Application of circVEGFC in treatment of rhabdomyosarcoma

By combining circVEGFC overexpression with mTOR inhibitors, the problems of poor treatment efficacy and systemic toxicity of rhabdomyosarcoma have been solved, achieving precise differentiation treatment and improved chemotherapy sensitivity for rhabdomyosarcoma.

CN121987656APending Publication Date: 2026-05-08BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
Filing Date
2026-03-18
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing gene therapy methods have limited efficacy in treating rhabdomyosarcoma and pose systemic toxicity risks, lacking precise and safe treatment options.

Method used

The circVEGFC sequence (SEQ ID NO:1) was overexpressed via vectors such as adenovirus vectors, and combined with mTOR pathway inhibitors such as everolimus for gene therapy. This allowed for local administration of the gene to rhabdomyosarcoma cells, thereby regulating the proliferation and differentiation of tumor cells.

Benefits of technology

It significantly inhibits the proliferation of rhabdomyosarcoma cells, promotes tumor differentiation, improves chemosensitivity, reduces systemic toxicity, and provides a precise and safe treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121987656A_ABST
    Figure CN121987656A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and relates to application of circVEGFC in treatment of rhabdomyosarcoma, in particular to application of circVEGFC in preparation of medicine for treating rhabdomyosarcoma, and the sequence of circVEGFC is SEQ ID NO: 1. By promoting expression of circVEGFC, proliferation and migration of rhabdomyosarcoma cells are remarkably inhibited, and rhabdomyosarcoma differentiation is promoted. In addition, the circVEGFC is combined with an mTOR pathway inhibitor, such as a rapamycin drug, so that tumor proliferation can be synergistically inhibited.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the use of circVEGFC in the treatment of rhabdomyosarcoma, specifically the use of circVEGFC in the preparation of drugs for treating rhabdomyosarcoma. Background Technology

[0002] Rhabdomyosarcoma (RMS) is one of the most common types of soft tissue sarcomas in children and adolescents, originating from mesenchymal cells with skeletal muscle differentiation potential. Although its overall incidence is low, accounting for only about 1% of all malignancies, RMS exhibits high biological heterogeneity and aggressiveness. Based on molecular and histological characteristics, RMS is mainly classified into embryonal, acinar, spindle-shaped sclerotic, and pleomorphic types.

[0003] Gene therapy, as an innovative treatment strategy for diseases related to genetic factors (including malignant tumors and congenital genetic diseases), has developed rapidly in recent years. Its core concept is to deliver exogenous nucleic acid substances (DNA / RNA) to target cells, thereby achieving therapeutic goals by correcting abnormal gene expression or restoring physiological function. Gene therapy for tumors typically utilizes viral or non-viral vectors to precisely introduce tumor suppressor genes, immune regulatory factors, or gene editing systems into tumor cells to induce tumor suppression, immune activation, or apoptosis. Currently, many gene therapy products have made progress in clinical or translational research. For example, oncolytic virus-based gene therapy has attracted much attention in the treatment of solid tumors. A type of recombinant virus can selectively infect and lyse tumor cells while stimulating the host's anti-tumor immune response, providing a new treatment option for drug-resistant or recurrent tumors. With the continuous maturation of delivery systems and gene editing technologies, gene therapy is gradually moving from theory to clinical practice, bringing a completely new treatment modality to refractory tumors.

[0004] Notably, circular RNAs (circRNAs) exhibit high stability due to their covalently closed structure and cell-type and tissue-specific expression characteristics, making them a hot topic in functional studies and disease biomarker exploration in recent years. Numerous studies have shown that circRNAs, as an important class of non-coding RNAs, not only participate in gene expression regulation through mechanisms such as sponging microRNAs, regulating RNA-binding proteins, and influencing transcription and translation, but are also closely related to biological processes such as tumorigenesis, immune regulation, and cellular stress responses. Their closed circular structure, lacking both 5' and 3' ends, provides them with natural resistance to exonucleases, thus maintaining a longer half-life in the cellular environment. Recent literature further indicates that functional abnormalities of circRNAs in the nervous system, cardiovascular system, and various malignant tumors may be associated with disease-driving events or drug resistance formation. Therefore, circRNAs are not only potential biomarkers but also provide new targets and directions for nucleic acid drugs and RNA therapy strategies. Summary of the Invention

[0005] This invention provides the use of circVEGFC in the preparation of a medicament for treating rhabdomyosarcoma, characterized in that the sequence of circVEGFC is SEQ ID NO:1.

[0006] Preferably, the drug comprises an agent that promotes circVEGFC expression.

[0007] More preferably, the reagent that promotes circVEGFC expression is a circVEGFC overexpression construct.

[0008] More preferably, the vector for the circVEGFC overexpression construct is an adenovirus vector, an adeno-associated virus vector, a lentiviral vector, a retroviral vector, or an exosome vector.

[0009] Preferably, the rhabdomyosarcoma is an embryonal rhabdomyosarcoma or an alveolar rhabdomyosarcoma.

[0010] Preferably, the drug further includes a second drug.

[0011] More preferably, the second drug is an mTOR pathway inhibitor.

[0012] More preferably, the mTOR pathway inhibitor is a rapamycin-type drug.

[0013] More preferably, the rapamycin drug is everolimus.

[0014] This invention is the first to discover that circVEGFC expression is downregulated in rhabdomyosarcoma cells compared to normal cells. In rhabdomyosarcoma patient tissues, circVEGFC expression levels were significantly lower than in normal muscle tissue. Overexpression of circVEGFC significantly inhibited rhabdomyosarcoma cell proliferation and promoted tumor differentiation, while knockdown of circVEGFC enhanced rhabdomyosarcoma cell proliferation and inhibited tumor differentiation. These results indicate that circVEGFC plays an important role in the development and progression of rhabdomyosarcoma and shows promising potential for gene therapy applications, providing new ideas for precision treatment, targeted therapy, differentiation therapy, and improving chemosensitivity in rhabdomyosarcoma. Furthermore, the circVEGFC of this invention can be administered locally to the tumor site, helping to reduce systemic toxicity and improve treatment safety. Attached Figure Description

[0015] Figure 1 The identification of the circular RNA circVEGFC in this invention is illustrated: wherein, Figure 1 A is a schematic diagram of circVEGFC forming a loop in exons 2-3 of the VEGFC gene on chromosome 4, and the circular splicing junction sequence verified by Sanger sequencing; Figure 1 B represents the amplification gel electrophoresis image of the circVEGFC structure, which is stable and resistant to RNase R nuclease. Figure 1 Amplified gel electrophoresis image of circVEGFC at the cDNA and gDNA levels; Figure 1 D represents the fluorescence in situ hybridization (FISH) experiment, showing the subcellular localization of circVEGFC in RMS cells. R+ indicates treatment with RNase R, and R- indicates no treatment with RNase R.

[0016] Figure 2 This is a comparison of the expression levels of circVEGFC in RMS patient tissues, cell lines, and differentiation models detected by RT-qPCR: Figure 2 A represents a comparison of the expression levels of circVEGFC in RMS patient tissues and normal control tissues; Figure 2 B shows a comparison of the expression levels of circVEGFC in RMS cell lines (RD, RH30) and normal myoblasts (HSM); Figure 2 C represents the expression change of circVEGFC in the differentiation-induced model.

[0017] Figure 3 This is a graph showing the effects of overexpression of circVEGFC on RMS cell proliferation, colony formation, and differentiation indicators: Figure 3 A and Figure 3B represents the efficiency validation of constructing overexpression (OE) models in RD and RH30 cells, respectively; Figure 3 C and Figure 3 D represents the inhibition curve of circVEGFC overexpression on the in vitro proliferation of RD and RH30 cells as shown in the CCK-8 assay; Figure 3 E and Figure 3 F is an image from an experiment showing the inhibition of RD and RH30 cell colony formation by overexpression of circVEGFC; Figure 3 G and Figure 3 H represents the effect of circVEGFC overexpression on the expression of multiple myogenic differentiation markers mRNA in RD and RH30 cells using qPCR.

[0018] Figure 4 This is a graph showing the effect of knockdown of circVEGFC on the biological behavior of RMS cells: Figure 4 A and Figure 4 B is a validation of the efficiency of circVEGFC knockdown by siRNA in RD and RH30 cells; Figure 4 C and Figure 4 D represents the promoting effect of circVEGFC knockdown on the proliferation of RD and RH30 cells as shown in the CCK-8 assay. Figure 4 E and Figure 4 F represents the experimental results of knocking down circVEGFC to promote RMS cell clone formation. Figure 4 G and Figure 4 H represents the inhibitory effect of circVEGFC knockdown on the expression of differentiation-related markers in RD and RH30 cells, as detected by qPCR.

[0019] Figure 5 This is a graph showing the in vivo treatment efficacy evaluation of a tumor-bearing mouse model: Figure 5 A and Figure 5 B represents in vivo imaging and quantitative fluorescence analysis of the xenograft model constructed after RD and RH30 cells were treated with circVEGFC overexpression. Figure 5 C represents the tumor volume growth curve after injection of OE-circVEGFC adenovirus in PDX models of embryonal (ERMS) and alveolar (ARMS) rhabdomyosarcoma patients.

[0020] Figure 6 shows the transcriptome sequencing and differential pathway analysis of RMS cells overexpressing circVEGFC: Figure 6A and Figure 6B Volcano plot and clustering heatmap of differential gene expression in cells after overexpression of circVEGFC; Figure 6C The GO functional bar chart shows significant enrichment of DEGs, involving processes such as sarcomere tissue and lipoprotein metabolism; Figure 6DBubble plot of KEGG pathway enrichment and GSEA analysis showing significant enrichment of myopathic differentiation pathways.

[0021] Figure 7 shows the effect of overexpression of circVEGFC on cell cycle distribution and expression of cell cycle-related genes. Figure 7A and Figure 7B Flow cytometry was used to detect the histograms and proportion statistics of changes in cell cycle distribution caused by overexpression of circVEGFC in RD and RH30 cells (OE group) and control construct group (NC group), respectively. qPCR was also used to detect the mRNA expression response of the downstream cell cycle marker CCND1.

[0022] Figure 8 shows the effect of knockdown of circVEGFC on RMS cell cycle distribution: Figure 8A and Figure 8B Histograms and statistical analyses of the effects of circVEGFC knockdown on cell cycle distribution in RD and RH30 cells (si-1, si-2, si-3) and the control construct (si-NC) were performed, and qPCR was used to detect the mRNA expression response of the downstream cell cycle marker CCND1.

[0023] Figure 9 This is a graph showing the correlation between circVEGFC expression and RMS cell differentiation indicators. Figure 9 A shows flow cytometry scatter plots of single-stained and co-stained circVEGFCs and differentiation marker MHC molecules obtained by flow cytometry. Figure 9 B is a curve fitted to the co-expression values ​​of circVEGFC and MHC by flow cytometry, illustrating the co-expression situation.

[0024] Figure 10 This is a verification diagram showing how circVEGFC synergistically promotes RMS cell differentiation with MYOD1; Figure 10 A and Figure 10 B demonstrates the synergistic enhancement of the expression level of the differentiation key protein MHC by the combined application of circVEGFC and MYOD1 in RD and RH30 cells, respectively.

[0025] Figure 11 Identification of downstream interacting proteins of circVEGFC: Figure 11 A is a silver staining image of the protein binding in the circVEGFC pull-down assay. Figure 11B shows the Western blotting results of CDH15 and DVL2 proteins in the circVEGFC pull-down assay. The markers are Epizyme and WJ103. The input group is the control group, the negative group is the negative control probe group, and the positive group is the circVEGFC positive probe group.

[0026] Figure 12 This demonstrates that circVEGFC, in synergy with everolimus, enhances the therapeutic effect of RMS cells: Figure 12 AB shows the dose-response curves and changes in cell viability of RD and RH30 cells overexpressing circVEGFC cells in response to everolimus treatment; Figure 12 Statistical trend of efficacy of NC group and OE group with Log concentration when CD is administered in combination. Detailed Implementation

[0027] To make the technical solutions and effects of the present invention clearer, the present invention is further described below through embodiments. It should be understood that these are merely exemplary and not intended to limit the present invention. Materials similar to or the same as the types and models, properties, or functions of the reagents and instruments described below can be used in the implementation of the present invention. Unless otherwise specified, the reagents used in the present invention can be any suitable commercially available reagent. The instruments and reagents used in the present invention are used according to the instructions of the instrument / reagent manufacturer. The experimental methods involved in the present invention are conventional experimental methods in the art, and those skilled in the art can operate them based on known biological and chemical knowledge.

[0028] The term circVEGFC used in this invention refers to the circular RNA produced by backsplicing exons 2-3 of the VEGFC (vascular endothelial growth factor C) gene. Figure 1 Its nucleotide sequence is shown in SEQ ID NO:1. It consists of 405 nucleotides, and its circBankID in the public database circBank (https: / / www.circbank.cn / index.html) is hsa_VEGFC_0002400.

[0029] SEQ ID NO:1: GCTTATGCAAGCAAAGATCTGGAGGAGCAGTTACGGTCTGTGTCCAGTGTAGATGAACTCATGACTGTACTCTACCCAGAATATTGGAAAATGTACAAGTGTCAGCTAAGGAAAGGAGGCTGGCAACATAACAGAGAACAGGCCAACCTCAACTCAAGGACAGAAGAGACTATAAAATTTGCTGCAGCACATTATAATACAGA GATCTTGAAAAGTATTGATAATGAGTGGAGAAAGACTCAATGCATGCCACGGGAGGTGTGTATAGATGTGGGGAAGGAGTTTGGAGTCGCGACAAACACCTTCTTTAAACCTCCATGTGTGTCCGTCTACAGATGTGGGGGTTGCTGCAATAGTGAGGGGCTGCAGTGCATGAACACCAGCACGAGCTACCTCAGCAAGACG.

[0030] As used in this invention, the term "tumor" refers to any malignant or benign growth and proliferation of cells, as well as all precancerous and cancerous cells and tissues.

[0031] Rhabdomyosarcoma (RMS) is a mesenchymal malignant tumor originating from skeletal muscle. It is the most common soft tissue sarcoma in childhood, accounting for approximately 3.5% of childhood malignancies. RMS is mainly classified into four histological subtypes: embryonal rhabdomyosarcoma (ERMS), acinar rhabdomyosarcoma (ARMS), spindle cell / sclerosing rhabdomyosarcoma, and pleomorphic rhabdomyosarcoma. Among them, ARMS is often accompanied by PAX3 / 7-FOXO1 gene fusion and has a poor prognosis, while ERMS is more common in children under 5 years old in the head and neck and genitourinary tract. Clinically, patients are divided into low-, intermediate-, and high-risk groups according to the primary site, TNM clinical stage, and postoperative pathological grade of RMS. Currently, the main treatment approach is a multidisciplinary comprehensive treatment plan based on surgery, radiotherapy, and chemotherapy.

[0032] The term "treatment" as used in this invention includes relieving and / or eliminating symptoms associated with a particular disease or condition.

[0033] The term “combined use” or “combined drug use” as used in this invention includes the simultaneous, sequential, or alternating use of two or more drugs or drug components, including preparing two or more drugs or drug components into a pharmaceutical product present in one or more dosage units to obtain a suitable pharmaceutical product for combined use, and administering the pharmaceutical product to a mammal requiring combined use.

[0034] As used in this invention, the term "construction" refers to a recombinant gene molecule comprising one or more isolated nucleic acid sequences from different sources. Thus, a construct is a chimeric molecule in which two or more nucleic acid sequences from different sources are assembled into a single nucleic acid molecule, and includes any construct containing (1) nucleic acid sequences comprising regulatory and coding sequences not found together in nature (i.e., at least one nucleotide sequence is heterologous relative to at least one other nucleotide sequence), or (2) sequences encoding non-naturally adjacent functional RNA molecules or protein portions, or (3) non-naturally adjacent promoter portions. Representative constructs include any recombinant nucleic acid molecule, such as plasmids, granules, viruses, autonomously replicating polynucleotide molecules, bacteriophages, or linear or circular single-stranded or double-stranded DNA or RNA nucleic acid molecules derived from any source, capable of genome integration or autonomous replication, comprising one or more of these nucleic acid molecules and operatively linked nucleic acid molecules. Constructs of this invention typically include essential elements for guiding the expression of a nucleic acid sequence of interest (e.g., a target nucleic acid sequence or a regulator nucleic acid sequence) also contained in the construct. Such elements may include regulatory elements or regulatory sequences, such as a promoter operatively linked to a nucleic acid sequence of interest (to direct transcription of that nucleic acid sequence), and often also include a polyadenylation sequence. In some embodiments of the invention, the construct may be contained within a vector. In addition to the components of the construct, the vector may also include, for example, one or more optional markers, one or more origins of replication (e.g., prokaryotic and eukaryotic origins), at least one multiple cloning site, and / or elements that facilitate stable integration of the construct into the host cell genome. Two or more constructs may be contained in a single nucleic acid molecule, such as a single vector, or may be contained in two or more separate nucleic acid molecules, such as two or more separate vectors. An “expression construct” typically includes at least one regulatory sequence operatively linked to a nucleotide sequence of interest. In this way, for example, a promoter operatively linked to the nucleotide sequence to be expressed is provided in the expression construct for expression in an organism or a portion thereof, including a host cell.

[0035] The term "rapamycin class drugs" as used in this invention refers to rapamycin and its derivatives. Rapamycin and its derivatives share the same core structure and are typically modified by altering the R group. Examples include temsirolimus, everolimus, ridaforolimus, umirolimus, and zotarolimus. Temsirolimus is a prodrug obtained by esterifying the 42-OH group of rapamycin with 2,2-dimethylolpropionate. Everolimus is obtained by etherifying rapamycin with ethylene glycol. Ridaforolimus is obtained by esterifying rapamycin with dimethylphosphonic acid. Umirolimus is a highly lipophilic rapamycin derivative; zotarolimus is obtained by replacing the 42-hydroxyl group of rapamycin with a tetrazolium ring. Rapamycin was the first marketed mTOR inhibitor, mediating its antiproliferative function by forming a complex with peptidyl-prolyl isomerase (PPIase) FKBP12. FKBP12 is a ubiquitous protein that acts as a receptor for immunosuppressive drugs. The mechanism of action of these inhibitors begins with the formation of a complex with FKBP12, which then binds to the mTORFRB domain, inducing a conformational change that inhibits mTORC1 kinase activity. mTOR inhibition means blocking protein synthesis and cell growth, and amplifying autophagy by promoting tumor regression. Rapamycin and its derivatives inhibit mTORC1 activity through direct interactions with the components of mTORC1 (mTOR, GBL, and Raptor). However, long-term use of rapamycin-like drugs can modulate the expression of Akt, a downstream effector of mTORC2, leading to drug resistance.

[0036] As used in this invention, the term "and / or" refers to and covers any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and / or" means that any one of the listed items can be used alone, or any combination of two or more listed items can be used. For example, A and / or B means A alone, B alone, and combinations of A and B.

[0037] One embodiment of the present invention provides the use of circVEGFC in the preparation of a medicament for treating rhabdomyosarcoma, wherein the sequence of said circVEGFC is SEQ ID NO:1. In a preferred embodiment, the medicament comprises a reagent that promotes circVEGFC expression. The reagent that promotes circVEGFC expression can be any reagent known in the art for promoting the expression of a target circular RNA; in a preferred embodiment, said reagent that promotes circVEGFC expression is a circVEGFC overexpression construct. In a preferred embodiment, the vector of said circVEGFC overexpression construct is an adenovirus vector, an adeno-associated virus vector, a lentiviral vector, a retroviral vector, or an exosome vector.

[0038] In a preferred embodiment, the medicament of the present invention further includes a second medicament used in combination with the circVEGFC of the present invention. The second medicament refers to any drug other than the circVEGFC of the present invention that can be used to treat rhabdomyosarcoma. The second medicament can be used simultaneously, sequentially, or alternately with the circVEGFC of the present invention. When used simultaneously, the second medicament can be administered in one unit or different units of the circVEGFC of the present invention, without particular limitation. In a preferred embodiment, the second medicament includes an mTOR pathway inhibitor. In a preferred embodiment, the mTOR pathway inhibitor is a rapamycin-type drug. In a preferred embodiment, the rapamycin-type drug is everolimus, a selective mTORC1 inhibitor that has been widely used in recent years to treat adult tumors.

[0039] Another embodiment of the present invention provides the use of circVEGFC in the detection or preparation of reagents for the treatment of rhabdomyosarcoma, wherein the sequence of said circVEGFC is SEQ ID NO:1. Preferably, the reagent comprises PCR amplification primers for detecting circVEGFC expression levels, said PCR amplification primers comprising the forward primer of SEQ ID NO:2 and the reverse primer of SEQ ID NO:3.

[0040] SEQID NO:2: GCTACCTCAGCAAGACGG; SEQ ID NO:3: ACTTGTACATTTTCCAATATTCTGGG.

[0041] In the following embodiments of the present invention, all results from at least three independent experiments were analyzed using SPSS version 23.0 (SPSS, USA) or GraphPad Prism 8 as the final results. Data are expressed as mean ± standard deviation. The significance of differences between groups was assessed using a t-test. A p-value less than 0.05 was considered statistically significant.

[0042] The tumor tissues, cell lines, and cell cultures involved in the following embodiments of the present invention are as follows: Rhabdomyosarcoma tumor tissues were obtained from online databases, such as rhabdomyosarcoma from Stjude Cloud and muscle tissue from GSE13873. The expression levels of circRNAs in the transcriptome were analyzed by bioinformatics to compare the expression differences between tumor tissues and normal control tissues.

[0043] Rhabdomyosarcoma cell line RH30 was purchased from the American Type Culture Collection (ATCC, CRL-2061); RD and normal myoblastic cells HSM were purchased from Peking Union Medical College Cell Bank. Cells were cultured in RPMI-1640 or DMEM medium containing 10% fetal bovine serum (FBS). Example

[0044] Example 1: Molecular characterization of circVEGFC RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR) Total RNA was extracted from cells using TRIzol reagent (15596018, Invitrogen, USA). The culture medium was discarded from the cells in six-well plates, and 1000 µL of TRIzol was added. The cells were incubated at room temperature for 5 min, then transferred to 1.5 mL EP tubes. 0.2 mL of chloroform (Beijing Tongguang Fine Chemical Co., Ltd.) was added to each 1.5 mL EP tube, and the mixture was vigorously shaken for 15 s, incubated for 5 min, and then centrifuged at 12000 rpm at 4°C for 15 min. The supernatant was collected into a new EP tube. An equal volume of isopropanol was added, and the mixture was gently mixed by inverting. The cells were incubated at room temperature for 10 min. Centrifuge at 12000 rpm and 4°C for 10 min. A white precipitate will appear at the bottom. Discard the supernatant, add 1 mL of 75% DEPC ethanol to wash the RNA once, centrifuge at 7500 rpm and 4°C for 5 min, add 30–50 µL of DEPC water, and dissolve thoroughly. Use a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) to assess the concentration and purity of the RNA sample. Generally, an A260 / A280 ratio between 1.8 and 2.1 is considered a preliminary indication of good total RNA quality. Store at -20°C or -80°C.

[0045] RNA was reverse transcribed into cDNA using a commercial cDNA synthesis kit (RR036A, Takara Biotech, Japan). The sample loading system is as follows:

[0046] After thoroughly mixing the above sample loading system, place the PCR tubes in the PCR instrument (Thermo, VIIA7 Dx). The parameters are set as follows:

[0047] The obtained cDNA was stored at -20°C. Then, RT-qPCR was performed using the SYBR Green PCR Kit (#1725122, Bio-Rad, USA). The reaction mixture is as follows:

[0048] The reaction conditions for RT-qPCR are as follows: Pre-denaturation: 95℃, 10 min.

[0049] PCR cycles (40 cycles): Denaturation: 95℃, 15 s; Annealing / Extension: 60℃, 1 min; Melting curve analysis: 95℃, 15 s; 60℃, 1 min; 95℃, 15 s.

[0050] GAPDH was used as an internal reference gene for data normalization. The forward and reverse primer sequences for circVEGFC are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively, and the forward and reverse primer sequences for GAPDH are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. circVEGFC-F: GCTACCTCAGCAAGACGG (SEQ ID NO:2); circVEGFC-R:ACTTGTACATTTTCCAATATTCTGGG (SEQ ID NO:3); GAPDH-F: TGCACCACCAACTGCTTAG (SEQ ID NO:4); GAPDH-R:GATGCAGGGATGATGTTC (SEQ ID NO:5).

[0051] Sanger sequencing Sanger sequencing was commissioned to Beijing Liuhe BGI Genomics Co., Ltd.

[0052] RNase R tolerance test Total RNA was extracted from the cells using the TRIzol method or column extraction, and its concentration and purity were detected using a NanoDrop 2000 spectrophotometer. 2 μg of total RNA was added to 2 μL of 10X RNase R Buffer (Gisai Biotechnology, R0300), 1 μL of RNase R enzyme (Gisai Biotechnology, R0300, 20 U / μL), and DEPC water was added to a final volume of 20 μL. The mixture was incubated at 37°C for 30 minutes. The enzymatic digests were then reverse transcribed using a cDNA synthesis kit (RR036A, Takara Biotechnology Co., Ltd., Japan) to synthesize cDNA. PCR amplification and electrophoresis: VEGFC and GAPDH were amplified using linear forward primers (SEQ ID NO:6-linVEGFC-F:GGCCAACCTCAACTCAAGGA) and reverse primers (SEQ ID NO:7-linVEGFC-R:AGATCTCTGTATTATAATGTGCT), as well as forward and reverse primers (SEQ ID NO:4-5) for GAPDH; circVEGFC was amplified using forward and reverse primers (SEQ ID NO:2-3); PCR reaction conditions were as described in "RT-qPCR Reaction Conditions" under "RNA Extraction and Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)". The amplification products were electrophoresed in a 2% agarose gel and observed using a gel imaging system.

[0053] Validation of PCR amplification products of gDNA and cDNA Total RNA and gDNA were extracted from cells using the TRIzol method and a genomic DNA extraction kit (QIAGEN, 69504), respectively. RNA was then reverse transcribed into cDNA for later use. Subsequently, using gDNA and cDNA as templates, PCR amplification was performed using circular primers targeting circVEGFC (SEQ ID NO: 2-3) and linear primers targeting its corresponding linear transcripts (SEQ ID NO: 6-7), respectively. The amplification products were separated by 2% agarose gel electrophoresis and imaged for analysis.

[0054] Fluorescence in situ hybridization (FISH) Cells were seeded into 24-well plates containing cell culture slides. When cell confluence reached 60%–70%, the slides were removed and washed three times with PBS. Cells were then fixed with 4% paraformaldehyde at room temperature for 10 min, followed by permeabilization with 0.5% Triton X-100 for 5 min. After discarding the permeabilization solution, 200 μL of prehybridization buffer (Ribroaden Biotech, C10910) was added, and the plates were incubated at 37°C for 30 min. Then, a Cy3-labeled circVEGFC backsplicing site (BSJ) specific probe (Ribroaden Biotech) was added to a final concentration of 2 μM, and hybridization was performed overnight at 37°C in the dark. After hybridization, cells were washed sequentially with 4×SSC, 2×SSC, and 1×SSC containing 0.1% Tween-20 at 42°C in the dark. Subsequently, the nuclei were stained with DAPI for 5 min, and after mounting with an anti-fluorescence quencher, the slides were observed and images were acquired using a laser confocal microscope (Olympus, FV3000) to analyze the distribution of fluorescence signals and determine the subcellular localization of circVEGFC.

[0055] result like Figure 1 As shown in Figure A, the characteristic splicing sites of the circVEGFC gene in RD cells were verified by Sanger sequencing to be formed by the cleavage of exons 2-3 of the VEGFC gene. Figure 1 As shown in Figure B, the circVEGFC band showed no significant change before and after treatment using the RNase R tolerance assay, while the linear band significantly weakened or disappeared, verifying that the circular structure of circVEGFC has better stability than linear mRNA (showing results from RD cells). Figure 1 As shown in Figure C, circVEGFC amplification in cDNA and gDNA revealed that the circular primers amplified the target band only in cDNA and not in gDNA, confirming that the characteristic sequence of circVEGFC originates from reverse splicing of RNA, rather than a genome-level DNA sequence. circVEGFC is formed by the closure of RNA exons into circular loops, not DNA (as shown in RD cell results). Figure 1 As shown in D, the circVEGFC fluorescent probe was used to identify its distribution in both the cell nucleus and cytoplasm, with the cytoplasm being the predominantly dominant component.

[0056] Example 2: Expression of circVEGFC in clinical samples circVEGFCs were extracted from RMS cell lines (RD cells and RH30 cells), normal myocytes (HSM), and an RMS differentiation model according to the method in Example 1. In this invention, GAPDH was used as an internal reference gene for data normalization, and the relative expression level was calculated using a 2-1 ratio. - Δ Δ CT Calculation by method.

[0057] The RMS cell differentiation model was implemented by forcing undifferentiated RMS cells to transform into mature myocytes using exogenous myogenic regulatory factor (MYOD1) in conjunction with an induction medium. The MYOD1 overexpression plasmid (GeneChem, Shanghai) was introduced into RD cells using liposome transfection reagent (Invitrogen, Lipofectamine™ 3000). MYOD1, a core member of the myogenic regulatory factor family, is a key transcription factor that initiates the myogenic process and induces cells to transition from the proliferative phase to the differentiation phase. Six hours after transfection, the standard growth medium (Growth Medium (GM), which is RPMI-1640 or DMEM medium containing 10% FBS (FBS is TransGen FS301-02; RPMI-1640 is GIBCO, C22400500BT; DMEM is GIBCO, C11995500BT) was replaced with differentiation medium (Differentiation Medium (DM), which is RPMI-1640 or DMEM medium containing 2% horse serum (horse serum is Gibco, 26050-070)). After inducing differentiation using the above differentiation model for 48 hours, cells were harvested for RNA extraction.

[0058] result Figure 2 The expression level of circVEGFC in RMS patient tissues, cell lines, and differentiation models, such as Figure 2 A and Figure 2 As shown in Figure B, the expression of circVEGFC was significantly decreased in RMS tumor tissues and cell lines. Figure 2 As shown in C, in the differentiation model, compared with the control cells (low differentiation) that have not undergone differentiation model treatment, the expression of circVEGFC is significantly increased in the cells (high differentiation) after applying the differentiation model treatment.

[0059] Example 3: Overexpression of circVEGFC inhibits the proliferation, clonal ability, and promotes differentiation of RMS cells in vitro. Construction of circVEGFC overexpression plasmid and control plasmid The full-length cDNA sequence of circVEGFC was amplified using the RT-qPCR method described in Example 1. The PCR product was identified by agarose gel electrophoresis and then purified. The purified target gene fragment and the corresponding plasmid vector were digested with restriction endonucleases and ligated using T4 DNA ligase to construct the circVEGFC overexpression plasmid. A blank plasmid was used as a control. The circVEGFC overexpression plasmid was transformed into competent *E. coli*, and positive clones were obtained after antibiotic screening. The correctness of the recombinant plasmid was confirmed by colony PCR, restriction endonuclease digestion analysis, and sequencing. After successful plasmid amplification, the plasmid was extracted and purified using a plasmid extraction kit for subsequent cell experiments.

[0060] The above-mentioned circVEGFC overexpression plasmid construct and control plasmid construct were all synthesized, cloned and identified by GeneChem (Shanghai).

[0061] Cell transfection Before transfection, RD and RH30 cells were seeded in culture plates of appropriate size to achieve a cell density of approximately 75%-80% at transfection. Following the instructions of the transfection reagent (Invitrogen, Lipofectamine™ 3000), the circVEGFC overexpression plasmid construct or control plasmid construct was diluted with serum-free medium and incubated at room temperature before being mixed to form a DNA-transfection reagent complex. The complex was added to the cell culture system and incubated at 37 °C with 5% CO2. After 24 hours, the medium was replaced with fresh complete medium, and the cells were cultured for further analysis. 72 hours after transfection, GFP fluorescence was observed in the cells using a fluorescence microscope, indicating successful preparation of overexpression groups RD and RH30. RT-qPCR was used to assess the stable transfection efficiency of the overexpression plasmid construct.

[0062] Cell proliferation detection using CCK-8 reagent Cell proliferation was assessed using a cell counting kit-8 (Beyotime, C0043). Cells in logarithmic growth phase (overexpression group RD, control group RD, overexpression group RH30, and control group RH30) were digested and prepared into single-cell suspensions, seeded at approximately 75%-80% cell density in 96-well plates, with four replicates per group for parallel experiments. After cell attachment, cells were cultured at 37 °C and 5% CO2. At specified time points (0, 24, 48, 72, 96, 120, and 144 h), CCK-8 reagent was added to each well, gently mixed, and incubated for another 1 h. The absorbance (OD 450 nm) of each well was then measured using a microplate reader (Thermo Fisher Scientific, Multiskan FC) at 450 nm.

[0063] Settlement formation experiment Cells (overexpression group RD, control group RD, overexpression group RH30, and control group RH30) were seeded at a density of 800 cells per well into six-well plates containing culture medium. After two weeks of culture, cell colonies were washed with PBS. Cell colonies were then fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (#C0121, Beyotime, China) in the dark for 15 minutes. Colonies were photographed and counted using ImageJ (National Institutes of Health, 1.8.0).

[0064] Tumor differentiation marker detection RT-qPCR was used to detect the mRNA expression levels of myogenic regulatory factors MYOD1, MYOG, and DESSMIN, as well as the terminal differentiation marker Myosin Heavy Chain (MHC), in cells (overexpression group RD, control group RD, overexpression group RH30, and control group RH30). Data processing: Using GAPDH as an internal control, the relative expression levels of each differentiation marker were calculated. The forward and reverse primers for each target substance are shown below: MYOD1-F:CGGACGTGCCTTCTGAGTC (SEQ ID NO:8) MYOD1-R:AGCACCTGGTATATCGGGTTG (SEQ ID NO:9) MYOG-F:GGGGAAAACTACCTGCCTGTC (SEQ ID NO:10) MYOG-R: AGGCGCTCGATGTACTGGAT (SEQ ID NO: 11) DESMIN-F: GAGACCATCGCGGCTAAGAAC (SEQ ID NO: 12) DESMIN-R: GTGTAGGACTGGATCTGGTGT (SEQ ID NO: 13) MHC-F:ATTGCTTCGTGGTGGACTCAA (SEQ ID NO:14) MHC-R: GGCCATGTCTTCGATCCTGTC (SEQ ID NO: 15).

[0065] result The level of circVEGFC expression in transfected cells was detected, such as... Figure 3 As shown in AB, in both RD and RH30 cells, the level of circVEGFC in the overexpression group (OE) was significantly higher than that in the control group (NC). Figure 3 As shown in CF, the results of CCK-8 and colony formation assays indicated that overexpression of circVEGFC significantly inhibited the proliferation rate and colony formation number of RMS cells. Figure 3 As shown in GH, RT-qPCR results revealed that overexpression of circVEGFC significantly upregulated the expression levels of myogenic differentiation markers in RMS cells. These results indicate that increasing circVEGFC expression can effectively inhibit the malignant proliferative phenotype of RMS cells and induce cell differentiation into mature myocytes.

[0066] Example 4: Knockdown of circVEGFC promotes RMS cell proliferation, clonal capacity, and inhibits differentiation in vitro. Construction and transfection of short interfering RNA (siRNA) The short interfering RNA (siRNA) targeting circVEGFC and the control siRNA were constructed by RiboBio (Guangzhou, China). To increase the reliability of the results, this invention designed three sets of siRNAs to prepare different circVEGFC knockdown groups. The specific sequences are shown below.

[0067] hsa-circVEGFC-F1:TCAGCAAGACGGCTTATGC (SEQ ID NO:16); hsa-circVEGFC-R1: AGTCGTTCTGCCGAATACG (SEQ ID NO: 17); hsa-circVEGFC-F2: AGCAAGACGGCTATGCAA (SEQ ID NO: 18); hsa-circVEGFC-R2:TCGTTCTGCCGAATACGTT (SEQ ID NO:19); hsa-circVEGFC-F3: AGACGGCTTATGCAAGCAA (SEQ ID NO: 20); hsa-circVEGFC-R3:TCTGCCGAATACGTTCGTT (SEQ ID NO:21).

[0068] Using Lipofectamine RNAiMAX transfection reagent (#13778150, Invitrogen, USA), following the manufacturer's instructions, the three groups of siRNAs specifically targeting the circVEGFC reverse splice adapter and the control siRNA (Guangzhou Ruibo Biotechnology Co., Ltd., siN0000001-1-5) were transfected into RD cells and RH30 cells, respectively, to construct the circVEGFC knockdown group si-circVEGFC group, namely si-1, si-2, si-3 and the control group si-NC.

[0069] The transfection steps are as follows: 1. Dilute siRNA (use new pipette tips in all the following steps to prevent RNase contamination): Mix 100µL Opti-MEM (Gibco, USA) with 3 or 4µL siRNA (20uM) solution, gently pipette 10 times to mix, and let stand at room temperature for 10 min; 2. Dilute RNAiMAX (Lipofectamine): Mix 100µL Opti-MEM (Gibco, USA) with 5µL RNAiMAX, gently pipette 10 times to mix, and let stand at room temperature for 10 min; 3. Preparation of RNAiMAX-siRNA complex: Mix 100µL of diluted RNAiMAX with 10µL of diluted siRNA, gently pipette to mix, and incubate at room temperature for 15 min to prepare RNAiMAX-siRNA transfection complex; 4. Transfection: Add 200 µL of the transfection complex obtained in step 3 to cells in a normally cultured six-well plate (Corning, 3516), gently shake to distribute evenly, and incubate in an incubator. The transfection efficiency is then assessed after 48 hours.

[0070] The expression levels of circVEGFC in the si-circVEGFC groups (si-1, si-2, si-3) and the si-negative control group (si-NC) were detected using the same method as in Example 2. Cell proliferation capacity and colony formation were studied using the "CCK-8 reagent cell proliferation assay" and "colony formation assay" as in Example 3. The expression level of myogenic regulatory factor mRNA was detected using the method in the "tumor differentiation index detection" section of Example 3.

[0071] result RT-qPCR test results are as follows Figure 4 As shown in Figures AB, compared with the si-NC group, the expression of circVEGFC in all three si-circVEGFC groups was significantly decreased. The results of the CCK-8 assay and colony formation assay are as follows... Figure 4 As shown in CF, knockdown of circVEGFC significantly promoted the proliferation of RMS cells and significantly increased colony formation rate. The results of myogenic regulatory factor mRNA expression levels are as follows: Figure 4 As shown in GH, the mRNA expression levels of differentiation-related genes decreased. These results indicate that knocking down circVEGFC further worsens the tumor characteristics of RMS cells and inhibits their normal differentiation process.

[0072] Example 5: Mouse Model Experiment Construction of circVEGFC overexpression adenovirus construct and control adenovirus construct The cDNA sequence of circVEGFC was inserted into an adenovirus expression vector to construct the circVEGFC overexpression construct, with a blank adenovirus vector used as a control construct. Both the circVEGFC overexpression adenovirus construct and the control adenovirus construct were constructed by GeneChem (Shanghai).

[0073] Tumor cell xenograft model (CDX) Stable luciferase-overexpressing cell lines were constructed using RD and RH30 cell lines. pLV-luciferase lentivirus (purchased from GeneChem, Shanghai, China) was transfected into RD and RH30 cells, and puromycin (Lablead, China) was used for selection to establish stable luciferase-overexpressing cell lines. The specific steps are as follows: RD and RH30 cells were cultured at 1.5 × 10⁻⁶ cells / cells. 5Cells were seeded at a density of [number] cells / well in 24-well cell culture plates. After 24 hours of culture, cell status was observed. Lentiviral infection was initiated when cell confluence reached approximately 40% and the cells were evenly distributed at the bottom of the wells. The original culture medium was discarded, and 480 μL of fresh complete culture medium and 20 μL of HitransGP viral infection enhancement reagent (REVG005, GeneChem, China) were added to each well. Lentiviral virus carrying the luciferase gene (CON285, GeneChem, Shanghai, China) was then added, and culture continued. The required viral volume was calculated based on a set MOI of 20 and viral titer using the formula: Virus volume = (MOI × number of cells) / viral titer. Forty-eight hours after infection, puromycin was added to the culture medium at a final concentration of 4 μg / mL for resistance selection. During selection, the culture medium was replaced with fresh puromycin every day for 14 days to obtain cell lines stably expressing the luciferase gene. The puromycin concentration was then halved, and the culture was maintained for 7 days. Finally, the expression level of luciferase was detected using a dual-luciferase reporter gene detection system (Promega, E1910), and cell lines with stable high expression of luciferase were screened.

[0074] Using the "cell transfection" method described in Example 3, the above-mentioned stable luciferase-expressing tumor cells were overexpressed with circVEGFC (overexpression group RD, control group RD, overexpression group RH30, and control group RH30), and then inoculated into the hind limb muscles of mice, with each mouse receiving 2*10 cells. 6 Tumor cells were collected. Mice were cultured and observed, and fluorescence intensity was measured on days 7 and 28 using InVivoFXPro (Bruker, Germany). Tumor data were acquired and analyzed using BrukerMI software. All animal welfare and experimental procedures were conducted in accordance with the requirements of the Beijing Municipal Committee for the Management of Laboratory Animals and have obtained ethical approval.

[0075] Tumor tissue xenograft model (PDX) To validate the antitumor efficacy of circVEGFC in an in vivo environment that more closely resembles clinicopathological characteristics, this invention establishes a patient-derived rhabdomyosarcoma xenograft model (PDX): fresh rhabdomyosarcoma tissue specimens (including embryonal ERMS and acinar ARMS) are obtained from clinical surgery. The obtained tumor tissue is cut into pieces approximately 1 mm thick. 3 Small pieces were implanted subcutaneously into 4-6 week old immunodeficient mice using a puncture cannula. The mice's vital signs and tumor growth were observed regularly until the tumor reached approximately 100 mm². 3The subsequent experiments were then conducted. According to the experimental timeline diagram, treatment began on day 25 post-implantation, using a multi-point intratumoral injection method. The circVEGFC-overexpressing adenovirus construct (OE) or the corresponding control adenovirus construct (NC) was injected every 3 days. Each mouse's hind limb tumor received 100 μL of adenovirus per injection, at a concentration of 5*10⁻⁶. 9 pFu / mL (adenovirus construct diluted with PBS), continued until the observation endpoint. Tumor growth assessment and data collection volume measurements were performed every 5 days.

[0076] result We constructed tumor cell xenograft (CDX) and patient tumor tissue xenograft (PDX) models to validate the inhibitory effect of circVEGFC on the growth of rhabdomyosarcoma (RMS) at the in vivo level. In vivo imaging and quantitative fluorescence analysis of bioactivity are shown below. Figure 5 As shown in Figures AB, rhabdomyosarcoma treated with circVEGFC overexpression showed significant growth inhibition on day 28 in the CDX model. Meanwhile, in the PDX model, the results of tumor treatment with a circVEGFC-overexpressing adenovirus vector were as follows... Figure 5 As shown in Figure C, the growth rate of the tumor volume was significantly inhibited. In vivo experiments consistently demonstrate that circVEGFC can significantly inhibit the growth of rhabdomyosarcoma, showing promising potential for anti-tumor applications.

[0077] Example 6: Molecular mechanism by which circVEGFC inhibits RMS 1. circVEGFC inhibits tumor proliferation by altering cell cycle and differentiation level. RNA sequencing (RNA-seq) analysis RH30 cells were transfected with the OE-NC and OE-circVEGFC constructs from Example 3 for 48 hours. Total RNA was then isolated from these cells using TRIzol reagent. Triple-parallel experiments were conducted for both the control and overexpression groups. All libraries were prepared using Illumina HiSeq 4000 according to the manufacturer's recommendations. Sequence data were aligned to the hg19 reference genome using HISAT2. High-throughput sequencing was performed using the Illumina HiSeq 2000 platform. RNA-seq transcript data were analyzed using TopHat / Cufflinks software. Genes with a false discovery rate (FDR) <0.05, a p-value <0.01, and a fold change >1.2 were considered differentially expressed genes (DEGs).

[0078] Enrichment pathway analysis KEGG analysis was performed on the obtained DEGs using KEGG Mapper (http: / / www.genome.jp / kegg / mapper.html). GO enrichment analysis [GO bioprocesses (GO:BP)] was performed using the GO database (http: / / www.geneontology.org / ). A p-value less than 0.05 was considered statistically significant.

[0079] Flow cytometry The following steps were performed on the RMS cells overexpressing circVEGFC in Example 3 and their control group cells, and the RMS cells knocked down circVEGFC expression in Example 4 and their control group cells: (1) Select cells in the logarithmic growth phase, digest them with trypsin, resuspend them in 1×PBS pre-cooled to 4°C, and then centrifuge them at 1000 rpm for 5 min in a 4°C centrifuge. After discarding the supernatant, repeat the 1×PBS washing step twice; (2) Resuspend the cells in 0.5 mL of pre-cooled 1×PBS, and then add 1.5 mL of pre-cooled anhydrous ethanol. Fix them in a 4°C refrigerator for 8 h, or in a -20°C refrigerator for more than 30 min (they can be stored in a -20°C refrigerator for one month); (3) Cell staining: After centrifuging the fixed cells, wash the cells once with pre-cooled 1×PBS, and after centrifugation, add 1 mL of PBS (containing 50 μg / mL ethidium bromide (E8751, Sigma) and 100 μg / mL RNase). A (R6513, Sigma) resuspended cells; (4) flow cytometer (ACEA, NovoCyte, USA) was used for detection and analysis. A 488nm laser was used to detect fluorescence signals with wavelengths above 600nm. 10,000 cells were counted and the results were analyzed using cell cycle fitting software (ModFit LT 5).

[0080] After mincing the patient-derived tumor tissue, it was digested into a single-cell state using collagenase, resuspended in 1×PBS pre-cooled to 4°C, and then centrifuged at 1000 rpm for 5 min at 4°C. The supernatant was discarded, and the 1×PBS washing step was repeated twice. 1 mL of permeabilization working solution (eBioscience™, 00-5521-00) was added, and the mixture was incubated in the dark for 1 hour. After centrifugation and discarding the supernatant, anti-MHC antibody (R&D, mab4470) and / or circVEGF were added. 1 μL of the FISH probe C (Guangzhou Ruibo Biotechnology Co., Ltd., 488nm, lnc1CM00C) was vortexed to mix thoroughly and incubated at room temperature in the dark for 40 minutes. After centrifugation and discarding the supernatant, 1 μL of the secondary antibody goat anti-mouse 594nm (Invitrogen, A32742) was added, vortexed to mix thoroughly, and incubated at room temperature in the dark for 20 minutes. After centrifugation and discarding the supernatant, the cells were washed twice and then analyzed using a flow cytometer (ACEA, NovoCyte). The assay included blank cells, single-stained circVEGFC cells, single-stained MHC cells, and co-stained circVEGFC and MHC cells.

[0081] Tumor differentiation marker detection Total RNA was extracted from RD or RH-30 cells using the TRIzol method, and the RNA was reverse transcribed into cDNA. The mRNA expression level of the cell cycle marker CCND1 was detected by RT-qPCR, with GAPDH as an internal control, and the relative expression levels of various differentiation indicators were calculated. The primers for CCND1 were: CCND1-F: GCTCGAAGTGGAAACCATC (SEQ ID NO:22); CCND1-R: CCTCCTTCTGCACACATTTGAA (SEQ ID NO: 23).

[0082] Tumor cell differentiation model Using liposome transfection reagent (Invitrogen, Lipofectamine™ 3000), the MYOD1 overexpression plasmid (GeneChem, Shanghai) and / or the circVEGFC overexpression plasmid construct from Example 3 were introduced into RD and RH30 cells, respectively. The RD and RH30 cells were treated using the RMS cell differentiation model method described in Example 2. The growth medium was Growth Medium (GM) containing 10% FBS in RPMI-1640 or DMEM, where the FBS was TransGen FS301-02, the RPMI-1640 was GIBCO C22400500BT, and the DMEM was GIBCO. The culture medium used was C11995500BT. Differentiation medium (DM) was either RPMI-1640 or DMEM containing 2% horse serum (Gibco, 26050-070). Additionally, RD and RH30 cells without the MYOD1 overexpression plasmid and the circVEGFC overexpression plasmid construct from Example 3 were cultured using GM and DM, respectively. RT-qPCR was used to detect changes in the expression of the cell differentiation marker MHC under different treatments to assess the effect of circVEGFC on cell differentiation levels.

[0083] result Transcriptome sequencing and differential expression analysis of RMS cells by overexpression of circVEGFC: RNA-seq analysis was performed on RH30 cells to explore potential signaling pathways that may be affected by circVEGFC. Figure 6A As shown, compared with the control group, the overexpression group cells carried 275 upregulated genes and 371 downregulated genes. The cluster heatmap reveals the significantly differentially expressed genes between the control and overexpression groups. Figure 6B RH30_OE_V2_1, RH30_OE_V2_2, and RH30_OE_V2_3 represent three parallel overexpression groups, and RH30_con1, RH30_con2, and RH30_con3 represent three parallel control groups. These differentially expressed genes were analyzed using the KEGG and GO databases, and pathway enrichment analysis showed (…). Figure 6C -E), circVEGFC overexpression-induced differentially expressed mRNAs are enriched in cell cycle, muscle differentiation, etc.

[0084] Results from analysis of cell cycle-related gene expression in RMS cells overexpressing circVEGFC and those with knocked-down circVEGFC showed that circVEGFC is associated with tumor cell cycle and tumor differentiation degree (Figures 7-8).

[0085] Flow cytometry was used to detect the co-expression of circVEGFC and the differentiation marker MHC in patient-derived tumor cells. In both the circVEGFC and MHC single-staining groups, cells exhibited good single-channel fluorescence specificity. Co-staining results showed significant co-expression of circVEGFC and MHC molecules within the cells. Figure 9 A). The fitting curve between the circVEGFC values ​​of co-stained cells and the MHC flow cytometry detection values ​​showed a positive correlation (R=0.429). Figure 9 (B) further confirmed that the expression level of circVEGFC is closely related to the differentiation status of the tumor cells.

[0086] circVEGFC can also synergistically promote RMS cell differentiation with MYOD1. In RD and RH30 cells, under the influence of differentiation culture medium, overexpression of either MYOD1 or circVEGFC alone can increase the relative expression level of MHC to some extent. Combined application of overexpression of circVEGFC and MYOD1 showed a synergistic enhancing effect on MHC expression levels, effectively promoting myogenic differentiation of rhabdomyosarcoma (RD and RH30) cells. Figure 10 ).

[0087] 2. circVEGFC regulates tumor cell cycle and differentiation by binding to CDH15 and DVL2. circRNA-pulldown-MS mass spectrometry detection Biotin-labeled circRNA probes were used in RNA pull-down assays to screen for binding proteins that interact with circRNA. Specific biotin-labeled oligonucleotide probes were designed and synthesized based on the backsplicing sequence of circVEGFC, along with corresponding negative control probes. All probes were provided by Sangon Biotech. Three positive probes were added simultaneously in a 1:1:1 molar ratio during the experiment.

[0088] circVEGFC-Positive-Probe1: GCTTGCATAAGCCGTCTTGCTGAG (SEQ ID NO: 24); circVEGFC-Positive-Probe2: ATAAGCCGTCTTGCTGAGGTAGCT (SEQ ID NO: 25); circVEGFC-Positive-Probe3: ATCTTTGCTTGCATAAGCCGTCTT (SEQ ID NO: 26); circVEGFC-Negative-Probe: CTCAGCAAGACGGCTTATGCAAGC (SEQ ID NO: 27).

[0089] Cells in the logarithmic growth phase were collected into culture dishes and fixed with 1% formaldehyde for 10 min. After fixation, 2.5M glycine was added at a glycine:fixative ratio of 1:20 (i.e., 500 μL of glycine was added to 10 mL of fixative). The culture dishes were placed on a shaker at room temperature and thoroughly mixed for 5 min. 15 mL of PBS was added and thoroughly mixed, then the liquid was discarded. The above steps were repeated, adding 15 mL of PBS and thoroughly mixing (just shake a few times by hand), then discarding the liquid. The cells were collected by centrifugation at 1200 rpm, 4 degrees Celsius for 3 min. The cell pellet was resuspended in 1 mL of pre-chilled lysis buffer (Lysisbuffer, Thermo Fisher Scientific, FNN0021), and 4 μL of PMSF (250 mmol) and 10 μL of PIC (100 mmol) were added and gently mixed by pipetting. The mixture was vortexed 3 times and then sonicated for lysis. Centrifuge at 12000 r / min, 4℃ for 10 min, and collect the supernatant as cell lysis buffer for direct use in circRNA gene RNA pull-down protein enrichment experiments or as input group for detection.

[0090] Using the Pierce™ Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific, 20164), take 50 μL of Pierce... TMAdd Nucleic-Acid Compatible Streptavidin Magnetic Beads to a 1.5 mL EP tube, then place it on a magnetic rack until the EP tube becomes clear and transparent, then discard the supernatant. Remove the 1.5 mL EP tube from the magnetic rack, add 20 mM Triss (pH 7.5), and gently pipette to resuspend the magnetic beads. Place it on a magnetic rack until the EP tube becomes clear and transparent, then discard the supernatant. Repeat this washing process once. Remove the 1.5 mL EP tube from the magnetic rack, add Binding Buffer, and gently pipette to resuspend the magnetic beads. After mixing the magnetic beads, add the biotin-labeled DNA probe, gently pipette to mix, and incubate at room temperature (18–25°C) using a rotary mixer for 4 hours. After incubation, briefly centrifuge the sample tube in a small centrifuge, then place it on a magnetic rack until the EP tube becomes clear and transparent, then discard the supernatant. Remove the magnetic rack from the 1.5 mL EP tube after discarding the supernatant, add 20 mM Tris (pH 7.5), gently pipette to resuspend the magnetic beads, and then place it on the magnetic rack until the EP tube becomes clear and transparent, then discard the supernatant. Remove the magnetic rack from the 1.5 mL EP tube after discarding the supernatant, add Binding Buffer, and gently pipette to resuspend the magnetic beads. Remove the magnetic rack from the 1.5 mL EP tube after discarding the supernatant, add Cell Lysis Buffer, gently pipette to resuspend the magnetic beads, mix well, and then place it in a 4°C refrigerator and incubate overnight using a rotary mixer.

[0091] Add Wash Buffer and gently pipette to resuspend the magnetic beads. Then place the tube on a magnetic rack until the EP tube becomes clear and transparent, then discard the supernatant. Wash away any unbound or bound non-specific proteins from the magnetic bead-probe-RNA-protein mixture.

[0092] Remove the 1.5 mL EP tube from the magnetic rack after discarding the supernatant, add Wash Buffer and gently pipette to resuspend the magnetic beads to elute the target protein. Incubate the resuspended magnetic beads in a metal bath at 1000 rpm and 37 degrees Celsius for 30 min, then place it on the magnetic rack until the EP tube becomes clear. Retain the supernatant for mass spectrometry identification.

[0093] The RNA pull-down-enriched proteins were subjected to SDS-PAGE gel electrophoresis. 20 μL of protein solution was run on a stacking gel, and electrophoresis was stopped just 1 cm into the separating gel. The stacking gel was rinsed with water, and the concentrated and aggregated sample bands (ensuring each band was as uniform in size and shape as possible) were cut into 1 mm square pieces and placed in EP tubes. An appropriate volume of pure acetonitrile dry gel was added, followed by approximately 50 μL of LTT solution (10 mM, dissolved in 100 mM ammonium bicarbonate) to completely cover the dry gel particles. The reaction was carried out at 56 °C for 30 minutes. After cooling to room temperature, pure acetonitrile dry gel was added, and all solvents were discarded. Subsequently, approximately 50 μL of LIAAA solution (55 mM, dissolved in 100 mM ammonium bicarbonate) was added to cover the dry gel particles. The reaction was carried out at 37 °C in the dark for 10 minutes. After cooling to room temperature, pure acetonitrile dry gel was added, and all solvents were discarded. The staining agents on the gel particles were removed using a 50% acetonitrile, 50% 100 mM ammonium bicarbonate solution. After decolorization, the sample tube was dried using pure acetonitrile, and the solvent in the sample tube was discarded. Then, a sufficient volume of trypsin solution (13 ng / μL, dissolved in 10 mM ammonium bicarbonate solution containing 10% acetonitrile) was added for overnight enzymatic hydrolysis. After hydrolysis, a 50% acetonitrile solution containing 0.1% formic acid, an 80% acetonitrile solution containing 0.1% formic acid, and pure acetonitrile were added sequentially to extract the peptides from the gel particles. The extracted peptides were then combined, lyophilized, and analyzed by mass spectrometry.

[0094] Western Blot Experiment In RH30 cells, protein complexes binding to circVEGFC were specifically enriched using an RNA pull-down assay. The enriched protein samples and an input control group were added to an SDS-PAGE gel (containing a 5% stacking gel and a 10% separating gel) for electrophoresis. Electrophoresis was initially run at a constant voltage of 80V until the bromophenol blue indicator reached the separating gel interface, then continued at a constant voltage of 100V for approximately 1.5 hours. After electrophoresis, the target protein was transferred to a methanol-activated PVDF membrane. After transfer, the PVDF membrane was blocked with TBST solution containing 5% skim milk powder at room temperature for 30 minutes. Subsequently, the membrane was immersed in an incubation solution containing specific primary antibodies—M-Cadherin antibody (CDH15) (CST, 40491T), DVL2 antibody (CST, 3224T), and GAPDH antibody (CST, 5174T)—and incubated overnight at 4°C. The following day, the membrane was washed 5-6 times (5 min each time) with TBST to remove excess primary antibody. Then, HRP-labeled secondary antibody diluted 1:20000 was added, and the membrane was incubated at 37°C on a shaker for 2 h. After another thorough wash with TBST, ECL-enhanced chemiluminescence solution (CST, 6883P3) was added (mixed 1:1 by volume), and the membrane was exposed and developed in an imaging system.

[0095] result Silver staining results from RNA-pulldown-MS (mass spectrometry) analysis of circVEGFC showed that circVEGFC can interact with a variety of different RNA-binding proteins. Figure 11 A), where circVEGFC binds to two key candidate interacting proteins, CDH15 and DVL2, at 88.9 kDa and 78.9 kDa, respectively. Western blot results showed ( Figure 11 In the input group (B), the target protein bands were detected in all groups. CDH15 and DVL2 antibody bands were detected in the circVEGFC positive probe group, but not in the negative control probe group. The control protein antibody GAPDH was not detected in either the positive or negative probe groups. CDH15 (M-Cadherin) is a trigger for terminal myocyte differentiation; DVL2 is a core component of the Wnt signaling pathway, involved in regulating cell proliferation and polarity. circVEGFC, by binding to CDH15 and DVL2, promotes myogenic differentiation of RMS cells and regulates their proliferation, thereby achieving an inhibitory effect on rhabdomyosarcoma.

[0096] Example 7: Combined use of circVEGFC and everolimus circVEGFC and everolimus combination therapy RD cells and RH30 cells transfected with the circVEGFC adenovirus construct and the control adenovirus construct were seeded at a density of 75%-80% into 96-well plates and cultured at 37°C and 5% CO2. Everolimus was then added to each well at concentrations of 10 nM, 50 nM, 100 nM, 500 nM, 1000 nM, 5000 nM, 10000 nM, 50000 nM, and 100000 nM. After 48 hours of culture for RD cells and 24 hours for RH30 cells, CCK-8 was added to each well. The cells were then cultured for another hour, and the optical density at 450 nm was measured using a microplate reader to calculate cell viability and efficacy.

[0097] result Results of circVEGFC and the mTOR inhibitor everolimus in the treatment of rhabdomyosarcoma (RMS) show that, Figure 12 As shown in Figures AB, compared with the control group, rhabdomyosarcoma cells overexpressing circVEGFC exhibited significantly reduced activity against everolimus's IC50. Meanwhile, as... Figure 12As shown in CD, the slope of the dose-response curve for cells overexpressing circVEGFC treated with everolimus was significantly greater than that for cells not overexpressing circVEGFC treated with everolimus. This indicates that the difference in inhibitory effect between cells overexpressing circVEGFC and those not overexpressing circVEGFC increased with increasing everolimus concentration. These experimental results demonstrate that the combined use of circVEGFC and everolimus significantly enhances drug sensitivity and further reduces RMS cell viability, exhibiting a synergistic inhibitory effect.

[0098] As demonstrated by the above examples, circVEGFC expression was significantly reduced in RMS cell lines and clinical tissues. In vitro experiments confirmed that circVEGFC significantly inhibited RMS cell proliferation and clonogenicity, and promoted their differentiation into mature myocytes. Furthermore, in vivo experiments using CDX and PDX mouse models consistently demonstrated the significant inhibitory effect of circVEGFC on RMS tumor growth. At the molecular level, this invention reveals that circVEGFC exerts its anti-cancer effect by directly binding to CDH15 and DVL2 proteins. Considering the potential for insufficient efficacy or drug resistance in patients using mTOR inhibitors (such as everolimus) to treat rhabdomyosarcoma, this invention provides a new method to improve such efficacy. In summary, this invention reveals the important biological significance of circVEGFC in the development and progression of rhabdomyosarcoma and its application prospects in gene therapy. Simultaneously, circVEGFC also holds promise as a biomarker for RMS prognostic assessment, providing new insights for the precise diagnosis and personalized treatment of rhabdomyosarcoma patients.

Claims

1. The use of circVEGFC in the preparation of a medicament for treating rhabdomyosarcoma, characterized in that, The sequence of circVEGFC is SEQ ID NO:

1.

2. The use according to claim 1, characterized in that, The drug includes a reagent that promotes circVEGFC expression.

3. The use according to claim 2, characterized in that, The reagent that promotes circVEGFC expression is a circVEGFC overexpression construct.

4. The use according to claim 3, characterized in that, The vector for the circVEGFC overexpression construct is an adenovirus vector, an adeno-associated virus vector, a lentiviral vector, a retroviral vector, or an exosome vector.

5. The use according to claim 1, characterized in that, The rhabdomyosarcoma is either embryonal rhabdomyosarcoma or alveolar rhabdomyosarcoma.

6. The use according to any one of claims 1-5, characterized in that, The drug also includes a second drug.

7. The use according to claim 6, characterized in that, The second drug is an mTOR pathway inhibitor.

8. The use according to claim 7, characterized in that, The mTOR pathway inhibitor is a rapamycin-type drug.

9. The use according to claim 8, characterized in that, The rapamycin-type drug in question is everolimus.

Citation Information

Patent Citations

  • Application of protein coded by circular RNA circVEGFC in esophageal squamous cell carcinoma diagnosis product

    CN119104721A

  • Application of CD146 in diagnosis and treatment of rhabdomyosarcoma

    CN121555639A

  • Recombinant adeno-associated virus vector for targeted delivery of VEGF-C (vascular endothelial growth factor-C) and application of recombinant adeno-associated virus vector in promoting endocardial differentiation to treat coronary heart disease

    CN121653188A

  • Circular rnas for diagnosis of depression and prediction of response to antidepressant treatment

    US20240200139A1