Heat-resistant alpha-galactosidase mutants

By mutating the α-galactosidase AG2 gene, a mutant with improved heat resistance was obtained, solving the problem of enzyme activity loss during feed pelleting and achieving efficient enzyme activity retention under high temperature conditions, which is suitable for the animal feed industry.

CN121991930APending Publication Date: 2026-05-08QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGDAO VLAND BIOTECH GRP CO LTD
Filing Date
2023-05-25
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

The existing α-galactosidase has insufficient heat resistance during feed pelleting, resulting in severe loss of enzyme activity and affecting its application effect in animal feed.

Method used

By mutating the α-galactosidase AG2 gene and introducing specific amino acid substitutions or combinations, mutants with significantly improved heat resistance were obtained, including single-point and multi-point mutants, and their expression in host cells such as Pichia pastoris and Aspergillus niger was optimized.

Benefits of technology

The mutants showed a significant increase in enzyme activity residual rate under high temperature conditions. The single-point mutants increased by 10.47%-96.94% at 67℃, while the multi-point mutants increased by 113.4%-449.7% at 68℃. They are suitable for use in animal feed to improve animal health and feed utilization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering and protein modification, in particular to a heat-resistant alpha-galactosidase mutant. On the basis of alpha-galactosidase AG2, the invention provides at least one protein which is selected from S41H, I108V, S146M, A174W, A176M, N201Y, V202P, K206Y, V211W, A230L, D233S, S239H, A268I, V328I, T347K, T347L, T347Q, H358E, T395K, T395R, V397M, N407A, A459C, A462D, A462Q, T478K, N487L, Q502C, Q539M, Q539Y, A552P, A577S, compared with a wild type, the heat resistance of the mutant is remarkably improved, and wide application of the mutant in feed is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and protein modification technology, and specifically relates to a thermostable α-galactosidase mutant. Background Technology

[0002] α-Galactosidase, also known as melibiase (EC 3.2.1.22), catalyzes the removal of α-1,6-linked galactose residues from various galactoside substrates. α-Galactosidase is widely distributed in nature, especially in bacteria, fungi, and yeasts. Bacterial sources of α-Galactosidase include *Bacillus thermophilus*, *Lactobacillus acidophilus*, *Lactobacillus fermentum*, *Bifidobacterium adolescentis*, and *Bifidobacterium breve*. α-Galactosidase has also been isolated from the extreme thermophilic bacterium *Dunaliella salina* and the marine bacterium *Pseudomonas pseudoalteromonas*. It has also been reported that α-Galactosidase is present in filamentous actinomycetes; for example, it can be isolated from *Streptococcus rubrum* and *Saccharomyces rubrum*. Brouns et al. isolated and purified α-galactosidase from the hyperthermophilic archaea *P2*, a fungus found in high-acidity terrestrial volcanic regions. This α-galactosidase exhibits extremely high thermal stability. Furthermore, among fungi, *Aspergillus oryzae*, *Aspergillus fumigatus*, *Fusarium oxysporum*, *Penicillium spp.*, *Trichophyton spp.*, and *Rhizopus oligosporus* can all serve as sources of α-galactosidase. Wang et al. isolated an α-galactosidase from *Neosatoria fischeri*, and their results showed that it possesses highly specific hydrolytic activity against soy products.

[0003] Soybeans and other legumes are rich protein sources in animal feed, containing high concentrations of soluble oligosaccharides such as raffinose and stachyose. These oligosaccharides cannot be completely digested in the animal's gastrointestinal tract. These undigested sugars, once ingested, promote the growth of harmful bacteria, causing bloating and gastrointestinal disorders, severely damaging animal health and reducing feed efficiency. Therefore, adding α-galactosidase preparations to animal feed can completely remove these excess sugars, inhibit their fermentation in the intestines, alleviate bloating symptoms, prevent harmful pathogens from damaging the animal's intestines, improve animal immunity, increase nutrient absorption, and improve feed utilization.

[0004] For example, Baucells et al. added α-galactosidase preparations to the feed of growing and finishing pigs. The results showed that, compared with the control group, the weight of the growing and finishing pigs in the experimental group was significantly increased, and various indicators were significantly improved. Ghazi et al. added α-galactosidase preparations to soybean feed for broilers. The results showed that the digestibility of soybean feed by broilers was improved, increasing the nutritional value of soybean feed. Dai Qiuzhong et al. studied the effect of adding α-galactosidase preparations to feed on the production performance of yellow-feathered broilers. The results showed that the addition of enzyme preparations could degrade α-galactosides in feed, change the composition of intestinal substrates, promote the growth of beneficial bacteria, inhibit the growth of harmful bacteria, improve the growth status of broilers, significantly reduce the feed conversion ratio in the later stages and throughout the entire growth period, and improve the production performance of the experimental chickens. Miao Zhijun et al. studied the effect of adding α-galactosidase preparations to feed on the weight gain and production performance of Muscovy ducks. The results showed that it could improve the weight gain and production performance of Muscovy ducks.

[0005] Currently, there is a brief high-temperature phase in the pelleted feed production process. Directly adding α-galactosidase to animal feed during pelleting results in extremely low residual enzyme activity. Furthermore, spraying or mixing α-galactosidase into the feed after pelleting not only increases equipment investment but also fails to guarantee the stability of the enzyme preparation and the uniformity of its distribution in the feed. Therefore, improving the temperature tolerance of α-galactosidase is of significant practical importance. Summary of the Invention

[0006] To address the problems of existing technologies, this invention provides a heat-resistant α-galactosidase mutant. Based on α-galactosidase AG2, a large number of mutation screenings were conducted to finally obtain a mutant with significantly improved heat resistance, laying the foundation for its widespread use in the feed industry.

[0007] This invention provides an α-galactosidase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:2, and comprising an amino acid substitution at at least one position selected from the group consisting of: 41, 108, 146, 174, 176, 201, 202, 206, 211, 230, 233, 239, 268, 328, 347, 358, 395, 397, 407, 459, 462, 478, 487, 502, 539, 552, 577, 581, 587, 601, 613, 654, 659, 681, 710.

[0008] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:2.

[0009] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:2.

[0010] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: S41H, I108V, S146M, A174W, A176M, N201Y, V202P, K206Y, V211W, A230L, D233S, S239H, A268I, V328I, T347K, T347L, T347Q, H358E, T395K, T3 95R, V397M, N407A, A459C, A462D, A462Q, T478K, N487L, Q502C, Q539M, Q539Y, A552P, A577 S, A581P, A581R, V587T, S601C, G613F, S654L, Q659I, Q659K, Q659M, Q681D, Q681S, S710R.

[0011] In some embodiments of the present invention, the mutant comprises a combination of substitutions for at least one amino acid from the group consisting of: S41H / I108V; S41H / S146M; S41H / A174W; S41H / A176M; S41H / N201Y; S41H / V202P; S41H / K206Y; S41H / V211W; S41H / A230L; S41H / A268I; S41H / T347K; S41H / H358E; S41H / T395K; S41H / N407A; S41H / N487L; S41H / Q502C; S41H / Q539Y; S41H / A552P; S41H / V587T; S41H / G613F; S41H / S654L; S41H / Q659I; S41H / Q659M; S41H / Q681D; S41H / S710R; V211W / I108V; V211W / S146M; V211W / A174W; V211W / A176M; V211W / N201Y; V211W / V202P; V211W / K206Y; V211W / A230L; V211W / A268I; V211W / T347K; V211W / H358E; V211W / T395K; V211W / N407A; V211W / N487L; V211W / Q502C; V211W / Q539Y; V211W / A552P; V211W / A581R; V211W / V587T; V211W / G613F; V211W / S654L; V211W / Q659I; V211W / Q659M; V211W / Q681D; V211W / S710R; A459C / I108V; A459C / S146M; A459C / A174W; A459C / A176M; A459C / N201Y; A459C / V202P; A459C / K206Y; A459C / A230L; A459C / A268I; A459C / T347K; A459C / H358E; A459C / T395K; A459C / N407A; A459C / N487L; A459C / Q502C; A459C / Q539Y; A459C / A552P; A459C / A581R; A459C / V587T; A459C / G613F; A459C / S654L; A459C / Q659I; A459C / Q659M; A459C / Q681D; A459C / S710R; N487L / I108V; N487L / S146M; N487L / A174W; N487L / A176M; N487L / N201Y; N487L / V202P; N487L / K206Y; N487L / A230L; N487L / A268I; N487L / T347K; N487L / H358E; N487L / T395K; N487L / N407A; N487L / Q502C; N487L / Q539Y; N487L / A552P; N487L / A581R; N487L / V587T; N487L / G613F; N487L / S654L; N487L / Q659I; N487L / Q659M; N487L / Q681D; N487L / S710R; A581R / I108V; A581R / S146M; A581R / A174W; A581R / A176M; A581R / N201Y; A581R / V202P; A581R / K206Y; A581R / A230L; A581R / A268I; A581R / T347K; A581R / H358E; A581R / T395K; A581R / N407A; A581R / A462Q; A581R / Q502C; A581R / Q539Y; A581R / A552P; A581R / V587T; A581R / G613F; A581R / S654L; A581R / Q659I; A581R / Q659M; A581R / Q681D; A581R / S710R; S41H / I108V / S146M; S41H / I108V / A174W; S41H / S146M / A174W; S41H / S146M / D233S; S41H / S146M / S239H; I108V / S146M / N407A / V587T; I108V / S146M / D233S / V587T; I108V / S146M / V328I / H358E; I108V / S146M / D233S / V397M; I108V / S146M / A459C / Q502C; A268I / H358E / N407A; A268I / T347K / H358E / N407A; A268I / T347K / H358E / T395K; A268I / T347K / H358E / V587T; A268I / T347K / H358E / N407A / A459C; S41H / I108V / S146M / A174W; S41H / I108V / S146M / A174W / D233S; S41H / I108V / S146M / A174W / D233S / S239H; S41H / I108V / S146M / D233S; S41H / I108V / S146M / V328I; S41H / I108V / S146M / H358E; S41H / I108V / S146M / N407A; S41H / I108V / S146M / V587T; S41H / I108V / S146M / N407A / V587T; S41H / I108V / S146M / D233S / V587T; S41H / I108V / S146M / V328I / H358E; S41H / I108V / S146M / D233S / V397M; S41H / I108V / S146M / A459C / Q502C; S41H / I108V / S146M / V328I / A459C / Q502C; S41H / I108V / S146M / H358E / A459C / Q502C; S41H / I108V / S146M / V328I / H358E / A459C / Q502C; S41H / I108V / S146M / D233S / V397M / V587T; S41H / I108V / S146M / N407A / A459C / Q502C; S41H / I108V / S146M / D233S / V397M / A459C / Q502C; S41H / I108V / S146M / H358E / N407A / V587T; S41H / I108V / S146M / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / H358E / N407A / A459C / Q502C / V587T ; I108V / S146M / V328I / A459C / Q502C; I108V / S146M / H358E / A459C / Q502C; I108V / S146M / V328I / H358E / A459C / Q502C; I108V / S146M / D233S / V397M / V587T; S146M / H358E / N407A / A459C / Q502C / V587T; S146M / A176M / H358E / N407A / A459C / Q502C / V587T; S146M / N201Y / V202P / H358E / N407A / A459C / Q502C / V587T; S146M / K206Y / H358E / N407A / A459C / Q502C / V587T; S146M / V211W / H358E / N407A / A459C / Q502C / V587T; S146M / A230L / H358E / N407A / A459C / Q502C / V587T; S146M / T347K / H358E / N407A / A459C / Q502C / V587T; A268I / H358E / N407A / A459C / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / Q502C / V587T; A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / A462D / Q502C / V587T ; A268I / T347K / H358E / N407A / A459C / T478K / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / N487L / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / Q502C / Q539Y / V587T; A268I / T347K / H358E / N407A / A459C / Q502C / A552P / V587T; H358E / N407A / A459C / Q502C / V587T; H358E / T395K / N407A / A459C / Q502C / V587T; H358E / N407A / A459C / A462D / Q502C / V587T ; H358E / N407A / A459C / T478K / Q502C / V587T; H358E / N407A / A459C / N487L / Q502C / V587T; H358E / N407A / A459C / Q502C / Q539Y / V587T; H358E / N407A / A459C / Q502C / A552P / V587T; S41H / T95K / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / A462D / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / T478K / Q502C / V587T; S41H / I108V / S146M / T347K / H358EN407A / A459C / N487L / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / Q539Y / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / A552P / V587T; S41H / I108V / S146M / A176M / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / N201Y / V202P / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / K206Y / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / V211W / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A230L / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / A462D / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / T478K / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / N487L / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / Q502C / Q539Y / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / Q502C / A552P / V587T; S41H / I108V / S146M / N201Y / V202P / K206Y / V211W / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / A552P / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / A462D / Q502C / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / A552P / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / G613F / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S654L / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q659I / S710R; I108V / S146M / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / V587TK / Q659M / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q681D / S710R; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / A462D / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / G613F; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S654L; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q659I; S41H / I108V / S146M / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / V587TK / Q659M; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q681D; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S710R; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q659I; S41H / I108V / S146M / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / A552P / V587T / Q659M; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q681D; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / A552P / V587T; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / A462D / Q502C / A552P / V587T; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / A552P / V587T; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / G613F; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S654L; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q659I; I108V / S146M / V211W / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / A552P / V587T / Q659M; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q681D; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S654L / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q659I / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / A552P / V587T / Q659M / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q681D / S710R; S41H / I108V / S146M / N201Y / V202P / K206Y / V211W / H358E / N407A / A459C / Q502C / A552P / A581R / V587T / Q681D; S41H / I108V / S146M / N201Y / V202P / K206Y / V211W / H358E / N407A / A459C / Q502C / A552P / V587T / Q659I / S710R.

[0012] The present invention also relates to DNA molecules encoding the above-mentioned α-galactosidase mutant.

[0013] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0014] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0015] The host cell is Pichia pastoris ( Pichia pastoris ).

[0016] The host cell is Aspergillus niger ( Aspergillus niger ).

[0017] The host cell is Trichoderma reesei.

[0018] This invention is based on wild-type α-galactosidase AG2 and provides a formulation containing at least one enzyme selected from S41H, I108V, S146M, A174W, A176M, N201Y, V202P, K206Y, V211W, A230L, D233S, S239H, A268I, V328I, T347K, T347L, T347Q, H358E, T395K, T395R, and V397. The α-galactosidase mutants with the mutation sites described in M, N407A, A459C, A462D, A462Q, T478K, N487L, Q502C, Q539M, Q539Y, A552P, A577S, A581P, A581R, V587T, S601C, G613F, S654L, Q659I, Q659K, Q659M, Q681D, Q681S, and S710R are provided in this invention. Compared to α-galactosidase AG2, the mutants provided in this invention exhibit significantly improved heat resistance. Among them, the mutant containing the above-mentioned single mutation site provided by the present invention, after being treated at 67°C for 3 min, has an enzyme activity residual rate as high as 40.42%-72.06%, which is 10.47%-96.94% higher than that of the wild type; the mutant containing at least two mutation sites provided by the present invention, after being treated at 68°C for 3 min, has an enzyme activity residual rate of 24.92%-64.21%, which is 113.4%-449.7% higher than that of the wild type.

[0019] In summary, compared with α-galactosidase AG2, the single-point mutants and combined mutants provided by this invention have significantly improved heat resistance, which is beneficial to the widespread application of α-galactosidase in feed. Attached Figure Description

[0020] Figure 1 Image of recombinant plasmid pPIC9K-AG2. Detailed Implementation

[0021] The method of the present invention will be further illustrated below with examples. Experimental methods in the following examples that do not specify specific conditions can generally be operated under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention through these examples. However, the protection and scope of the claims of the present invention are not limited to the specific examples provided, but should include the scope of protection that can be extended by those skilled in the art based on this specification without inventive effort.

[0022] Experimental materials and reagents: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, and vector pPIC9k were purchased from Invitrogen.

[0023] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutation kits from Beijing Bomais Biotechnology Co., Ltd.

[0024] Culture medium formulation: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB+Amp medium: LB medium with 100 μg / mL ampicillin; LB+Kanamycin medium: LB medium with 50 μg / mL kanamycin; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast selection medium (MD medium): 2% glucose, 1.34% YNB, 4×10⁻⁵% biotin, 2% agar powder; BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10⁻⁵% biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10⁻⁵% biotin, 0.5% methanol.

[0025] The present invention will now be described in detail with reference to the embodiments.

[0026] Example 1: Synthesis of α-galactosidase gene and acquisition of recombinant plasmid The α-galactosidase gene was named AG2, with its nucleotide sequence SEQ ID NO: 1 and its encoding amino acid sequence SEQ ID NO: 2. This gene was synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0027] PCR primers were designed based on the 5' end of the gene, containing an EcoRI restriction enzyme site, and PCR primers were designed based on the 3' end, containing a NotI restriction enzyme site. The primer sequences are as follows: 5' primer AG2-F: GGCGAATTCCCCCTGCTATTGGTGCTTCTAA (underlined is the EcoRI restriction enzyme recognition site); 3' primer AG2-R: ATAGCGGCCGCTTATTGTCTTTCAAGAAAAACAAC (underlined is the NotI restriction enzyme recognition site).

[0028] Using the synthesized α-galactosidase AG2 gene SEQ ID NO: 1 as a template, PCR amplification was performed using the above primers. The PCR amplification system consisted of: 1 μL template, 1 μL upstream primer AG2-F, 1 μL downstream primer AG2-R, 10 μL 5×PSBuffer, 4 μL dNTPs (2.5 mM), 1 μL Primer-Star DNA polymerase, and 32 μL ddH2O, with a total reaction volume of 50 μL. The PCR cycling program was as follows: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, and 72℃ for 10 min. The PCR products were recovered from the gel, digested with EcoRI and NotI, and then ligated into the pPIC-9k vector digested with the same enzymes overnight at 16℃. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37℃. After the transformants appeared, the colony PCR was used to verify the positive clones. After sequencing verification, the correct recombinant plasmid pPIC9K-AG2 was finally obtained (Figure 1).

[0029] Example 2 Screening of α-galactosidase mutants To further improve the thermostability of α-galactosidase AG2, the protein structure of the synthesized α-galactosidase AG2 gene was analyzed. The protein has three domains: domain 1 consists of 285 amino acid residues at the N-terminus, domain 2 consists of 349 amino acid residues in the middle, and domain 3 consists of 74 amino acid residues at the C-terminus. The conserved sequence and active site are both located in domain 2. Without disrupting the protein's secondary structure and active site, a large number of mutation sites were screened for, and the results were verified experimentally. Design PCR primers AG2-F1 and AG2-R1: AG2-F1: GGCCCATGGCCCCTGCTATTGGTGCTTCTAA (The underlined part is the NcoI restriction enzyme recognition site); AG2-R1: GGCCTCGAGTTATTGTCTTTCAAGAAAAACAAC (The underlined part is the restriction endonuclease XhoI recognition site).

[0030] Using the α-galactosidase gene AG2 as a template, PCR amplification was performed using the GeneMorph II random mutagenesis PCR kit (Stratagene) with the above primers. The PCR product was recovered from the gel, digested with NcoI and XhoI, and then ligated into the pET-28a vector digested with the same enzymes. The transformed product was then transformed into E. coli BL21(DE3), plated on LB+Kana plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB+Kana medium containing 0.1 mM IPTG was added to each well. The plates were incubated at 37°C and 220 rpm for about 6 h. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break up the cell walls, obtaining E. coli cell lysate containing α-galactosidase.

[0031] 40 μL of lysis buffer was transferred to two new 96-well plates. One plate was treated at 65 °C for 10 min. 40 μL of substrate (3 mg / mL p-nitrophenol-α-D-galactopyranoside solution) was added to both 96-well plates. After reacting at 37 °C for 10 min, 160 μL of stop solution (0.5 mol / L Na2CO3 reagent) was added. The absorbance was measured at 400 nm. Different mutants retained different activities after high-temperature treatment.

[0032] Experimental results showed that some mutations had no effect on the heat resistance of α-galactosidase AG2 protein, while others even worsened its heat resistance or enzyme activity. Additionally, some mutations, although improving the temperature tolerance of α-galactosidase AG2 protein, significantly altered its enzymatic properties, which did not meet the requirements. Finally, the following mutation sites were identified that significantly improved the heat resistance of α-galactosidase AG2 without affecting its enzyme activity and original enzymatic properties: S41H, I108V, S146M, A174W, A176M, N201Y, V202P, K206Y, V211W, A230L, D233S, S239H, A268I, V328I, T347K, T347L, T347Q, H358E, T395K, and T395R. , V397M, N407A, A459C, A462D, A462Q, T478K, N487L, Q502C, Q539M, Q539Y, A552P, A577S , A581P, A581R, V587T, S601C, G613F, S654L, Q659I, Q659K, Q659M, Q681D, Q681S, S710R.

[0033] Based on α-galactosidase AG2, this invention provides enzymes containing S41H, I108V, S146M, A174W, A176M, N201Y, V202P, K206Y, V211W, A230L, D233S, S239H, A268I, V328I, T347K, T347L, T347Q, H358E, T395K, T395R, and V397M. Mutants with a single mutation site: N407A, A459C, A462D, A462Q, T478K, N487L, Q502C, Q539M, Q539Y, A552P, A577S, A581P, A581R, V587T, S601C, G613F, S654L, Q659I, Q659K, Q659M, Q681D, Q681S, S710R.

[0034] The present invention also provides a mutant comprising a combination of two or more mutation sites selected from the above-mentioned heat-resistant mutation sites, which further improves the heat resistance compared to the corresponding single-site mutant.

[0035] Example 3 Construction of Pichia pastoris engineered strains 3.1 Construction of the expression carrier Based on the codon preference of Pichia pastoris, the gene sequences of α-galactosidase AG2 and its mutants were optimized and synthesized by Shanghai Jereh Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0036] Using the mutants described above as templates, amplification was performed using primers AG2-F and AG2-R. The PCR products were recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated into the pPIC-9k vector, which had been digested with the same enzymes, overnight at 16°C. The ligation was then performed and transformed into E. coli DH5α. The transformed plasmids were plated on LB+Amp plates and incubated upside down at 37°C. After the transformants appeared, positive clones were verified by colony PCR. The correct recombinant plasmids were finally obtained after sequencing verification.

[0037] 3.2 Preparation of competent yeast cells Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Afterward, activated GS115 single clones were inoculated into 5 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 18 h. The culture was then transferred to Erlenmeyer flasks containing 50 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was in the range of 1.1–1.3, the cells were centrifuged at 4℃ and 6000 rpm for 3 min. 5 mL of the cells were collected and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 2 mL of pre-cooled sterile water and centrifuged at 4℃ and 6000 rpm for 3 min. The supernatant was gently discarded, and the cells were resuspended in 2 mL of pre-cooled sorbitol (1 mol / L). The cells were then centrifuged at 4℃ and 6000 rpm for 3 min. Centrifuge for 3 minutes, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).

[0038] 3.3 Conversion and Screening The recombinant expression plasmids constructed in Example 2 were linearized with Sac I. After purification and recovery, the linearized fragments were transformed into Pichia pastoris GS115 via electroporation. Recombinant Pichia pastoris strains were screened on MD plates. Single transformants were transferred to BMGY medium and cultured at 30°C and 250 rpm for 1 day with shaking. Then, they were transferred to BMMY medium and cultured at 30°C and 250 rpm with shaking, with 0.5% methanol added daily. After 3 days of induced expression, the bacterial cells were removed by centrifugation, and the supernatant containing α-galactosidase was obtained. The activity of α-galactosidase was then measured.

[0039] The results showed that the activity of α-galactosidase in the fermentation supernatant of the recombinant Pichia pastoris strain expressing α-galactosidase AG2 and its mutants obtained in this invention was 1140-2020 U / ml.

[0040] Methods for determining the enzyme activity of α-galactosidase (1) Definition of enzyme activity unit Under conditions of 37°C and pH 5.0, the amount of enzyme required to release 1 μmol of p-nitrophenol per minute from a 1.5 mg / ml solution of p-nitrophenol-α-D-galactopyranoside is defined as one unit of enzyme activity, U.

[0041] (2) Measurement method Take 0.5 ml of a 3 mg / ml p-nitrophenol-α-D-galactopyranoside solution and add it to a colorimetric tube. Equilibrate at 37℃ for 5 min. Then add 0.5 ml of α-galactosidase enzyme solution, appropriately diluted with pH 5.0 disodium hydrogen phosphate-citric acid buffer and equilibrated at 37℃. Mix well and incubate at 37℃ for 10 min. After the reaction is complete, add 4 ml of 0.5 mol / L Na₂CO₃ reagent and mix well to terminate the reaction. Then cool to room temperature. Using a standard blank sample as a blank control, measure the absorbance AE at 400 nm. Calculate the corresponding ug number of p-nitrophenol R = (AE - b) / K using the regression equation based on the p-nitrophenol standard curve.

[0042] Enzyme activity calculation formula: XD=(R×n) / (10×0.5×139.11).

[0043] In the formula: XD is the activity of α-galactosidase in the enzyme solution, U / ml; R is the calculated number of p-nitrophenol in μg; 10 is the reaction time of 10 min; 0.5 is the volume of enzyme solution added of 0.5 ml; n is the dilution factor of the enzyme solution; 139.11 is the molar mass of p-nitrophenol, 139.11 g / mol.

[0044] Example 4: Heat resistance analysis of α-galactosidase mutants The fermentation supernatant of the Pichia pastoris recombinant strain expressing the α-galactosidase mutant constructed in Example 3 was diluted with pH 5.0 disodium hydrogen phosphate-citric acid buffer (preheated for 10 min) to a concentration of 200 U / mL for α-galactosidase activity. The mixture was thoroughly mixed and treated at 67°C for 3 min. Samples were taken at the end of the treatment and cooled to room temperature before measuring the α-galactosidase activity. The enzyme activity residual rate was calculated as 100% of the enzyme activity of the untreated sample. Specific results are shown in Table 1.

[0045] Enzyme activity residual rate (%) = Enzyme activity after heat treatment / Enzyme activity before heat treatment × 100%.

[0046] Table 1. Analysis of the heat resistance of α-galactosidase single-point mutants α-Galactosidase mutant Enzyme activity residual rate after treatment at 67℃ for 3 minutes Wild-type AG2 36.59% S41H 57.18% I108V 50.54% S146M 48.08% A174W 50.13% A176M 40.42% N201Y 42.49% V202P 42.15% K206Y 53.53% V211W 60.24% A230L 55.16% D233S 50.63% S239H 48.43% A268I 56.74% V328I 58.01% T347K 53.28% T347L 71.95% T347Q 61.31% H358E 60.89% T395K 59.83% T395R 54.1% V397M 46.97% N407A 50.03% A462D 51.53% A462Q 48.5% T478K 52.02% N487L 70.05% Q539M 46.72% Q539Y 55.5% A552P 53.38% A577S 47.29% A581P 50.13% A581R 72.06% V587T 48.94% S601C 47.64% G613F 57.13% S654L 54.04% Q659I 65.73% Q659K 65.42% Q659M 58.78% Q681D 60.31% Q681S 55.4% S710R 60.51% The results are shown in Table 1. Compared with wild-type α-galactosidase AG2, the enzymes provided by this invention contain S41H, I108V, S146M, A174W, A176M, N201Y, V202P, K206Y, V211W, A230L, D233S, S239H, A268I, V328I, T347K, T347L, T347Q, H358E, T395K, T395R, and V397M, respectively. The thermostability of α-galactosidase mutants with single mutation sites (N407A, A459C, A462D, A462Q, T478K, N487L, Q502C, Q539M, Q539Y, A552P, A577S, A581P, A581R, V587T, S601C, G613F, S654L, Q659I, Q659K, Q659M, Q681D, Q681S, S710R) was significantly improved. After treatment at 67℃ for 3 min, the enzyme activity residual rate of the single-site galactosidase mutants reached 40.42%-72.06%, which was 10.47%-96.94% higher than that of the wild type, achieving unexpected technical results.

[0047] In addition, based on wild-type α-galactosidase AG2, this invention provides the following two-point mutants: S41H / I108V, S41H / S146M, A459C / Q502C, and S41H / A174W; three-point mutants: S41H / I108V / S146M, S41H / I108V / A174W, and S41H / S146M / A174W; and S41H / I108V / S146M / A174W, S41H / I108V / S146M / D233S, S41H / I108V / S146M / N407A, S41H / I108V / S146M / V328I, and S41H / I108V / S146M / A174W. Four-point mutants; five-point mutants S41H / I108V / S146M / A174W / D233S, S41H / I108V / S146M / D233S / V397M, S41H / I108V / S146M / A459C / Q502C; six-point mutants S41H / I108V / S146M / A174W / D233S / S239H; and seven-point mutants S41H / I108V / S146M / D233S / V397M / A459C / Q502C, after treatment at 68℃ for 3 min, showed enzyme activity residual rates of 24.92%-64.21%, which was 113.4%-449.7% higher than that of the wild type, and the heat resistance was significantly improved.

[0048] In summary, compared with α-galactosidase AG2, the single-point mutants and combined mutants provided by this invention have significantly improved heat resistance, which is beneficial to the widespread application of α-galactosidase in feed.

Claims

1. An α-galactosidase mutant, characterized in that, The mutant is an α-galactosidase with the amino acid sequence SEQ ID NO:2 containing substitutions or combinations of any one of the following amino acids: H358E; S41H / H358E; V211W / H358E; A459C / H358E; N487L / H358E; A581R / H358E; I108V / S146M / V328I / H358E; A268I / H358E / N407A; A268I / T347K / H358E / N407A; A268I / T347K / H358E / T395K; A268I / T347K / H358E / V587T; A268I / T347K / H358E / N407A / A459C; S41H / I108V / S146M / H358E; S41H / I108V / S146M / V328I / H358E; S41H / I108V / S146M / H358E / A459C / Q502C; S41H / I108V / S146M / V328I / H358E / A459C / Q502C; S41H / I108V / S146M / H358E / N407A / V587T; S41H / I108V / S146M / H358E / N407A / A459C / Q502C / V587T; I108V / S146M / H358E / A459C / Q502C; I108V / S146M / V328I / H358E / A459C / Q502C; S146M / H358E / N407A / A459C / Q502C / V587T; S146M / A176M / H358E / N407A / A459C / Q502C / V587T; S146M / N201Y / V202P / H358E / N407A / A459C / Q502C / V587T; S146M / K206Y / H358E / N407A / A459C / Q502C / V587T; S146M / V211W / H358E / N407A / A459C / Q502C / V587T; S146M / A230L / H358E / N407A / A459C / Q502C / V587T; S146M / T347K / H358E / N407A / A459C / Q502C / V587T; A268I / H358E / N407A / A459C / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / Q502C / V587T; A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / A462D / Q502C / V587T ; A268I / T347K / H358E / N407A / A459C / T478K / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / N487L / Q502C / V587T; A268I / T347K / H358E / N407A / A459C / Q502C / Q539Y / V587T; A268I / T347K / H358E / N407A / A459C / Q502C / A552P / V587T; H358E / N407A / A459C / Q502C / V587T; H358E / T395K / N407A / A459C / Q502C / V587T; H358E / N407A / A459C / A462D / Q502C / V587T ; H358E / N407A / A459C / T478K / Q502C / V587T; H358E / N407A / A459C / N487L / Q502C / V587T; H358E / N407A / A459C / Q502C / Q539Y / V587T; H358E / N407A / A459C / Q502C / A552P / V587T; S41H / T95K / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / A462D / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / T478K / Q502C / V587T; S41H / I108V / S146M / T347K / H358EN407A / A459C / N487L / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / Q539Y / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / A552P / V587T; S41H / I108V / S146M / A176M / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / N201Y / V202P / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / K206Y / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / V211W / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A230L / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / T347K / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / A462D / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / T478K / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / N487L / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / Q502C / Q539Y / V587T; S41H / I108V / S146M / A268I / T347K / H358E / N407A / A459C / Q502C / A552P / V587T; S41H / I108V / S146M / N201Y / V202P / K206Y / V211W / H358E / N407A / A459C / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / A552P / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / A462D / Q502C / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / A552P / V587T; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / G613F / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S654L / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q659I / S710R; I108V / S146M / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / V587TK / Q659M / S710R; I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q681D / S710R; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / A462D / Q502C / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / G613F; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S654L; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q659I; S41H / I108V / S146M / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / V587TK / Q659M; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / Q681D; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / V587T / S710R; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q659I; S41H / I108V / S146M / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / A552P / V587T / Q659M; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q681D; S41H / I108V / S146M / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / N487L / Q502C / A552P / V587T; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / A462D / Q502C / A552P / V587T; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / A552P / V587T; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / G613F; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S654L; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q659I; I108V / S146M / V211W / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / A552P / V587T / Q659M; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q681D; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / S654L / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q659I / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395 / N407A / A459C / Q502C / A552P / V587T / Q659M / S710R; I108V / S146M / V211W / A268I / T347K / H358E / T395K / N407A / A459C / Q502C / A552P / V587T / Q681D / S710R; S41H / I108V / S146M / N201Y / V202P / K206Y / V211W / H358E / N407A / A459C / Q502C / A552P / A581R / V587T / Q681D; S41H / I108V / S146M / N201Y / V202P / K206Y / V211W / H358E / N407A / A459C / Q502C / A552P / V587T / Q659I / S710R.

2. A DNA molecule encoding the α-galactosidase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is a non-plant cell.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris Aspergillus niger (), Aspergillus niger ) or Trichoderma reesei ( Trichoderma reesei Any one of them.

6. The application of the α-galactosidase mutant of claim 1 in feed production.