wherein n is independently an integer between 1 and 30. See WO2015089406, for example, paragraph

[0012] , the entire contents of which are incorporated herein by reference.

[0556] In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NO: 901-991.

[0557] VIII. Modified gRNA and mRNA In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or "chemically modified" gRNA to describe the presence of one or more non-natural or naturally occurring components or conformations used in place of or with the addition of canonical A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized using non-canonical nucleosides or nucleotides (referred to herein as "modified"). Modified nucleosides and nucleotides may include one or more of the following: (i) altering (e.g., replacing) one or two non-linked phosphate oxygens or one or more linked phosphate oxygens in the phosphodiester backbone (exemplary backbone modification); (ii) altering (e.g., replacing) a component of the ribose (e.g., the 2' hydroxyl group on the ribose) (exemplary sugar modification); (iii) modifying or replacing a naturally occurring nucleobase, including using a non-canonical nucleobase (exemplary base modification); and (iv) modifying the 3' or 5' end of an oligonucleotide to provide exonuclease stability, for example, by modifying the ribose with a 2' O-me, 2' halide, or 2' deoxy-substituted ribose; or a reverse base-free nucleotide, or by replacing the phosphodiester with a thiophosphate.

[0558] Chemical modifications (such as those listed above) can be combined to provide modified gRNA or mRNA containing two, three, four, or more modified nucleosides and nucleotides (collectively, “residues”). For example, the modified residues may have modified sugars and modified nucleobases. In some embodiments, up to 15% of the phosphate groups of the gRNA molecule are replaced by thiophosphate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3' end of the RNA.

[0559] In some embodiments, the gRNA contains one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of the modified gRNA is a modified nucleoside or nucleotide. In some embodiments, at least 5% of the modified guide RNA is a modified nucleotide or nucleoside. In some embodiments, at least 10% of the modified guide RNA is a modified nucleotide or nucleoside. In some embodiments, at least 15% of the modified gRNA is a modified nucleotide or nucleoside. In some embodiments, preferably at least 20% of the modified gRNA is a modified nucleotide or nucleoside. In some embodiments, no more than 65% of the modified gRNA is a modified nucleotide. In some embodiments, no more than 55% of the modified gRNA is a modified nucleotide. In some embodiments, no more than 50% of the modified gRNA is a modified nucleotide. In some embodiments, 10-70% of the modified gRNA is a modified nucleotide. In some embodiments, 20-70% of the modified gRNA consists of modified nucleotides. In some embodiments, 20-50% of the modified gRNA consists of modified nucleotides, and the nuclease is Spy Cas9. In some embodiments, 30-70% of the modified gRNA consists of modified nucleotides, and the nuclease is Nme Cas9.

[0560] Unmodified nucleic acids may be readily degraded by, for example, intracellular nucleases or those found in serum. For instance, nucleases can hydrolyze the phosphodiester bonds of nucleic acids. Therefore, in one aspect, the gRNAs described herein may contain one or more modified nucleosides or nucleotides, for example, to introduce stability against intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit a reduced innate immune response when introduced into cell populations in vivo and in vitro. The term "innate immune response" includes cellular responses to exogenous nucleic acids (including single-stranded nucleic acids) involving the induction of cytokine expression and release (especially interferon) and cell death.

[0561] In some embodiments of main-chain modification, the phosphate ester groups of the modified residues can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, the modified residues (e.g., modified residues present in modified nucleic acids) can include replacing unmodified phosphate ester moieties with modified phosphate ester groups as described herein. In some embodiments, main-chain modification of the phosphate ester backbone can include alterations that produce uncharged linkers or charged linkers with asymmetric charge distributions.

[0562] Examples of modified phosphate groups include thiophosphates, boron phosphates, methylphosphonates, aminophosphates, dithiophosphates, alkyl or aryl phosphonates, and phosphate triesters. The phosphorus atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygen atoms with one of the aforementioned atoms or groups can make the phosphorus atom chiral. The stereoisomer source phosphorus atom can have an "R" configuration (here, Rp) or an "S" configuration (here, Sp). The backbone can also be modified by replacing bridging oxygens (i.e., linking the phosphate ester to the oxygen of the nucleoside) with nitrogen (bridging aminophosphates), sulfur (bridging thiophosphates), and carbon (bridging methylenephosphonates). Substitution can occur at any of the linked oxygens or at both linked oxygens.

[0563] In certain main-chain modifications, the phosphate ester group may be replaced by a phosphorus-free linking group (e.g., an amide bond). In some embodiments, the charged phosphate ester group may be replaced by a neutral portion. Examples of portions that can replace the phosphate ester group include, but are not limited to, methylphosphonates, carboxymethyl groups, carbamates, amides, and thioethers. Other examples of portions that can replace the phosphate ester group include, but are not limited to, ethylene oxide linkers, sulfonates, sulfonamides, thiomethyl acetals, methyl acetals, methyleneimino, methylenemethylimino, methylenehydrazine, methylenedimethylhydrazine, and methyleneoxymethylimino.

[0564] Nucleic acid-mimicking scaffolds can also be constructed, where phosphate linkers and ribose are replaced by nuclease-resistant nucleosides or nucleotide substitutes. Such modifications can include backbone and sugar modifications. In some embodiments, nucleobases can be tethered by alternative backbones. Examples may include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes.

[0565] Modified nucleosides and modified nucleotides can include one or more modifications to the glycosyl group, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) can be modified, for instance, by being replaced with many different "oxygen" or "deoxy" substituents. In some embodiments, modification of the 2' hydroxyl group can enhance the stability of the nucleic acid because the hydroxyl group can no longer be deprotonated to form a 2'-alkoxide ion.

[0566] Examples of 2' hydroxyl modification may include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH2CH2O). nCH2CH2OR, where R can be, for example, H or an optionally substituted alkyl group, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, the 2' hydroxyl modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl modification can be a 2'-fluorine modification, wherein the modification replaces the 2' hydroxyl group with a fluoride. In some embodiments, the 2' hydroxyl modification can include a "locked" nucleic acid (LNA), wherein the 2' hydroxyl group can be, for example, a C1-6 alkylene group or a C1-6 alkylene group. 1-6 A heteroalkyl bridge is attached to the 4' carbon of the same ribose, wherein exemplary bridges may include methylene, propylene, ether, or amino bridges; O-amino (wherein the amino group may be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2). n -Amino group (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl modification can include an "unlocked" nucleic acid (UNA) where the ribose ring lacks the C2'-C3' bond. In some embodiments, the 2' hydroxyl modification can include methoxyethyl (MOE), (OCH2CH2OCH3, for example, a PEG derivative). The 2' modification can include hydrogen (i.e., deoxyribose); a halogen (e.g., bromine, chlorine, fluorine, or iodine); an amino group (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH (CH2CH2NH). n CH2CH2-amino (wherein the amino group may be, for example, as described herein), -NHC(O)R (wherein R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl groups, which may optionally be substituted with amino groups, for example, as described herein.

[0567] Sugar modifications can include a glycosyl group, which may also contain one or more carbon atoms having a stereochemical configuration opposite to that of the corresponding carbon atom in ribose. Therefore, modified nucleic acids can include nucleotides containing, for example, arabinose as a sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can be further modified at one or more constitutive sugar atoms. Modified nucleic acids can also include one or more sugars in the L-form, such as L-nucleosides. As used herein, a single abasic sugar should not be construed as causing a break in the double strand.

[0568] In some embodiments, the 2' modification includes, for example, modifications including 2'-OMe, 2'-F, 2'-H, and optionally 2'-O-Me.

[0569] The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may include modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases may be modified or completely substituted to provide modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotide may be independently selected from purines, pyrimidines, purine analogs, and pyrimidine analogs. In some embodiments, the nucleobases may include, for example, naturally occurring and synthetic derivatives of the base.

[0570] In embodiments employing dual guide RNA, each of the crRNA and tracrRNA may contain modifications. Such modifications may be at one or both ends of the crRNA or tracrRNA. In embodiments containing sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or internal nucleotides may be modified, or the entire sgRNA may be chemically modified. Some embodiments include a 5' end modification. Some embodiments include a 3' end modification. Some embodiments include both 5' and 3' end modifications.

[0571] In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in US20170114334, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2017 / 136794, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the modification patterns disclosed in WO2018 / 107028, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2019 / 237069, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2021 / 119275, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2023081687A1, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2022261292, the contents of which are hereby incorporated by reference in their entirety.

[0572] The terms “mA”, “mC”, “mU”, or “mG” can be used to denote nucleotides modified with 2'-O-Me. The terms “fA”, “fC”, “fU”, or “fG” can be used to denote nucleotides substituted with 2'-F. “*” can be used to depict PS modifications.

[0573] The terms A*, C*, U*, or G* can be used to denote a nucleotide that is linked to the next (e.g., 3') nucleotide via a PS bond.

[0574] The terms “mA*”, “mC*”, “mU*”, or “mG*” can be used to denote a nucleotide that has been replaced by 2'-O-Me and linked to the next (e.g., 3') nucleotide via a PS bond.

[0575] Any of the modifications described below may be present in the gRNA and mRNA described herein.

[0576] In the case of chemically modified sequences, “A”, “C”, “G”, “N” and “U” represent RNA nucleotides, that is, nucleotides with a 2’-OH group that is linked to a phosphodiesterase bond with a 3’ nucleotide.

[0577] The terms “mA”, “mC”, “mU”, or “mG” are used to denote adenine, cytosine, uridine, or guanidine nucleotides that have been modified with 2'-O-Me, respectively.

[0578] The modification of 2'-O-methyl can be described as follows: Another chemical modification that has been shown to affect the sugar ring of nucleotides is halogen substitution. For example, 2'-fluorine (2'-F) substitution on the sugar ring of nucleotides can increase oligonucleotide binding affinity and nuclease stability.

[0579] In this application, the terms “fA”, “fC”, “fU”, or “fG” are used to denote nucleotides that have been substituted with 2'-F.

[0580] The substitution of 2'-F can be described as follows: A phosphate thioester (PS) bond, or phosphate group, refers to a non-bridging phosphate oxygen bond in a phosphate diester bond, such as a bond between nucleotide bases. When phosphate thioesters are used to produce oligonucleotides, the modified oligonucleotides can also be referred to as S-oligonucleotides.

[0581] The asterisk (*) is used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide linked to the next (e.g., 3') nucleotide via a PS bond.

[0582] In this application, the terms “mA*”, “mC*”, “mU*” or “mG*” are used to denote a nucleotide that has been replaced with 2'-O-Me and linked to the next (e.g., 3') nucleotide via a PS bond.

[0583] The diagram below illustrates how S-substitution into a non-bridging phosphate group produces a PS bond that replaces the phosphodiester bond: Abase-free nucleotides are nucleotides that lack a nitrogenous base. The image below depicts an oligonucleotide whose abase-free (also known as apurinol) site is missing a base. As used herein, the presence of a single abase-free site should not be considered a disruption of the duplex, such as the duplex formed between the guide sequence of a guide RNA and its target site in the genome: A reverse base is a base that has a bond that is the reverse of the normal 5' to 3' bond (i.e., a 5' to 5' bond or a 3' to 3' bond). Such reverse bases exist only as terminal nucleotides. In 3' to 5' chemical synthesis methods, the reverse base does not have a 5' hydroxyl group that can be used to grow the chain. For example: Abase-free nucleotides can be linked by reverse bonding. For example, an abase-free nucleotide can be linked to a terminal 5' nucleotide via a 5'-5' bond, or a base-free nucleotide can be linked to a terminal 3' nucleotide via a 3'-3' bond. The reverse abase-free nucleotide at the terminal 5' or 3' nucleotide can also be referred to as a reverse abase-free cap.

[0584] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' end and one or more of the last three, four, or five nucleotides at the 3' end are modified. In some embodiments, the modification is 2'-O-Me, 2'-F, a reverse abasic nucleotide, a PS bond, or other nucleotide modifications known in the art to increase stability or performance.

[0585] In some implementations, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked via phosphate thioester (PS) bonds.

[0586] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise nucleotides modified with 2'-O-methyl (2'-O-Me). In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise nucleotides modified with 2'-fluorine (2'-F). In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise inverted abase-free nucleotides.

[0587] In some implementations, the Spy guide RNA comprises a modified sgRNA. In some implementations, the sgRNA comprises the modification patterns shown in Table 4, such as mN*mN*mN*NNNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGGmU*mG*mC*mU (SEQ ID NO: 669); or mN*mN*mN*NNNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmGmCmAmCmGmAmGmUmGmGmCmCmGmAmGmUmGmGmCmGmGmUmGmGmCmU*mU*mU*mU (SEQ ID NO: 669). 658), wherein each A, C, G, U, and N is an RNA nucleotide, a 2'-OH, and a phosphodiester bond to a 3' nucleotide, m indicates a 2'-O-methyl (2'-O-Me) modified nucleotide, and * indicates a phosphate thioester bond between nucleotides, and wherein the entirety of N constitutes a guide sequence that directs the nuclease to a target sequence, such as a target sequence complementary to the guide sequence. In some embodiments, the guide sequence comprises the guide sequences shown in Tables 3A-3B.

[0588] In some embodiments, the Nme guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification patterns shown in Tables 7A-7B, for example... mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 731); or mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 732); Each of A, C, G, U, and N represents an RNA nucleotide, a 2'-OH group, and a phosphodiester bond to a 3' nucleotide; m indicates a 2'-O-methyl (2'-O-Me) modified nucleotide; and * indicates a phosphate thioester bond between nucleotides. The entirety of N constitutes a guide sequence that directs the nuclease to a target sequence in the target gene. In some embodiments, the guide sequence comprises the guide sequences shown in Tables 2A-2B.

[0589] As mentioned above, in some embodiments, the compositions or formulations disclosed herein comprise mRNA containing an open reading frame (ORF) encoding an RNA-guided DNA binder, such as a Cas nuclease, for example, the Cas9 nuclease described herein. In some embodiments, mRNA comprising an ORF encoding an RNA-guided DNA binder (such as a Cas nuclease, e.g., the Cas9 nuclease) is provided, used, or administered. In some embodiments, the ORF encoding an RNA-guided DNA nuclease is referred to as a “modified RNA-guided DNA binder ORF” or simply “modified ORF,” which is used as an abbreviation to indicate ORF modification.

[0590] In some embodiments, the mRNA or modified ORF may contain modified uridine at at least one, multiple, or all uridine positions. In some embodiments, the modified uridine is uridine modified at the 5' position, for example, by halogenation, methylation, or ethylation. In some embodiments, the modified uridine is pseudouridine modified at the 1' position, for example, by halogenation, methylation, or ethylation. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or combinations thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methyl-pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0591] In some embodiments, the mRNA disclosed herein includes a 5' cap, such as Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below for example with regard to ARCA), which is linked via a 5'-triphosphate to the 5' position of the first nucleotide of the 5' to 3' strand of the mRNA, i.e., the first cap proximal nucleotide. In Cap0, the ribose of both the first and second cap proximal nucleotides of the mRNA contains a 2'-hydroxyl group. In Cap1, the ribose of the first and second transcription nucleotides of the mRNA contains a 2'-methoxy group and a 2'-hydroxyl group, respectively. In Cap2, the ribose of both the first and second cap proximal nucleotides of the mRNA contains a 2'-methoxy group. See, for example, Katibah et al. (2014). Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs (including mammalian mRNAs, such as human mRNAs) contain Cap1 or Cap2. Cap0 and other cap structures different from Cap1 and Cap2 may be immunogenic in mammals (such as humans) because components of the innate immune system (such as IFIT-1 and IFIT-5) recognize them as “non-self,” potentially leading to elevated levels of cytokines, including type I interferon. Components of the innate immune system (such as IFIT-1 and IFIT-5) may also competitively bind to mRNAs with caps other than Cap1 or Cap2 with eIF4E, potentially inhibiting mRNA translation.

[0592] Caps can be co-transcribed. For example, ARCA (Anti-reverse cap analog; Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide, which can be incorporated into the transcript at the in vitro initiation site. ARCA produces a Cap0 cap, where the 2' position of the first cap proximal nucleotide is a hydroxyl group. See, for example, Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' capanalogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG", RNA 7: 1486-1495. The ARCA structure is shown below.

[0593] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies catalog number N-7133) can be used to co-transcribe the Cap1 structure. The 3'-O-methylated forms of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies catalog numbers N-7413 and N-7433, respectively, or CleanCap™ AU is available from TriLink Biotechnologies catalog number N-7114. The CleanCap™ AG structure is shown below.

[0594] Alternatively, the cap can be added to the RNA post-transcriptionally. For example, vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S) and possesses RNA triphosphatase and guanylate transferase activities provided by its D1 subunit and guanine methyltransferase activities provided by its D12 subunit. Therefore, it can add 7-methylguanine to RNA in the presence of S-adenosylmethionine and GTP to obtain Cap0. See, for example, Guo, P. and Moss, B. (1990). Proc. Natl. Acad. Sci . USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem 269, 24472-24479.

[0595] In some embodiments, the mRNA further comprises a polyadenylated (polyA) tail. In some embodiments, the polyA tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenine nucleotides, optionally up to 300 adenine nucleotides. In some embodiments, the polyA tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. In some embodiments, the polyA tail comprises non-adenine nucleotides, i.e., it is a discontinuous polyA tail. In some embodiments, the polyA tail is discontinuous by non-adenine nucleotides at approximately every 40, 50, 60, 70, 80, or 90 nucleotides. In some embodiments, the polyA tail is discontinuous by non-adenine nucleotides at approximately every 50 nucleotides.

[0596] IX. Ribonuclear protein complex In some embodiments, a composition is included comprising one or more sgRNAs, said sgRNAs comprising one or more guide sequences from Table 2A or Table 3A or one or more sgRNAs from Table 2B or Table 3B, and an RNA-guided DNA binder, such as a nuclease, like a Cas nuclease, such as Cas9. In some embodiments, the RNA-guided DNA binder has lysinic activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binder comprises a Cas nuclease. Examples of Cas9 nucleases include those nucleases of the type II CRISPR system of Streptococcus pyogenes, Neisseria meningitidis, and other prokaryotes as known in the art, and their modified (e.g., engineered or mutant) forms.

[0597] In some embodiments, the Cas nuclease is a Cas9 nuclease derived from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease derived from Neisseria meningitidis.

[0598] In some embodiments, the gRNA, together with the RNA-guided DNA binder, is referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA binder is a Cas nuclease. In some embodiments, the gRNA, together with the Cas nuclease, is referred to as a Cas RNP. In some embodiments, the RNP contains type I, type II, or type III components. In some embodiments, the Cas nuclease is the Cas9 protein from the type II CRISPR / Cas system. In some embodiments, the gRNA, together with Cas9, is referred to as a Cas9 RNP.

[0599] Wild-type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target DNA strand. In some embodiments, the Cas9 protein contains more than one RuvC domain or more than one HNH domain. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the compositions, uses, and methods embodiments, Cas induces double-strand breaks in the target DNA.

[0600] In some embodiments, a chimeric Cas nuclease is used, wherein a domain or region of a protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced by a domain from a different nuclease (such as Fok1). In some embodiments, the Cas nuclease may be a modified nuclease.

[0601] In other embodiments, the Cas nuclease may be derived from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be the Cas3 protein. In some embodiments, the Cas nuclease may be derived from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0602] In some embodiments, the RNA-guided DNA binder has single-strand nicking enzyme activity, i.e., it can cleave one strand of DNA to produce a single-strand break, also known as a "nick". In some embodiments, the RNA-guided DNA binder comprises a Cas nicking enzyme. A nicking enzyme is an enzyme that creates a nick in dsDNA, i.e., it cuts one strand of the DNA double helix but not the other. In some embodiments, the Cas nicking enzyme is of the type of Cas nuclease (e.g., the Cas nuclease discussed above) in which the endonuclease active site is inactivated, for example by alteration of one or more catalytic domains (e.g., point mutation). See, for example, U.S. Patent No. 8,889,356, for example, the discussion of Cas nicking enzymes and exemplary catalytic domain alterations. In some embodiments, the Cas nicking enzyme (such as the Cas9 nicking enzyme) has an inactive RuvC or HNH domain.

[0603] In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain. For example, a modifiable protein can be used to mutate or completely or partially delete one of the nuclease domains to reduce its nucleic acid cleavage activity. In some embodiments, a nickase with a reduced-activity RuvC domain is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with a reduced-activity HNH domain is used. In some embodiments, a nickase with an inactive HNH domain is used.

[0604] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may contain amino acid substitutions in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the Streptococcus pyogenes Cas9 protein). See, for example, Zetsche et al. (2015). CellOctober 22:163(3): 759-771. In some embodiments, the Cas nuclease may contain amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the Streptococcus pyogenes Cas9 protein). See, for example, Zetsche et al. (2015).

[0605] In some embodiments, the polypeptide comprises, from the N-terminus to the C-terminus, an optional NLS, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase having amino acid substitutions in the HNH or HNH-like nuclease domain, such as the D16A NmeCas9 nickase. In some embodiments, the polypeptide comprises, from the N-terminus to the C-terminus, an optional NLS, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase having amino acid substitutions in the HNH or HNH-like nuclease domain, such as the D16A Nme2Cas9 nickase. In some embodiments, the polypeptide comprises, from the N-terminus to the C-terminus, first and second NLS, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase having amino acid substitutions in the HNH or HNH-like nuclease domain, such as the D16A NmeCas9 nickase. In some embodiments, the polypeptide comprises, from the N-terminus to the C-terminus, a first and a second NLS, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase having amino acid substitutions in the HNH or HNH-like nuclease domain, such as the D16A Nme2Cas9 nickase. In some embodiments, the polypeptide comprises, from the N-terminus to the C-terminus, a first NLS, a cytidine deaminase (e.g., APOBEC3A), a second NLS, an optional linker, and an Nme Cas9 nickase having amino acid substitutions in the HNH or HNH-like nuclease domain, such as the D16A Nme2Cas9 nickase. In some embodiments, the polypeptide comprises, from the N-terminus to the C-terminus, a first NLS, a cytidine deaminase (e.g., APOBEC3A), a second NLS, an optional linker, and an Nme Cas9 nickase having amino acid substitutions in the HNH or HNH-like nuclease domain, such as the D16A Nme2Cas9 nickase.

[0606] In some embodiments, the mRNA encoding the nicking enzyme is provided in combination with a pair of guide RNAs complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nicking enzyme to the target sequence and introduce the DSB by creating a nick on the opposite strand of the target sequence (i.e., a double nick). In some embodiments, using a double nick can improve specificity and reduce off-target effects. In some embodiments, the nicking enzyme is used with two separate guide RNAs targeting opposite DNA strands to create a double nick in the target DNA. In some embodiments, the nicking enzyme is used with two separate guide RNAs selected to be very close to each other to create a double nick in the target DNA.

[0607] In some embodiments, the RNA-guided DNA binder lacks lyase and nicking enzyme activity. In some embodiments, the RNA-guided DNA binder comprises a dCas DNA-binding polypeptide. The dCas polypeptide has DNA-binding activity but is substantially lacking in catalytic (lyase / nicking enzyme) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA binder or dCas DNA-binding polypeptide lacking lyase and nicking enzyme activity is a type of Cas nuclease (e.g., the Cas nucleases discussed above) in which its endonuclease active site is inactivated, for example by one or more alterations (e.g., point mutations) in its catalytic domain. See, for example, US 20140186958; US 20150166980; and US 20190338308.

[0608] In some implementations, the RNA-guided DNA binder contains one or more heterologous functional domains (e.g., is or contains a fusion polypeptide).

[0609] In some embodiments, the heterologous functional domain facilitates the transport of the RNA-guided DNA binder to the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binder can be fused with 1-5 NLSs. In some embodiments, the RNA-guided DNA binder can be fused with 2, 3, or 4 NLSs. In some embodiments, the RNA-guided DNA binder can be fused with two NLSs. In some embodiments, the RNA-guided DNA binder can be fused with one NLS. When using one NLS, the NLS can be attached to the N-terminus or C-terminus of the RNA-guided DNA binder sequence. In some embodiments, the NLS is not attached to the C-terminus. The NLS can also be inserted within the RNA-guided DNA binder sequence. In some cases, at least two NLSs are identical (e.g., two SV40 NLSs). In some embodiments, the RNA-guided DNA binder contains at least two different NLSs. In some embodiments, the RNA-guided DNA binder is fused with two SV40 NLS sequences attached to the carboxyl terminus. In some embodiments, the RNA-guided DNA binder may fuse with two NLSs, one attached to the N-terminus and the other to the C-terminus. In some embodiments, the RNA-guided DNA binder may fuse with three NLSs. In some embodiments, the RNA-guided DNA binder may not fuse with any NLSs.

[0610] In some embodiments, the NLS may be an SV40 NLS. Exemplary SV40 NLS sequences may be SV40 NLS, PKKKRKV (SEQ ID NO: 916), or PKKKRRV (SEQ ID NO: 928). In some embodiments, the NLS may be a dichotomous sequence, such as the NLS of a nucleoplasmic protein, KRPAATKKAGQAKKKK (SEQ ID NO: 929). In some implementations, the NLS sequence may include LAAKRSRTT (SEQ ID NO: 917), QAAKRSRTT (SEQ ID NO: 918), PAPAKRERTT (SEQ ID NO: 919), QAAKRPRTT (SEQ ID NO: 920), RAAKRPRTT (SEQ ID NO: 921), AAAKRSWSMAA (SEQ ID NO: 922), AAAKRVWSMAF (SEQ ID NO: 923), AAAKRSWSMAF (SEQ ID NO: 924), AAAKRKYFAA (SEQ ID NO: 925), RAAKRKAFAA (SEQ ID NO: 926), or RAAKRKYFAV (SEQ ID NO: 927). The NLS may be a snurportin-1 infeedin-β (IBB domain), such as the SPN1-impβ sequence. See Huber et al., 2002, J. Cell Bio., 156, 467-479. In one specific embodiment, a single PKKKRKV (SEQ ID NO: 916). In some embodiments, the first and second NLSs are independently selected from SV40 NLSs, nucleoplasmic protein NLSs, bipartite ...

Claims

1. An engineered cell, said engineered cell comprising gene modifications within genomic coordinates chr19:6586002-6591015.

2. An engineered cell having reduced or eliminated surface expression of CD70 protein relative to unmodified cells, and containing gene modifications within genomic coordinates chr19:6586002-6591015.

3. The engineered cell of claim 1 or 2, wherein the gene modification is within genomic coordinates targeted by a CD70 guide RNA, the guide RNA comprising a guide sequence of any one of SEQ ID NO: 1-38.

4. The engineered cell according to any one of claims 1-3, wherein the engineered cell has reduced or eliminated CD70 surface expression relative to unmodified cells, and comprises gene modifications within any of the genomic coordinates listed in Table 2A.

5. The engineered cell according to any one of claims 1-4, wherein the gene modification is within a genomic coordinate system selected from: chr19:6590121-6590145; chr19:6586002-6586026; chr19:6586003-6586027; chr19:6586013-6586037; chr19:6586357-65 86381;chr19:6586365-6586389;chr19:6586376-6586400;chr19:6590988-6591012;chr19:6590991-6591015;chr19:65908 62-6590886;chr19:6586396-6586420;chr19:6586372-6586396;chr19:6586371-6586395;chr19:6586360-6586384;chr19 :6586355-6586379;chr19:6586268-6586292;chr19:6586259-6586283;chr19:6586256-6586280;chr19:6586142-6586166; chr19:6586141-6586165; chr19:6586135-6586159; chr19:6586128-6586152; chr19:6586127-6586151; chr19:6586126-65 86150;chr19:6586121-6586145;chr19:6586120-6586144;chr19:6586096-6586120;chr19:6586055-6586079;chr19:65860 29-6586053;chr19:6586023-6586047;chr19:6586312-6586336;chr19:6586151-6586175;chr19:6586145-6586169;chr19: 6586100-6586124; chr19:6586030-6586054; chr19:6586028-6586052; chr19:6586395-6586419; and chr19:6586394-6586418.

6. The engineered cell according to any one of claims 1-5, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590121-6590145 and chr19:6586268-6586292.

7. The engineered cell of any one of claims 1-6, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of SEQ ID NO: 1 or 16.

8. The engineered cell of claim 1 or 2, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of any of SEQ ID NO: 101-169.

9. The engineered cell according to any one of claims 1, 2 and 8, wherein the engineered cell has reduced or eliminated CD70 surface expression relative to unmodified cells, and contains gene modifications within any of the genomic coordinates listed in Table 3A.

10. The engineered cell of any one of claims 1, 2, 8, and 9, wherein the gene modification is within a genomic coordinate system selected from: (a) chr19:6590998-6591018;chr19:6590995-6591015;chr19:6590992-6591012;chr19:6590991-6591011;chr19:6590987-659100 7;chr19:6590986-6591006;chr19:6590985-6591005;chr19:6590977-6590997;chr19:6590972-6590992;chr19:6590966-6590 986; chr19:6590958-6590978; chr19:6590957-6590977; chr19:6590945-6590965; chr19:6590944-6590964; chr19:6590940-65 90960;chr19:6590939-6590959;chr19:6590935-6590955;chr19:6590926-6590946;chr19:6590920-6590940;chr19:6590919- 6590939;chr19:6590914-6590934;chr19:6590908-6590928;chr19:6590907-6590927;chr19:6590899-6590919;chr19:659087 5-6590895;chr19:6590866-6590886;chr19:6590844-6590864;chr19:6590843-6590863;chr19:6586374-6586394;chr19:6586 368-6586388;chr19:6586288-6586308;chr19:6586285-6586305;chr19:6586276-6586296;chr19:6586267-6586287;chr19:65 (b) chr19:6590875-6590895;chr19:6590844-6590864;chr19:6590843-6590863; chr19:6590835-6590855;chr19:6590104-6590124;chr19:6590096-6590116;chr19:6590095-6590115;chr19:6590094-6590114;chr19:6590093-6590113;chr19:6590087-6590107; chr19:6590084-6590104;chr19:6590083-6590103;chr19:6590078-6590098;chr19:6586368-6586388; chr19:6586299-6586319;chr19:6586267-6586287;chr19:6590842-6590862;chr19:6590139-6590159; chr19:6590138-6590158;chr19:6590135-6590155;chr19:6590079-6590099;chr19:6590077-6590097;c hr19:6586412-6586432;chr19:6586404-6586424;chr19:6586403-6586423;chr19:6586396-6586416;c hr19:6586396-6586416;chr19:6586395-6586415;chr19:6586388-6586408;chr19:6586380-6586400;c hr19:6586379-6586399; chr19:6586375-6586395; chr19:6586369-6586389; chr19:6586367-6586387; chr19:6586360-6586380; chr19:6586359-6586379; chr19:6586120-6586140; and chr19:6586028-6586048.

11. The engineered cell of any one of claims 1, 2, and 8-10, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116, and 123.

12. The engineered cell according to any one of claims 1, 2, and 8-11, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590998-6591018; chr19:6590991-6591011; chr19:6590939-6590959; chr19:6590972-6590992; chr19:6590940-6590960; and chr19:6590907-6590927.

13. The engineered cell of any one of claims 1, 2, and 8-10, wherein the gene modification is within genomic coordinates targeted by a guide RNA, the guide RNA comprising a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164, and 168.

14. The engineered cell according to any one of claims 1, 2, 8-10 and 13, wherein the gene modification is within the genomic coordinates selected from the following: chr19:6590875-6590895; chr19:6586396-6586416; chr19:6586388-6586408; chr19:6586379-6586399; chr19:6586369-6586389; and chr19:6586120-6586140.

15. A composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises: a. A guide sequence selected from SEQ ID NO: 1-38; b. A guide sequence of at least 20, 21, 22, 23, 24 or 25 consecutive nucleotides selected from the sequence of SEQ ID NO: 1-38; c. A guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 1-38; d. A sequence containing 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2A; e. At least 20, 21, 22, 23, or 24 consecutive nucleotides from the sequence in (d); or f. A guide sequence that has at least 85%, 90%, or 95% identity with a sequence selected from (d).

16. A composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises: a. A guide sequence selected from SEQ ID NO: 101-169; b. A guide sequence of at least 17, 18, 19, or 20 consecutive nucleotides selected from the sequence of SEQ ID NO: 101-169; c. A guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 101-169; d. A sequence containing 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 3A; e. At least 17, 18, 19, or 20 consecutive nucleotides from the sequence in (d); or f. A guide sequence that has at least 85%, 90%, or 95% identity with a sequence selected from (d).

17. The composition of claim 15 or 16, wherein the composition is used to alter the DNA sequence within the CD70 gene in a cell.

18. A pharmaceutical composition comprising the composition of claim 15 or 16, or the use of the composition of claim 15 or 16 for inducing double-strand breaks or single-strand breaks in the CD70 gene in cells, altering the nucleic acid sequence of the CD70 gene in cells, or reducing the expression of the CD70 gene in cells.

19. A method of manufacturing engineered human cells having reduced or eliminated surface expression of CD70 protein relative to unmodified cells, the method comprising contacting the cells with a composition as described in claim 15 or 16.

20. A method for reducing the surface expression of CD70 protein in cells relative to unmodified cells, the method comprising contacting the cells with a composition comprising a guide RNA and optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, wherein the guide RNA comprises: a. A guide sequence selected from SEQ ID NO: 1-38; b. A guide sequence of at least 20, 21, 22, 23, 24 or 25 consecutive nucleotides selected from the sequence of SEQ ID NO: 1-38; c. A guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 1-38; d. A sequence containing 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2A; e. At least 20, 21, 22, 23, 24, or 25 consecutive nucleotides from the sequence in (d); or f. A guide sequence that has at least 85%, 90%, or 95% identity with a sequence selected from (d).

21. The composition, use, or method of any one of claims 15 and 17-20, wherein the guide RNA comprises the guide sequence of SEQ ID NO: 1 or 16.

22. A method for reducing the surface expression of CD70 protein in cells relative to unmodified cells, the method comprising contacting the cells with a composition comprising a guide RNA and optionally an RNA-guided DNA binder or an RNA-guided DNA binder, wherein the guide RNA comprises: a. A guide sequence selected from SEQ ID NO: 101-169; b. A guide sequence of at least 17, 18, 19, or 20 consecutive nucleotides selected from the sequence of SEQ ID NO: 101-169; c. A guide sequence having at least 85%, 90%, or 95% identity with a sequence selected from SEQ ID NO: 101-169; d. A sequence containing 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 3A; e. At least 17, 18, 19, or 20 consecutive nucleotides from the sequence in (d); or f. A guide sequence that has at least 85%, 90%, or 95% identity with a sequence selected from (d).

23. The composition, use, or method of any one of claims 16-19 and 22, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116, and 123.

24. The composition, use, or method according to any one of claims 15-23, wherein the RNA-guided DNA binder is a lysin.

25. The composition, use, or method of any one of claims 16-19, 22, and 24, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164, and 168.

26. The composition, use, or method of any one of claims 15-25, wherein the RNA-guided DNA binder is a base editor.

27. A cell population comprising engineered cells as claimed in any one of claims 1-14, or comprising engineered cells produced by using a composition as claimed in any one of claims 15-18, 21, and 23-26, or by a method as claimed in any one of claims 19-26.

28. A pharmaceutical composition comprising (a) engineered cells as described in any one of claims 1-14, or engineered cells produced by a composition or method as described in any one of claims 15-26; or (b) a cell population as described in claim 27.

29. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-28, wherein the gene modification comprises insertion, deletion, or substitution.

30. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-29, wherein the gene modification comprises insertion / deletion, C-to-T substitution, or A-to-G substitution within the genomic coordinates.

31. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-30, wherein the cells are engineered using a genome editing system.

32. The engineered cells, cell populations, pharmaceutical compositions or methods according to any one of claims 3-31, wherein the guide RNA is a dual guide RNA (dgRNA) or a single guide RNA (sgRNA).

33. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 32, wherein the sgRNA is Spy sgRNA.

34. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 33, wherein the SpysgRNA further comprises one or more of the following: A. A shortened section of the hairpin, or alternatively, a shortened section of the hairpin, wherein...

1. In hairpin 1, at least one of the following nucleotide pairs is replaced by a Watson-Crick pairing nucleotide: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region is optionally missing. a. Any one or both of H1-5 to H1-8 b. One, two, or all of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides in region 1 of the hairpin; or 2. The shortened hairpin region 1 lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. One or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601), or b. One or more of positions H1-6 to H1-10 are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO:601); or 3. The shortened hairpin region 1 is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or B. A shortened upper stem region, wherein the shortened upper stem region is missing 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region comprise fewer than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or C. Substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or D. An exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region.

35. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 34, wherein the guide RNA lacks 6 or 8 nucleotides in the shortened hairpin 1, and / or wherein H-1 and H-3 are missing, and / or wherein the guide RNA further comprises a 3' tail, wherein the 3' tail is 1-4 nucleotides in length, optionally 1 nucleotide in length, and / or wherein the guide RNA comprises an upper stem region, wherein the upper stem region comprises modifications of any one or more of US1-US12 in the upper stem region.

36. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 32 or 33, wherein the sgRNA comprises a nucleotide sequence selected from sequences in Tables 4A-5B, or wherein the guide RNA comprises a modified nucleotide sequence selected from modified Spy guide scaffold sequences in Table 5A, wherein the modified nucleotide sequence is at the 3' of the guide sequence, optionally wherein the guide RNA is modified according to a pattern of nucleotide sequences selected from modified Spy guide RNA sequences in Table 5B.

37. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 32 or 33, wherein the engineered cells, cell populations, pharmaceutical compositions, or methods comprise sequences or modification patterns selected from SEQ ID NO: 620, 630-641, and 658-669.

38. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 32, wherein the sgRNA is an Nme sgRNA comprising a guide region and a conserved region.

39. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 38, wherein the conserved region comprises one or more of the following: (a) A shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region is missing 2-24 nucleotides relative to SEQ ID NO: 700, wherein (i) One or more of nucleotides 37-48 and 53-64 are deleted relative to SEQ ID NO: 700, and optionally one or more of nucleotides 37-64 are substituted relative to SEQ ID NO: 700; and (ii) Nucleotide 36 is composed of at least two nucleotides linked to nucleotide 65; or (b) The shortened hairpin 1 region, wherein the shortened hairpin 1 is missing 2-10 nucleotides, optionally 2-8 nucleotides, relative to SEQ ID NO: 700, wherein (i) One or more of nucleotides 82-86 and 91-95 are deleted relative to SEQ ID NO: 700, and optionally one or more of positions 82-96 are substituted relative to SEQ ID NO: 700; and (ii) Nucleotide 81 is linked to nucleotide 96 by at least four nucleotides; or (c) The shortened hairpin 2 region, wherein the shortened hairpin 2 is missing 2-18 nucleotides, optionally 2-16 nucleotides, relative to SEQ ID NO: 700, wherein (i) One or more of nucleotides 113-121 and 126-134 are deleted relative to SEQ ID NO: 700, and optionally one or more of nucleotides 113-134 are substituted relative to SEQ ID NO: 700; and (ii) Nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; One or both of nucleotides 144-145 are optionally deleted relative to SEQ ID NO: 700; Optionally, at least 10 of the nucleotides are modified nucleotides.

40. The engineered cell, cell population, pharmaceutical composition, or method of claim 38 or 39, wherein the conserved region comprises a modified nucleotide sequence selected from the modified conserved region Nme guide RNA motifs in Table 6, and wherein the conserved region is located at the 3' of the guide region.

41. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 38-40, wherein the guide RNA comprises a nucleotide sequence selected from any one of SEQ ID NO: 700-706, 1018, 1019, and 720-732, or any other modified sequence shown in Tables 7A-7B, wherein N represents a guide sequence of any one of SEQ ID NO: 1-38.

42. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 41, wherein each nucleotide is any natural or non-natural nucleotide, and / or wherein the guide RNA is modified according to a pattern selected from SEQ ID NO: 720-732, wherein N is a guide sequence of any of SEQ ID NO: 1-38, N, A, C, G, and U are ribonucleotides (2'-OH), "m" indicates 2'-O-Me modification, "f" indicates 2'-fluorine modification, and "*" indicates phosphate thioester linkage between nucleotides.

43. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 3-42, wherein the guide RNA comprises at least one end modification, optionally wherein the modification comprises a 5' end modification and / or wherein the modification comprises a 3' end modification.

44. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 43, wherein the guide RNA comprises a modification in the hairpin region, optionally wherein the modification in the hairpin region is also an end modification.

45. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 43 or 44, wherein the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide, and / or wherein the modification comprises a phosphate thioester (PS) bond between nucleotides, and / or wherein the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide linked to a 3' adjacent nucleotide by a phosphate thioester (PS) bond, and / or wherein the modification comprises a 2'-fluorine (2'F) modified nucleotide, and / or wherein the 5' end modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide at nucleotides 1-3 at the 5' end of the guide sequence linked to a 3' adjacent nucleotide by a phosphate thioester (PS) bond.

46. ​​The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 3-45, wherein the guide RNA is associated with lipid nanoparticles (LNPs), optionally wherein the LNPs comprise cationic lipids, helper lipids, neutral lipids, stealth lipids, or a combination of two or more thereof.

47. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 46, wherein the cationic lipid is octadecano-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, also known as (9Z,12Z)-octadecano-9,12-dienoic acid 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, and / or wherein the accessory lipid is cholesterol, and / or wherein the neutral lipid is 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC), and / or wherein the occult lipid is 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol 2000. (PEG2k-DMG), and / or said LNP comprises octadecano-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octoxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, also known as (9Z,12Z)-octadecano-9,12-dienoic acid 3-((4,4-bis(octoxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, DSPC, cholesterol, and PEG2k-DMG.

48. A pharmaceutical composition comprising engineered cells as described in any one of claims 1-47.

49. A cell population comprising engineered cells as described in any one of claims 1-47.

50. A pharmaceutical composition comprising a cell population, wherein the cell population comprises a plurality of engineered cells as described in any one of claims 1-47, and optionally wherein the pharmaceutical composition further comprises a pharmaceutical excipient.

51. A method of administering engineered cells, cell populations, or pharmaceutical compositions as described in any one of claims 1-50 to a subject in need, wherein the engineered cells, cell populations, or pharmaceutical compositions are administered to the subject as adoptive cell transfer (ACT) therapy or as immunotherapy.

52. The engineered cells, cell populations, or pharmaceutical compositions according to any one of claims 1-50, wherein the engineered cells, cell populations, or pharmaceutical compositions are used as ACT therapy.

53. A method of treating a disease or condition, the method comprising administering to a subject in need engineered cells, cell populations or pharmaceutical compositions as described in any one of claims 1-50.

54. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-53, wherein the engineered cells have reduced surface expression of CD70 protein compared to unmodified cells.

55. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-54, wherein the cell comprises an exogenous nucleic acid encoding a target receptor expressed on the surface of the engineered cell, optionally wherein the target receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR).

56. The engineered cells, cell populations, pharmaceutical compositions, or cell methods of claim 55, wherein the targeted receptor is a WT1 TCR or an anti-CD70 CAR.

57. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-56, wherein the engineered cells further comprise a gene modification in the TGFBR2 gene, optionally wherein the gene modification in the TGFBR2 gene is located within genomic coordinates chr3:30674205-30674229, and optionally wherein the gene modification in the TGFBR2 gene comprises at least one nucleotide within genomic coordinates targeted by a TGFBR2 guide RNA, the guide RNA comprising the guide sequence of SEQ ID NO:

301.

58. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-57, wherein the engineered cells further comprise gene modifications of one or more of the CIITA, HLA-A, HLA-B, TRAC, or TGFBR2 genes, and / or wherein the engineered cells further have reduced surface expression of one or more of MHC class II, HLA-A, HLA-B, TRAC, or TGFBR2 compared to unmodified cells.

59. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 58, wherein the engineered cells comprise: i. Gene modifications within the genomic coordinates chr6:29942891-29942915 or chr6:29942609-29942633 of the HLA-A gene; ii. Gene modifications within the genomic coordinates chr6:31355222-31355246, chr6:31355221-31355245, or chr6:31355205-31355229 of the HLA-B gene; iii. Gene modifications within the genomic coordinates chr14:22547524-22547544, chr14:22550574-22550598, or chr14:22550544-22550568 of the TRAC gene; iv. Gene modifications within the genomic coordinates chr16:10906643-10906667 or chr16:10907504-10907528 of the CIITA gene; or v. A combination of two or more items from (i)-(iv).

60. The engineered cells, cell populations, pharmaceutical compositions, or methods of claim 58 or 59, wherein the engineered cells comprise at least one genetic modification, said genetic modification being: (i) within genomic coordinates targeted by an HLA-A guide RNA containing a guide sequence of SEQ ID NO: 403 or 404; (ii) within genomic coordinates targeted by an HLA-B guide RNA containing a guide sequence of SEQ ID NO: 406, 405, or 407; (iii) within genomic coordinates targeted by a TRAC guide RNA containing a guide sequence of SEQ ID NO: 413, 408, or 409; (iv) within genomic coordinates targeted by a CIITA guide RNA containing a guide sequence of SEQ ID NO: 402 or 401; or (v) a combination of two or more of (i)-(iv).

61. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-60, wherein the engineered cells comprise gene modifications within the genomic coordinates chr3:30674205-30674229 or chr3:30671941-30671961 of the TGFBR2 gene.

62. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-61, wherein the engineered cells comprise at least one gene modification within a genomic coordinate region targeted by a TGFBR2 guide RNA comprising a guide sequence comprising SEQ ID NO: 301 or 302.

63. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-62, wherein the engineered cells comprise gene modifications in the HLA-A gene, gene modifications in the HLA-B gene, gene modifications in the TRAC gene, and gene modifications in the CIITA gene.

64. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-63, wherein the engineered cells comprise gene modifications in the HLA-A gene, the HLA-B gene, the TRAC gene, the CIITA gene, and the TGFBR2 gene.

65. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-64, wherein the engineered cells comprise: i. Gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. Gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. Gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene; and iv. Gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene.

66. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-65, wherein the engineered cells comprise: i. Gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. Gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. Gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene; iv. Gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene; and v. Gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene.

67. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 58-66, wherein the engineered cells comprise: i. Gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene; ii. Gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene; iii. Gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene; iv. Gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene; v. Gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene; and vi. Gene modifications within the genomic coordinates chr19:6590121-6590145 of the CD70 gene.

68. An engineered human cell comprising gene modifications within the genomic coordinates chr6:29942891-29942915 of the HLA-A gene, gene modifications within the genomic coordinates chr6:31355222-31355246 of the HLA-B gene, gene modifications within the genomic coordinates chr16:10906643-10906667 of the CIITA gene, gene modifications within the genomic coordinates chr3:30674205-30674229 of the TGFBR2 gene, gene modifications within the genomic coordinates chr14:22547524-22547544 of the TRAC gene, and gene modifications within the genomic coordinates chr19:6590121-6590145 of the CD70 gene.

69. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-68, wherein the engineered cell is an immune cell, and optionally wherein the engineered cell is a lymphocyte.

70. The engineered cell, cell population, pharmaceutical composition, or method of claim 69, wherein the engineered cell is a T cell, optionally wherein the cell is a CD4+ T cell or a CD8+ T cell, and / or wherein the cell is a memory T cell, and / or wherein the cell is a stem cell memory T cell (Tscm).

71. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-70, wherein the cells are allogeneic cells.

72. The engineered cells, cell populations, pharmaceutical compositions, or methods according to any one of claims 1-71, wherein the engineered cells, cell populations, pharmaceutical compositions, or methods are administered to a subject as an adoptive cell transfer (ACT) therapy, for treating a subject with cancer, for treating a subject with an infectious disease, or for treating a subject with an autoimmune disease.

73. The cell population or pharmaceutical composition of any one of claims 27-72, wherein, as measured by flow cytometry, at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the cell population is CD70 negative.

74. The cell population or pharmaceutical composition of any one of claims 27-73, wherein, as measured by next-generation sequencing (NGS), at least 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cell population contains the genetic modification in the CD70 gene.

Images