Method for rapidly identifying drug resistance of fusarium moniliforme to phenamacril

Abstract

The invention discloses identification of nucleotide point mutation of a gene FfMyosin-5 related to fusarium moniliforme myosin 5 and application of the gene FfMyosin-5 in monitoring of resistance of a bactericide JS399-19, and particularly discloses a molecular detection method for identifying drug resistance of 422-site or 218-site amino acid mutation of the fusarium moniliforme FfMyosin-5 gene to JS399-19 and a special primer of the molecular detection method. The molecular detection method provided by the invention is high in sensitivity, good in stability and short in detection period, and can be used for monitoring the resistance gene frequency and the resistance generation and development condition of the field rice fusarium moniliforme to the bactericide JS399-19 in a high-throughput manner.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology. It relates to a myosin 5-related gene of *Bacillus subtilis*, the pathogen of rice seedling blight. FfMyosin-5 The identification of nucleotide point mutations and their application in the detection of resistance to the fungicide cyazofamid, specifically involving a rapid identification method for rice bakanae disease pathogens. FfMyosin-5 Nucleotide point mutations in genes and their molecular detection methods and specific primers for resistance to cyazofamid. Background Technology

[0002] Rice bakanae disease, also known as excessive growth disease or white stalk disease, was first discovered in Japan in 1828. It is a worldwide rice disease, now distributed in rice-growing areas globally, including Asia, Africa, the Americas, and Europe. In my country, rice bakanae disease occurs in all rice-growing regions. It can occur from the seedling stage to the heading stage, with symptoms appearing as early as the 2-4 leaf stage. Typical symptoms include yellowing and chlorosis of leaves, abnormal leaf elongation due to gibberellic acid production, poor root development with shortened roots, and the presence of white to pale pink mold (conidia and conidiophores) at the base of the stem. Other symptoms include significant internode elongation, node bending, numerous aerial roots growing backwards from the nodes, and weakened tillering ability. Rice seedlings typically show symptoms within 20-30 days after transplanting. Severe infection can cause death before heading. Colorless conidia are produced on the leaf sheaths of dead rice plants. Mildly infected plants may still head, but the panicles are short and contain few grains. In my country, 69 fungicides (including single-agent and compound formulations) are registered for the control of rice seedling blight. The active ingredients mainly include prochloraz, carbendazim, thiophanate-methyl, tebuconazole, cyazofamid, fludioxonil, propiconazole, oxadixyl, fluazinam, and ethionine. However, due to the irrational and frequent use of these fungicides, many plant pathogens have developed severe resistance to them. Therefore, major international agrochemical companies have been dedicated to developing novel fungicides with entirely new mechanisms of action and no positive cross-resistance with existing fungicides on the market for the control of rice seedling blight and the management of fungicide resistance.

[0003] Cyazofamid is a fungicide with completely independent intellectual property rights, developed in 1998 by the Jiangsu Base of the National Southern Pesticide Innovation Center. It is mainly used to control diseases caused by Fusarium spores, such as wheat scab, rice bakanae disease, and cotton wilt. Chemically, cyazofamid belongs to the cyanoacrylate class of fungicides. Mechanism of action studies have shown that cyazofamid targets Fusarium spores. Myosin-5The gene encodes myosin and binds to the pocket of the myosin-binding cleft, preventing myosin from binding to F-actin (cytoskeleton), thereby exerting antibacterial activity. The Fungicide Resistance Action Committee (FRAC) classifies cyazofamid as a cyanoacrylate fungicide based on its chemical structure. Cyazofamid obtained pesticide registration in my country in 2007, mainly for controlling diseases caused by Fusarium. Currently, the FRAC classifies its inherent resistance risk as high, requiring resistance risk management during use. Our laboratory obtained rice bakanae disease-resistant strains exhibiting high levels of resistance to cyazofamid in field monitoring, and the resistant strains also showed high survival fitness, indicating that the field resistance risk of rice bakanae disease to cyazofamid is medium to high. Therefore, when using cyazofamid to control rice bakanae disease, it is necessary to strengthen resistance monitoring and provide timely early warning of the occurrence of cyazofamid resistance, so as to guide the scientific use of cyazofamid, delay the development of resistance, and extend the service life of the fungicide.

[0004] Conventional methods for detecting fungicide resistance include mycelial growth rate assay, mycelial dry weight assay, spore germination assay, and agar spreading assay. However, these methods all require the isolation and purification of the pathogen, followed by inoculation onto drug-treated culture medium or onto fungicide-treated living plants or tissues, with results only available after a certain period. Using conventional methods, resistant strains can only be detected when their frequency in the field exceeds 1% (e.g., to detect a 1% frequency resistant strain with a 95% probability, a sample size greater than 300 is required). Therefore, these methods suffer from low sensitivity, high workload, and long experimental cycles.

[0005] With the rapid development of molecular biology techniques and the continuous expansion of their applications, restriction enzyme digestion PCR and allelic specific PCR molecular techniques have begun to be used in the detection of antibiotic resistance in pathogens. Compared with traditional detection methods, these techniques not only save detection time and improve work efficiency, but also enhance detection sensitivity, with a detection frequency of 10... -5 -10 -4 It is more suitable for detecting low-frequency resistance genes and is also considered an ideal method for early diagnosis of resistance in the field. Therefore, molecular detection technology will play an increasingly important role in the sustainable management system of diseases. Summary of the Invention

[0006] Novel E422A or K218N mutant strains of *Bakanaerus jasminoides* (rice bakanae disease pathogen) with cyazofamid resistance were discovered during field monitoring. Both strains exhibit good survival fitness and have the potential for large-scale epidemics in the field. To address the problems existing in the prior art, the present invention aims to provide a cyazofamid resistance-related protein and its encoding gene in *Bakanaerus jasminoides*, and its application as a screening marker for cyazofamid resistance in *Bakanaerus jasminoides* during the identification of cyazofamid resistance.

[0007] To achieve the objectives of this invention, the technical solution is as follows: One object of the present invention is to provide a protein associated with resistance to cyazofamid, the rice bakanae disease pathogen, which is a protein as shown in 1) or 2) below: 1) A protein consisting of the amino acid residue sequence of SEQ ID NO: 21 in the sequence listing; 2) Proteins derived from SEQ ID NO: 21 by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID NO: 21 in the sequence listing and which are associated with cyazofamid resistance function.

[0008] The above SEQ ID NO:21 is shown below: MVRGISRRPK NKGAGAAADG ASGGAKPKKA TFETTKKKEI GVSDTLLLSK VSNEAINDNL 60 KKRFEGHEIY TYIGHVLVSV NPFRDLGIYT DQVLESYMGK NRLEMPPHVF AIAEASYYNM 120 KAYSDNQCVI ISGESGAGKT EAAKRIMQYI ASVSGGESGD IKQIKDMVLA TNPLLESFGN 180 AKTLRNNNSS RFGKYLQIYF NAQGEPVGAD ITNYLLEXSR VVGQITNERN FHIFYQFAKG 240 ASQQYRETFG VQKPETYVYT SRSKCLDVDG IDDLAEFQDT LNAMKVIGLT QAEQDEIFRM 300 LAAILWIGNI QFQEDQGGYA EVIDRSVVDF AAYLLEVTPD QLISGITIRI LTPRNGEVIE 360 SPANPAQAQA TRDALAMAIY SNLFDWIVER INKSLKARQP TTNTIGILDI YGFEIFEKNS 420 FXQLCINYVN EKLQQIFIQL TLKAEQEEYA REQIQWTPIK YFDNKVVCDL IEQIRPVGIF 480 SAMKDATKTA HADPAACDRT FMQSINGMSH AHLTPRQGNF IIKHYAGDVT YTVEGITDKN 540 KDQLLKGLLN LFQHSGNQFV HTLFPRPVDQ DNRKQPPSAG DRIRASANAL VETLMKCQPS 600 YIRTIKPNEN KSPTEYNSPN VLHQIKYLGL QENVRIRRAG FAYRQDFDKF VDRFFLLSPA 660 TSYAGEFTWE GTTEAAVKQI LKDTSIPKEE WQMGVTKAFI KAPETLFALE HMRDRYWHNM 720 ATRIQRMWRA YLAYRAESAT RIQRFWRKKR TGAEYLQLRD HGHQVLGGRK ERRRMSLLGS 780 RRFLGDYLGV NASTGPGAQI RNAASIGTNE KAVFSCRAEI LEAKFGRSSK ASPRIIVVTT 840 NKFYIIAQML VNGHPQISVE KAVPLGAIKF IGASSARDDW FSLGIGSPQE PDPLMNCMLK 900 TEMFTQMQRV MPGGFNLKIA ETIEYAKKPG KMQQVKVLKD SQLPVDYYKS GAVHTQPGEP 960 PSSISRPTPK GKPVPPRPIT RGKLIKPGGP NGRPSRIQGN RTAKPRPGAG RAVPQPPAAV 1020 SNIAAVPAAA AQSTPRIAPR PGANAATPIP AAHNALPSHT RNASGAGRAP PPPPPAVAAR 1080 PPSPPKVMAK VLYDFAGQRE NELTITANEI VEIVQKESNG WWLAKNPQTA QQAWVPAAYV 1140 EEQAPPAPRA PPAPPRSKPT PPAPPAKRPA ANRKPAELQQ RDSGMSLNTP NGGDSRSSTP 1200 TPSLGGSLAD ALLARKNAMQKEKEDDDDW 1229 Among them, X at position 422 from the amino terminus is either E or A; and X at position 218 from the amino terminus is either K or N.

[0009] Among them, in the cyazofamid resistance-related protein of rice bakanae disease bacterium, if the 422nd amino acid is glutamic acid, it is sensitive to cyazofamid; if the 422nd amino acid is mutated from glutamic acid to alanine from the N-terminus, rice bakanae disease bacterium will show resistance to cyazofamid.

[0010] Another type, where the 218th amino acid is lysine, is sensitive to cyazofamid. When the 218th amino acid from the N-terminus is mutated from lysine to asparagine, rice bakanae disease pathogens exhibit resistance to cyazofamid.

[0011] In one embodiment of the present invention, the sequence of the cyazofamid resistance-related protein (myosin 5) of the rice bakanae disease pathogen is shown in SEQ ID NO: 21. When the 422nd amino acid at the N-terminus of SEQ ID NO: 21 is glutamic acid (X = E) and the 218th amino acid at the N-terminus of SEQ ID NO: 21 is lysine (X = K), the rice bakanae disease pathogen is sensitive to cyazofamid.

[0012] When the 422nd amino acid from the N-terminus of SEQ ID NO: 21 is mutated to alanine (X=A), and the 218th amino acid from the N-terminus of SEQ ID NO: 21 is lysine (X=K), the rice bakanae disease pathogen exhibits resistance to cyazofamid.

[0013] In addition, when the 218th amino acid from the N-terminus of SEQ ID NO: 21 is mutated to asparagine (X=N), and the 422nd amino acid from the N-terminus of SEQ ID NO: 21 is glutamic acid (X=E), the rice bakanae disease pathogen exhibits resistance to cyazofamid.

[0014] The present invention also provides a gene encoding a cyazofamid resistance-related protein.

[0015] The genomic nucleotide sequence of the encoding gene is shown in 1), 2), or 3) below: 1) The nucleotide sequence of SEQ ID NO: 22 in the sequence listing; 2) A DNA molecule that can recombine with the DNA sequence described in 1) under strict conditions and encodes a protein related to cyazofamid resistance function; 3) A DNA molecule that has more than 90% homology with the nucleotide sequence of SEQ ID NO: 21 in the sequence listing and encodes a protein related to cyazofamid resistance function.

[0016] The above SEQ ID NO:22 is shown below: atggtacggg tcaaccttta atatcggcgt cttttttggc tgacaacttt tactcaactc 60 tcagggaata tcaagacgcc ctaagaacaa gggcgccggt gcagccgcgg acggcgcaag 120 cggaggcgcg aagcccaaga aggccacctt tgagacaacc aagaagaagg agattggtgt 180 ttccgatctg actctgctga gcaaagtctc caacgaagcc atcaacgata atttgaagaa 240 gcgatttgag ggccacgaaa tttataccta cattggccat gtgttggtct cagtcaaccc 300 tttcagggac ctgggcattt atactgatca ggtcctcgag agctacatgg gcaagaaccg 360 actcgaaatg ccaccacacg tcttcgccat cgccgaggcc tcgtactaca acatgaaggc 420 atacagcgac aaccagtgtg tcattatttc aggagagtca ggagccggaa agaccgaggc 480 ggccaagcgc atcatgcagt acattgctag tgtgtctggt ggagaatccg gagacatcaa 540 gcagattaag gacatggtgc tggcaaccaa ccccttacta gagtctttcg gaaacgcaaa 600 aacacttcga aacaacaatt cctcgcgttt tggcaagtat ctacagatct acttcaacgc 660 ccagggcgaa cccgtgggtg ccgacatcac aaactacctc ctggaaast cacgagtggt 720 gggccagatc acgaacgagc gaaacttcca tatcttttac caattcgcga agggcgcttc 780 acaacaatac cgagaaacat tcggcgttca aaaacccgag acctacgtct ataccagtcg 840 gtcaaaatgc ttggacgtgg acggtatcga cgatctcgcc gagtttcagg acacgcttaa 900 tgccatgaag gttattggcc ttactcaggc tgagcaagat gaaatttttc gaatgctggc 960 ggctatccta tggattggaa atatccagtt tcaggaggat cagggcggct acgcagaggt 1020 tatcgatcga tcagtggttg actttgccgc ttacctgtta gaagttaccc ctgaccagct 1080 catcagcggt atcacaattc gaatcctgac acctcgaaat ggcgaagtca tcgaatcgcc 1140 cgccaaccct gcccaagcac aggctacgcg agatgctctg gcaatggcta tctacagcaa 1200 tcttttcgac tggatcgtcg agcgcattaa caagtctctc aaggcgaggc aaccgacaac 1260 caatacaatc ggcattctgg atatctacgg attcgaaatt ttcgagaaga acagttttgm 1320 gcagctgtgc atcaactacg tcaacgagaa gttgcaacag atcttcattc aactgactct 1380 caaggccgag caggaggaat atgccaggga acagattcaa tggactccta tcaagtactt 1440 cgataacaag gttgtgtgcg accttatcga acagatccgg ccagttggta tcttctctgc 1500 tatgaaggat gccaccaaga ccgcacacgc tgaccctgct gcttgcgatc gcacattcat 1560 gcagagtatc aacggcatgt ctcatgctca tcttacccct cgacaaggaa acttcatcat 1620 caagcattac gctggtgatg tcacctatac tgtcgaaggt attacggaca agaacaagga 1680 tcagcttctc aaggggcttt tgaacctctt ccagcacagt ggaaaccaat ttgttcatac 1740 cctgttccct cggcccgttg accaagataa ccgaaagcag cctccttctg caggcgatcg 1800 catccgagct tccgccaatg ccctggtcga gacgttgatg aagtgccagc cctcatacat 1860 ccgtactatc aagcccaacg agaacaagtc gccaacagaa tataacagcc ctaatgtatt 1920 gcatcagatc aagtatcttg gtcttcaaga aaacgttcgc attcgtcgtg ccggttttgc 1980 ttaccgccaa gatttcgaca agttcgttga tcgattcttc ctcttgtctc ctgctacctc 2040 atacgctggt gaattcactt gggagggaac aactgaggct gctgtaaagc agattctcaa 2100 ggataccagc attcctaagg aagagtggca aatgggtgtt accaaggcct tcatcaaagc 2160 ccctgagacg ctctttgccc ttgagcatat gagagacaga tactggcaca acatggctac 2220 gcgaattcag cgcatgtgga gggcttacct cgcctaccga gccgagtcgg cgacccgaat 2280 tcagcgattc tggcggaaga agcgaaccgg agcagagtac cttcagcttc gtgaccatgg 2340 ccaccaggtc ctgggaggtc gcaaggaaag acgccgtatg agtctgctgg gttctcgacg 2400 attccttggt gactatctgg gtgtcaatgc aagcaccggc cccggagctc agatccgcaa 2460 cgcagctagt attggtacaa acgaaaaggc ggtattttca tgccgtgctg agattctgga 2520 ggccaagttt ggtcgatcca gtaaagcaag ccctcgaatc atcgtcgtca ccaccaacaa 2580 gttctatatc attgctcaaa tgcttgtgaa tggccaccca caaatctcag ttgagaaagc 2640 ggtgcccttg ggagccatca agttcatcgg cgcctcatca gcgcgcgatg attggttctc 2700 gcttggcatt ggctcccctc aggaacctga ccccctcatg aattgtatgc tcaagacaga 2760 aatgtttact cagatgcagc gagtgatgcc cggtggattc aaccttaaga tcgctgagac 2820 aatcgagtat gccaagaagc ccggcaagat gcagcaggtc aaggtcctga aggattcaca 2880 acttccaggt gattactata agagtggtgc tgtgcacacg cagccccggtg agccaccgag 2940 ctccatctct agacctacac ccaagggcaa gcctgtacct cctcgcccca tcactcgagg 3000 caagctgatc aagcctggtg gccccaacgg tcgaccttct cgcatccagg gcaaccgaac 3060 tgccaagcct agaccagggg caggtcgagc cgtgcctcaa ccaccagctg ctgtctctaa 3120 tatcgccgct gttcccgctg ccgcagccca aagcactcct cgtatcgccc ctcgtcctgg 3180 tgccaacgct gctactccaa ttcccgctgc ccacaacgct ctcccaagcc atactcgcaa 3240 tgctagtggc gctggacgtg cacccccacc gccgctcct gctgtcgcag cacgcccacc 3300 aagcccaccc aaggtgatgg ccaaggtctt gtatgacttt gctggcaac gagaaaacga 3360 gctcacaatc accgctaatg agatcgttga gatcgtgcag aaaggaatcca atggtacgct 3420 cgaacctttg acatcggaaa ctgaacatta ctaacatggt tatctaggtt ggtggctagc 3480 caagaaccct caaactgcac aacaggcttg ggtccctgca gcatatgtcg aggaacaagc 3540 tccacctgcg cctcgagctc ctccggctcc tccgcgatcc aagccaacac cccctgcgcc 3600 cccagccaag cgtcctgctg ctaaccgtaa gcctgccgag cttcagcagc gtgactctgg 3660 catgagcctc aatacgccca atggaggaga cagccgcagc agcacaccaa cacccagctt 3720 aggtggggagt ttagcggatg ctcttctggc caggaagaat gctatgcaaa aggaaaagga 3780 ggatgacgat gactggtag 3799 In SEQ ID NO:22, the nucleotide m at position 1320 from the 5' end is either a or c; and the nucleotide s at position 709 from the 5' end is either g or c.

[0017] In one embodiment of the present invention, the encoding gene is as shown in SEQ ID NO:22, wherein the 1320th nucleotide from the 5' end of SEQ ID NO:22 is a (m=a), and the 709th nucleotide from the 5' end of SEQ ID NO:22 is g (s=g), which is a genotype sensitive to cyazofamid.

[0018] Additionally, when the 1320th nucleotide from the 5' end is mutated to c (SEQ ID NO: 22, the 1320th nucleotide from the 5' end is m=c), and the 709th nucleotide from the 5' end of SEQ ID NO: 22 is g (s=g), it is a genotype that shows resistance to cyazofamid (the 1320th nucleotide from the 5' end in its target gene is mutated to C).

[0019] Additionally, when the 709th nucleotide from the 5' end is mutated to g (SEQ ID NO: 22, the 709th nucleotide from the 5' end is s=c) and the 1320th nucleotide from the 5' end of SEQ ID NO: 22 is a (m=a), it is a genotype that shows resistance to cyazofamid (the 709th nucleotide from the 5' end in its target gene is mutated to C).

[0020] Expression cassettes, recombinant expression vectors, or transgenic recombinant bacteria containing the aforementioned coding genes are also within the scope of protection of this invention.

[0021] Another object of the present invention is to provide the application of myosin 5 of rice bakanae disease pathogen or its encoding gene in the identification of rice bakanae disease pathogen resistance to cyazofamid.

[0022] In one embodiment of the present invention, the resistance to cyazofamid is increased by detecting whether the amino acid at position 422 from the N-terminus of myosin 5 of rice bakanae disease changes from glutamic acid to alanine; wherein, myosin 5 of rice bakanae disease is the protein shown in SEQ ID NO: 21 in the sequence listing.

[0023] In another method, the resistance to cyazofamid is increased by detecting whether the amino acid at position 218 of myosin 5 from the N-terminus of rice bakanae disease bacteria changes from lysine to asparagine.

[0024] By testing the myosin 5 gene of rice bakanae disease pathogens, it was found that the nucleotide at position 1320 from the 5' end was c, which increased its resistance to cyazofamid; another gene showed that the nucleotide at position 709 from the 5' end was c, which also increased its resistance to cyazofamid. The gene encoding myosin 5 of rice bakanae disease pathogens is the gene shown in SEQ ID NO: 22.

[0025] Another object of the present invention is to provide a detection or auxiliary detection method for rice bakanae disease. FfMyosin-5 The primer set for determining whether the gene has a mutation site is given by the DNA molecule described in SEQ ID NO: 6 and SEQ ID NO: 7 of the sequence listing.

[0026] The application of the primer set in identifying the resistance of rice bakanae disease pathogen to pesticides is also within the scope of protection of this invention; the pesticide resistance refers to the resistance of rice bakanae disease pathogen to cyazofamid.

[0027] This invention also provides a method for detecting or assisting in the detection of rice seedling pathogens. FfMyosin-5 Methods for determining whether a gene contains a mutation site include the following steps: Using the genomic DNA of the rice bakanae disease strain to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO: 11 and SEQ ID NO: 15. If SEQ ID NO: 11 and SEQ ID NO: 15 can amplify a 474 bp band, then the rice bakanae disease strain to be tested... FfMyosin-5 The gene has or is a candidate for a mutation site.

[0028] In the PCR amplification, the annealing temperature of primer pairs SEQ ID NO: 11 and SEQ ID NO: 15 was 58°C.

[0029] In the method described above, the mutation site refers to the rice bakanae disease pathogen. FfMyosin-5 The nucleotide at position 1320 from the 5' end of the gene is C, which causes the amino acid at position 422 from the N-terminus of myosin 5 of rice bakanae disease to change from glutamic acid to alanine.

[0030] In the method described, the mutated myosin 5 of *Bambusa oryzae* is shown in SEQ ID NO: 21, wherein the 422nd amino acid from the N-terminus of SEQ ID NO: 21 is alanine (GCG = A). In the mutated *Bambusa oryzae*... FfMyosin-5 The gene is shown in SEQ ID NO: 22, wherein the 1320th nucleotide from the 5' end of SEQ ID NO: 22 is c.

[0031] Using the genomic DNA of the rice bakanae disease strain to be tested as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO: 16 and SEQ ID NO: 20. If SEQ ID NO: 16 and SEQ ID NO: 20 can amplify a 388 bp band, then the rice bakanae disease strain to be tested... FfMyosin-5 The gene has or is a candidate for a mutation site.

[0032] In the PCR amplification, the annealing temperature of primer pairs SEQ ID NO: 16 and SEQ ID NO: 20 was 64℃.

[0033] In the method described above, the mutation site refers to the rice bakanae disease pathogen. FfMyosin-5 The 709th nucleotide from the 5' end of the gene is c, which causes the 422nd amino acid from the N-terminus of myosin 5 of rice bakanae disease to be mutated from lysine to asparagine.

[0034] In the method described, the mutated myosin 5 of *Bambusa oryzae* is shown in SEQ ID NO: 21, wherein the 218th amino acid from the N-terminus of SEQ ID NO: 21 is asparagine (N). In the mutated *Bambusa oryzae*... FfMyosin-5 The gene is shown in SEQ ID NO:22, wherein the 709th nucleotide from the 5' end of SEQ ID NO:22 is c.

[0035] The present invention also provides the application of the above method in identifying the resistance of rice bakanae disease pathogens to pesticides; the pesticide resistance refers to the resistance of rice bakanae disease pathogens to cyazofamid.

[0036] Rice bakanae pathogens with the mutation sites have or are candidates to have drug resistance.

[0037] Another object of the present invention is to provide a method for treating rice bakanae disease. FfMyosin-5 Mutation sites in genes or proteins.

[0038] The rice bakanae disease pathogen provided by this invention FfMyosin-5 A mutation site in the gene is the site of the rice bakanae disease. FfMyosin-5 The gene's genomic DNA sequence has a mutation at nucleotide 1320 from the 5' end to c, and this nucleotide mutation exists alone.

[0039] In addition, the rice bakanae disease pathogens provided also include FfMyosin-5 A mutation site in the gene is the site of the rice bakanae disease. FfMyosin-5 The gene's genomic DNA sequence has a mutation at nucleotide position 709 from the 5' end, which is a single nucleotide change.

[0040] The present invention provides a mutation site for myosin 5 in rice bakanae disease, where the 422nd amino acid from the N-terminus of myosin 5 in rice bakanae disease is alanine; another mutation is that the 218th amino acid from the N-terminus of myosin 5 in rice bakanae disease is asparagine.

[0041] The mutation site refers to the genotype that is sensitive to cyazofamid in rice seedling pathogens. FfMyosin-5 The gene undergoes a mutation at position 1320 (5' end) to change to c; additionally, it undergoes a mutation at position 709 (5' end). This results in a change of amino acid 422 (N-terminus) from glutamic acid to alanine in myosin 5, the pathogen of rice bakanae disease. Furthermore, it causes a change of amino acid 218 (N-terminus) from lysine to asparagine in myosin 5.

[0042] The application of any of the above-mentioned mutation sites in identifying the resistance of rice bakanae disease pathogens is also within the scope of protection of this invention; in the above applications, rice bakanae disease pathogens containing the aforementioned mutation sites have or are candidate to have resistance. The resistance refers to the resistance of rice bakanae disease pathogens to cyazofamid.

[0043] The molecular detection method provided by this invention has high sensitivity, good stability, and short detection cycle. It can be used for high-throughput monitoring of the frequency of resistance genes to the fungicide cyazofamid in rice bakanae disease in the field, as well as the occurrence and development of resistance. This enables early warning of resistant diseases, guides timely adjustment of rice bakanae disease control strategies, promotes scientific pesticide use, delays the occurrence and development of drug resistance, and plays an important role in the sustainable management system of the disease.

[0044] The method for detecting point mutations in rice bakanae disease pathogens resistant to cyazofamid provided by this invention can perform highly sensitive, simple, and rapid molecular detection of resistant strains, enabling timely understanding of the dynamics of resistance development. This is of great significance for formulating reasonable disease management plans and effectively controlling the development of resistant populations. Attached Figure Description

[0045] Figure 1 Amino acid sequence alignment of susceptible and resistant strains of rice bakanae disease (E422A) A Rice bakanae disease FfMyosin-5 Gene diagram and location of the E422A point mutation on the gene; B. Comparison of the amino acid sequence of FfMyosin-5 protein in cypermethrin-sensitive and resistant strains of rice.

[0046] LD-5, HLZ-6, and HLZ-15 are susceptible strains; HLW-20, HLW-25, HLM-28, and HLM-10 are resistant strains carrying the E422A point mutation.

[0047] Figure 2 The binding mode of cyazofamid to FfMyosin-5 protein in the rice E422A mutant is shown.

[0048] Figure 3 The sensitivity of the FfMyosin-5 protein E422A transformant to cyazofamid.

[0049] Figure 4 AS-PCR primers and annealing temperatures were screened for the E422A point mutation: A = E422A-F1; B = E422A-F2; C = E422A-F3; D = E422A-F4.

[0050] Figure 5 AS-PCR was used to detect resistant strains of *Bakanaeda bakanae* (rice bakanae disease) with the E422A point mutation (58℃); A. Site specificity, with LD-5, HLZ-6, and HLZ-15 being sensitive strains; HLW-20, HLW-25, HLM-28, and HLM-10 being resistant strains carrying the E422A point mutation; B. Species specificity. Fusarium verticillioides It is Fusarium oxysporum. Fusarium oxysporum It is Fusarium oxysporum. Botrytis cinereaIt is Botrytis cinerea. Pyricularia oryzae It is the rice blast fungus.

[0051] Figure 6 Amino acid sequence alignment of susceptible and resistant strains of rice bakanae disease (K218N) A Rice bakanae disease FfMyosin-5 Gene pattern diagram and the location of the K218N point mutation on the gene; amino acid sequence alignment of FfMyosin-5 protein in rice basil cypermethrin-sensitive and resistant strains.

[0052] HLM-3, HLM-7, HLW-26, ZJM-16, and ZJM-46 are resistant strains carrying the K218N point mutation.

[0053] Figure 7 The binding mode of cyazofamid to FfMyosin-5 protein in the rice basil K218N mutant is shown.

[0054] Figure 8 The sensitivity of the FfMyosin-5 protein K218N transformant to cyazofamid.

[0055] Figure 9 AS-PCR was used to detect the resistance of rice bakanae disease pathogens to the K218N point mutation (64℃); among them, LD-5, HLZ-6 and HLZ-15 were sensitive strains; HLM-3, HLM-7, HLW-26, ZJM-16 and ZJM-46 were resistant strains carrying the K218N point mutation. Fusarium incarnatum It is *Fusarium solani*, Fusarium oxysporum It is Fusarium oxysporum. Botrytis cinerea It is Botrytis cinerea. Pyricularia oryzae It is the rice blast fungus. Detailed Implementation

[0056] The preferred embodiments of the present invention will now be described in detail with reference to the examples. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0058] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0059] The strains described above are only the materials used in the embodiments of the present invention. In fact, when applying the screening markers described in the present invention, any commercially available fungal strains can be used.

[0060] In this article, "resistant strains" refers to rice bakanae disease pathogens that are resistant to the fungicide cyazofamid; "sensitive strains" refers to rice bakanae disease pathogens that are sensitive to the fungicide cyazofamid.

[0061] The rice bacillating strains used in the following examples are: strains LD-5, HLZ-6 and HLZ-15 are susceptible strains; HLW-20, HLW-25, HLM-28 and HLM-10 are resistant strains. In another mutation scenario, HLM-3, HLM-7, HLW-26, ZJM-16, and ZJM-46 are resistant strains.

[0062] The strains HLW-20, HLW-25, and HLW-26 were collected from Sunxiangfu Village, Suihua City, Heilongjiang Province, China; HLM-28, HLM-10, HLM-3, and HLM-27 were collected from Minxing Village, Qinjia Town, Beilin District, Suihua City, Heilongjiang Province; ZJM16 and ZJM-46 were collected from Yanjiang New Village, Jinan Street, Zhuji City, Zhejiang Province, China; LD-4 and LD-5 were collected from Jiangnan Village, Qingshui Town, Dawa District, Zhuji City, Zhejiang Province, China; HLB-4 was collected from Yongheng Village, Shuanghe Town, Beilin District, Suihua City, Heilongjiang Province, China; and HLZ-5 and HLZ-15 were collected from Zhaodong City, Suihua City, Heilongjiang Province, China. All strains were identified as *Bakanaeda jatropha*, the pathogen of rice seedling blight, using existing morphological and molecular biological methods. The resistance of all strains was verified by colony growth assay.

[0063] Example 1: Monitoring of resistance to field-grown cyazofamid, the causal agent of rice seedling blight. Collect rice seedling pathogens from all over the country for field monitoring of pesticide resistance.

[0064] PDA medium: 200 g potato, 18 g glucose, 15 g agar powder, distilled water to a final volume of 1 L, sterilize at 121°C for 20 min.

[0065] The experimental steps are as follows: 1) The parent strain of rice bakanae disease was pre-cultured on PDA medium at 25°C for 4 days, and several mycelial cakes with a diameter of 5 mm were collected. 2) Inoculate the mycelial growth onto PDA medium plates with concentrations of 1 μg / mL and 30 μg / mL cyazofamid, respectively. Inoculate the mycelial growth onto PDA medium plates without the drug as a blank control. Each concentration was replicated three times (corresponding to three plates). Incubate at 25℃ in the dark for 3-5 days, measure the colony diameter, and calculate the inhibition rate of mycelial growth by different concentration treatments. 3) The resistant strain was determined based on the inhibition rate on 1 μg / mL and 30 μg / mL cyazofamid PDA medium plates, as shown in Table 1.

[0066] Table 1. Criteria for determining the resistance of cyazofamid to rice bakanae disease pathogen. Note: IR, Inhibition rate = (CK diameter - Treatment diameter) / CK diameter × 100% Example 2: Sensitivity of rice bakanae disease pathogen to cyazofamid. HLW-20, HLW-25, HLM-28, and HLM-10 were selected from the monitored resistant strains of *Bakanaeda salsa*; LD-5, HLZ-6, and HLZ-15 were selected from the susceptible strains of *Bakanaeda salsa*.

[0067] Another mutation scenario involved selecting HLM-3, HLM-7, HLW-26, ZJM-16, and ZJM-46 from the monitored resistant strains of rice bakanae disease.

[0068] PDA medium: 1000 g potato, 100 g glucose, 15 g agar powder, distilled water to a final volume of 1 L, sterilized by moist heat at 121°C for 20 min.

[0069] The experimental steps are as follows: 1) Cyazofamid is prepared into a concentration of 10 using dimethyl sulfoxide (DMSO) as the solvent. 5 For the sensitivity determination of susceptible strains of rice bakanae disease to cyazofamid, the cyazofamid stock solution was diluted with DMSO to prepare working solutions of corresponding concentrations. The final concentrations of cyazofamid in the drug-treated culture medium were 0.06 µg / mL, 0.6 µg / mL, 3 µg / mL, 6 µg / mL, and 30 µg / mL. For the sensitivity determination of resistant strains of rice bakanae disease to cyazofamid, the cyazofamid stock solution was diluted with DMSO to prepare working solutions of corresponding concentrations. The final concentrations of cyazofamid in the drug-treated culture medium were 1 µg / mL, 5 µg / mL, 10 µg / mL, 20 µg / mL, and 100 µg / mL.

[0070] 2) Cool the sterilized PDA medium to 45°C, add 100 µL of the corresponding drug working solution to 100 mL of PDA medium and mix well. Pour the drug-containing medium into a 9 cm diameter petri dish. Use the untreated medium as a blank control. Perform 3 technical replicates for each concentration of drug-containing medium.

[0071] 3) The rice bakanae pathogen was cultured on a PDA plate in the dark for 4 days. Using a punch, a 5 mm diameter mycelial cake was taken along the edge of the colony and inoculated onto the drug-containing and control culture medium plates prepared according to step 2). The plates were placed in a 25°C incubator in the dark and the colony diameter was measured after 4 days.

[0072] 4) The colony diameter was measured using the cross-multiplication method. Based on the colony diameter, the inhibition rate of each concentration of the agent on the mycelial growth of the tested strain was calculated. The inhibition rate was then converted into a probability value (Y), and the agent concentration was converted into a logarithmic value (X) to base 10. The virulence regression equation Y=a+bX and the correlation coefficient R for the tested rice bakanae strain were calculated using DPS data processing software. 2 and effectively inhibits medium concentrations of EC 50 The value is calculated, and the resistance multiple is determined.

[0073] Resistance ratio = EC50 of resistant strain 50 / EC of susceptible strains 50 The results are shown in Table 2: Table 2. Sensitivity of tested rice basil strains to cyazofamid.

[0074] The susceptibility of rice bakanae disease pathogen to cyazofamid was tested, and the results showed that the average EC5 values ​​of susceptible strains LD-5, HLZ-6, and HLZ-15 were... 50 The concentration was 0.163 µg / mL, while the average EC50 of resistant strains HLW-20, HLW-25, HLM-28, and HLM-10 was 0.163 µg / mL. 50 The average EC50 of HLM-3, HLM-7, HLW-26, ZJM-16 and ZJM-46 was 14.565 µg / mL. 50 >30 µg / mL, all significantly higher than the average EC50 of susceptible strains. 50 As shown in Table 2, it is speculated that this may have a significant impact on the prevention and control of rice seedling blight in the field.

[0075] Example 3: Rice bakanae disease pathogen FfMyosin-5 Discovery of gene and myosin 5 mutation sites I. Strains Culture 1. Strains: The susceptible strains are LD-5, HLZ-6 and HLZ-15, and the resistant strains are HLW-20, HLW-25, HLM-28 and HLM-10.

[0076] Another group of resistant strains are HLM-3, HLM-7, HLW-26, ZJM-16 and ZJM-46.

[0077] 2. Method: Strain culture: *Bakanae nil*, the rice bakanae nil pathogen, was cultured on PDB medium (200 g potato, 18 g glucose, diluted to 1 L with distilled water, sterilized at 121°C for 20 min) at 25°C. Sensitive and resistant strains of the pre-cultured *Bakanae nil* were inoculated onto PDB medium and cultured in the dark at 25°C for 4 days. Mycelia were then collected, frozen in liquid nitrogen, and stored at -80°C for genomic DNA extraction.

[0078] II. Genomic DNA was extracted from susceptible and resistant strains of *Bambusa jirovecii*, respectively: 1) Take an appropriate amount of mycelium that has been frozen in liquid nitrogen, grind it into powder using a mortar and pestle, and place it in a 2 mL centrifuge tube; 2) Add 650 μL of 2% CTAB solution (preheated to 65℃) to the centrifuge tube, then incubate in a water bath at 65℃ for 30 min; 3) Add an equal volume of phenol:chloroform:isoamyl alcohol = 25:24:1 to the centrifuge tube, mix well, and centrifuge at 12000 g for 10 min at room temperature. 4) Transfer 600 μL of supernatant to a new 2 mL sterile centrifuge tube, add an equal volume of chloroform:isoamyl alcohol = 24:1, place on a 3D shaker at 75 r / min, room temperature, for 10 min; 5) Centrifuge at 12000 g, room temperature, for 10 min, then transfer 400 μL of supernatant to a new centrifuge tube and add 0.6 times the volume of isopropanol. Place in a -20℃ freezer for 30 min. 6) Centrifuge at 12000 g, 4℃, for 10 min, discard the supernatant, and keep the precipitate, which is DNA; 7) Add 800 μL of 75% ethanol to the centrifuge tube, gently tap the tube wall to wash the DNA; 8) Centrifuge at 7500 g, 4℃, for 5 min, remove supernatant, and dry under reduced pressure to remove alcohol. 9) Add 30-50 μL of ddH2O to the tube containing DNA, measure the DNA concentration and purity, and store at -20℃ for later use.

[0079] III. Actin Gene of Susceptible Strains of Rice Bakanae disease FfMyosin-5 amplification Use primers FfMyosin-5-F (5'-ATGGTACGGGTCAACCTTTAAT-3', SEQ ID NO:1) and FfMyosin-5-R1 (5'-CCAGACACACTAGCAATG-3', SEQ ID NO:2); FfMyosin-5-YF1 (5'-TAGTGTGTCTGGTGGAGAATC-3', SEQ ID NO :3); FfMyosin-5-YF2 (5'- GATGACTTCGCCATTTCGAGG -3', SEQ ID NO: 4); FfMyosin-5-YF (5'- TTATCTTGGTCAACGGGCCG -3', SEQ ID NO: 5), FfMyosin-5-YR (5'- AGTGGTTGACTTTGCCGCTTA -3', SEQ ID NO :6);FfMyosin-5-MYO-F1 (5'- GAAATGGCGAAGTCATC-3' (SEQ ID NO: 7), FfMyosin-5-MYO-R (5'-CTACCAGTCATCGTCATCCTC-3', SEQ ID NO: 8); FfMyosin-5-G11 (5'-GATGAAGTGCCAGCCCTCAT-3', SEQ ID NO: 9), FfMyosin-5-G10 (5'-ATACGAGGAGTGCTTTGGGC-3', SEQ ID NO: 10); amplified encoding rice bakanae disease pathogen. Myosin-5 The full length of the gene.

[0080] PCR reaction system (50 μL reaction volume): FastPfu Fly DNA Ploymerase 1μL, dNTPs 4 μL, FastPfu Fly Buffer 10 μL, FfMyosin-5-F 1 μL (10 μM), FfMyosin-5-R 1 μL (10 μM), genomic DNA 100 ng (1 μL), ddH2O to a final volume of 50 μL. The PCR reaction program was as follows: 94.0℃ for 3 min; then 94.0℃ for 30 s, 55℃ for 30 s, 72.0℃ for 120 s, for 35 cycles; finally, 72.0℃ for 10 min; store at 12℃.

[0081] The PCR products were sequenced. The results showed that myosin 5 was present in susceptible strains of *Rhizoctonia solani*. FfMyosin-5The gene is 3799 bp in length, as shown in SEQ ID NO: 22, containing 109 bp introns. After removing the introns, its cDNA sequence is 3690 bp in length, encoding the amino acid sequence shown in SEQ ID NO: 21. The 1320th nucleotide from the 5' end of SEQ ID NO: 22 is 'a', and the 422nd amino acid from the N-terminus of SEQ ID NO: 21 is glutamic acid (X=E). The 709th nucleotide from the 5' end of SEQ ID NO: 22 is 'g', encoding the amino acid sequence shown in SEQ ID NO: 21, and the 218th amino acid from the N-terminus of SEQ ID NO: 21 is lysine (X=K).

[0082] Myosin 5, a resistant strain of rice bakanae disease pathogen FfMyosin-5 The gene is 3799 bp in length, as shown in SEQ ID NO:22, and encodes the amino acid sequence shown in SEQ ID NO:21. There are two scenarios: 1) When the 1320th nucleotide from the 5' end of SEQ ID NO: 22 is 'a', and the 709th nucleotide from the 5' end of SEQ ID NO: 22 is mutated to 'c', the corresponding amino acid sequence is that the 422nd amino acid from the N-terminus of the amino acid sequence shown in SEQ ID NO: 21 is glutamic acid (X=E), and the 218th amino acid from the N-terminus of SEQ ID NO: 21 is asparagine (X=N); 2) When the 1320th nucleotide from the 5' end of SEQ ID NO: 22 is mutated to 'c', and the 709th nucleotide from the 5' end of SEQ ID NO: 22 is 'g', the corresponding amino acid sequence is that the 422nd amino acid from the N-terminus of the amino acid sequence shown in SEQ ID NO: 21 is glutamic acid (X=A), and the 218th amino acid from the N-terminus of SEQ ID NO: 21 is asparagine (X=K).

[0083] In this case, X (from the 422nd position of the amino terminus) = E or A. Additionally, X (from the 218th position of the amino terminus) = K or N.

[0084] The above SEQ ID NO:22 is shown below: atggtacggg tcaaccttta atatcggcgt cttttttggc tgacaacttt tactcaactc 60 tcagggaata tcaagacgcc ctaagaacaa gggcgccggt gcagccgcgg acggcgcaag 120 cggaggcgcg aagcccaaga aggccacctt tgagacaacc agagaagg agattggtgt 180 ttccgatctg actctgctga gcaagctc caacgaagcc atcaacgata atttgagaa 240 gcgatttgag ggccacgaaa ttataccta cattggccat gtgttggtct cagtcaaccc 300 ttcagggac ctgggcattt atactgatca ggtcctcgag agctacatgg gcaagaaccg 360 actcgaaatg ccaccacacg tcttcgccat cgccgaggcc tcgtactaca acatgaaggc 420 atacagcgac aaccagtgtg tcattattc aggagtca ggagccggaa agaccgaggc 480 ggccaagcgc atcatgcagt acatgctag tgtgtctggt ggagaatccg gagacatcaa 540 gcagattaag gataggtgc tggcaaccaa ccccttacta gagtctttcg gaaacgcaaa 600 aacacttcga aaacaatt cctcgcgtttt tggcaagtat ctacagatct acttcaacgc 660 ccaggggcgaa cccgtgggtg ccgacatcac aaactacctc ctggaaaast cacgagtggt 720 gggccagatc acgaacgagc gaaacttcca tatctttac caatcgcga agggcgctc 780 acaacaatac cgagaaacat tcggcgttca aaaacccgag acctacgtct ataccagtcg 840 gtcaaaatgc ttggacgtgg acggtatcga cgatctcgcc gagtttcagg acacgcttaa 900 tgccatgaag gttattggcc ttactcaggc tgagcaagat gaaatttttc gaatgctggc 960 ggctatccta tggattggaa atatccagtt tcaggaggat cagggcggct acgcagaggt 1020 tatcgatcga tcagtggttg actttgccgc ttacctgtta gaagttaccc ctgaccagct 1080 catcagcggt atcacaattc gaatcctgac acctcgaaat ggcgaagtca tcgaatcgcc 1140 cgccaaccct gcccaagcac aggctacgcg agatgctctg gcaatggcta tctacagcaa 1200 tcttttcgac tggatcgtcg agcgcattaa caagtctctc aaggcgaggc aaccgacaac 1260 caatacaatc ggcattctgg atatctacgg attcgaaatt ttcgagaaga acagttttgm 1320 gcagctgtgc atcaactacg tcaacgagaa gttgcaacag atcttcattc aactgactct 1380 caaggccgag caggaggaat atgccaggga acagattcaa tggactccta tcaagtactt 1440 cgataacaag gttgtgtgcg accttatcga acagatccgg ccagttggta tcttctctgc 1500 tatgaaggat gccaccaaga ccgcacacgc tgaccctgct gcttgcgatc gcacattcat 1560 gcagagtatc aacggcatgt ctcatgctca tcttacccct cgacaaggaa acttcatcat 1620 caagcattac gctggtgatg tcacctatac tgtcgaaggt attacggaca agaacaagga 1680 tcagcttctc aaggggcttt tgaacctctt ccagcacagt ggaaaccaat ttgttcatac 1740 cctgttccct cggcccgttg accaagataa ccgaaagcag cctccttctg caggcgatcg 1800 catccgagct tccgccaatg ccctggtcga gacgttgatg aagtgccagc cctcatacat 1860 ccgtactatc aagcccaacg agaacaagtc gccaacagaa tataacagcc ctaatgtatt 1920 gcatcagatc aagtatcttg gtcttcaaga aaacgttcgc attcgtcgtg ccggttttgc 1980 ttaccgccaa gatttcgaca agttcgttga tcgattcttc ctcttgtctc ctgctacctc 2040 atacgctggt gaattcactt gggagggaac aactgaggct gctgtaaagc agattctcaa 2100 ggataccagc attcctaagg aagagtggca aatgggtgtt accaaggcct tcatcaaagc 2160 ccctgagacg ctctttgccc ttgagcatat gagagacaga tactggcaca acatggctac 2220 gcgaattcag cgcatgtgga gggcttacct cgcctaccga gccgagtcgg cgacccgaat 2280 tcagcgattc tggcggaaga agcgaaccgg agcagagtac cttcagcttc gtgaccatgg 2340 ccaccaggtc ctgggaggtc gcaaggaaag acgccgtatg agtctgctgg gttctcgacg 2400 attccttggt gactatctgg gtgtcaatgc aagcaccggc cccggagctc agatccgcaa 2460 cgcagctagt attggtacaa acgaaaaggc ggtattttca tgccgtgctg agattctgga 2520 ggccaagttt ggtcgatcca gtaaagcaag ccctcgaatc atcgtcgtca ccaccaacaa 2580 gttctatatc attgctcaaa tgcttgtgaa tggccaccca caaatctcag ttgagaaagc 2640 ggtgcccttg ggagccatca agttcatcgg cgcctcatca gcgcgcgatg attggttctc 2700 gcttggcatt ggctcccctc aggaacctga ccccctcatg aattgtatgc tcaagacaga 2760 aatgtttact cagatgcagc gagtgatgcc cggtggattc aaccttaaga tcgctgagac 2820 aatcgagtat gccaagaagc ccggcaagat gcagcaggtc aaggtcctga aggattcaca 2880 acttccagtt gattactata agagtggtgc tgtgcacacg cagcccggtg agccaccgag 2940 ctccatctct agacctacac ccaagggcaa gcctgtacct cctcgcccca tcactcgagg 3000 caagctgatc aagcctggtg gccccaacgg tcgaccttct cgcatccagg gcaaccgaac 3060 tgccaagcct agaccagggg caggtcgagc cgtgcctcaa ccaccagctg ctgtctctaa 3120 tatcgccgct gttcccgctg ccgcagccca aagcactcct cgtatcgccc ctcgtcctgg 3180 tgccaacgct gctactccaa ttcccgctgc ccacaacgct ctcccaagcc atactcgcaa 3240 tgctagtggc gctggacgtg cacccccacc gccgcctcct gctgtcgcag cacgcccacc 3300 aagcccaccc aaggtgatgg ccaaggtctt gtatgacttt gctggacaac gagaaaacga 3360 gctcacaatc accgctaatg agatcgttga gatcgtgcag aaggaatcca atggtacgct 3420 cgaacctttg acatcggaaa ctgaacatta ctaacatggt tatctaggtt ggtggctagc 3480 caagaaccct caaactgcac aacaggcttg ggtccctgca gcatatgtcg aggaacaagc 3540 tccacctgcg cctcgagctc ctccggctcc tccgcgatcc aagccaacac cccctgcgcc 3600 cccagccaag cgtcctgctg ctaaccgtaa gcctgccgag cttcagcagc gtgactctgg 3660 catgagcctc aatacgccca atggaggaga cagccgcagc agcacaccaa cacccagctt 3720 aggtggggagt ttagcggatg ctcttctggc caggaagaat gctatgcaaa aggaaaagga 3780 ggatgacgat gactggtag 3799 In SEQ ID NO: 22, nucleotide m at position 1320 from the 5' end is either a or c. Additionally, nucleotide s at position 709 from the 5' end is either g or c.

[0085] IV. Sequence Alignment Sensitive strains LD-5, HLZ-6, and HLZ-15, and resistant strains HLW-20, HLW-25, HLM-28, and HLM-10 were respectively tested. Myosin-5 The full-length gene was sequenced. Sequence analysis using DANMAN software revealed the E422A resistance mutation type in cyazofamid-resistant strains. Specific results are as follows: Among the susceptible strains, FfMyosin-5 The genomic DNA sequence of the gene has nucleotide a at position 1320 from the 5' end (nucleotide a from the 5' end of SEQ ID NO: 22), and the corresponding FfMyosin-5 protein has glutamic acid (Glu) at position 422 from the N-terminus (glutamic acid at position 422 from the N-terminus of SEQ ID NO: 21, X=E). However, the resistant strains HLW-20, HLW-25, HLM-28, and HLM-10 contain the gene... Myosin-5 The genomic sequence of FfMyosin-5 has nucleotide c at position 1320 from the 5' end (SEQ ID NO: 22 has nucleotide m=c at position 1320 from the 5' end), and the corresponding FfMyosin-5 protein has alanine (Ala) at position 422 from the N-terminus (SEQ ID NO: 21 has alanine (X=A) at position 422 from the N-terminus). Figure 1 ).

[0086] The results showed that the resistant strain had a mutation in the FfMyosin-5 protein, namely a point mutation at position 1320 from the 5' end of the genome, where G was changed to A (nucleotide m=g at position 1320 from the 5' end of SEQ ID NO: 22). Analysis of the sequencing peak plot showed a clear single peak. This change at position 1320 also led to a mutation at position 422, where glutamic acid was changed to alanine, i.e., the 422nd amino acid at the N-terminus of SEQ ID NO: 21 was alanine (X=A).

[0087] In another mutation scenario, the resistant strains are HLM-3, HLM-7, HLW-26, ZJM-16, and ZJM-46. Myosin-5 The full-length gene was sequenced. Sequence analysis using DANMAN software revealed the K218N resistance mutation type in cyazofamid-resistant strains. Specific results are as follows: Among the susceptible strains, FfMyosin-5 The genomic DNA sequence of the gene has nucleotide g at position 709 from the 5' end (nucleotide g is 709 from the 5' end of SEQ ID NO: 22), and the corresponding FfMyosin-5 protein has lysine (Lys) at position 218 from the N-terminus (lysine (Lys) is 218 from the N-terminus of SEQ ID NO: 21). However, the resistant strains HLM-3, HLM-7, HLW-26, ZJM-16, and ZJM-46 have the same gene sequence. Myosin-5 The genomic sequence of FfMyosin-5 protein has nucleotide c at position 709 from the 5' end (SEQ ID NO: 22, nucleotide s=c at position 709 from the 5' end), and the corresponding FfMyosin-5 protein has asparagine (Asn) at position 218 from the N-terminus (SEQ ID NO: 21, nucleotide 218 from the N-terminus is asparagine (Asn) (X=N) Figure 6 ).

[0088] The results showed that the resistant strain had a mutation in the FfMyosin-5 protein, namely a point mutation at position 709 from the 5' end of the genome, where G was converted to C (nucleotide 709 from the 5' end of SEQ ID NO: 22 is s=c). Analysis of the sequencing peak plot showed a clear single peak. This change in the 709th base also led to a mutation at position 218 of lysine to asparagine, that is, the mutation type of amino acid 218 at the N-terminus of SEQ ID NO: 21 is asparagine (X=N).

[0089] Example 4: Verification of resistance-related mutation sites in rice bakanae disease. I. Sequence Alignment The amino acid sequence of the rice bakanae disease pathogen FfMyosin-5 protein was obtained through sequencing in our laboratory. Crystal structures were retrieved from the Protein Data Bank (PDB) using the NCBI ProteinBLAST tool. The 6UI4 crystal structure showed 97.40% sequence identity with the Myosin-5 protein, indicating high homology. Therefore, the 6UI4 structure can be used as a template for constructing the Myosin-5 structure.

[0090] II. Homology Modeling Based on the template protein's three-dimensional structure file and sequence alignment file, the structural similarity is inferred from the sequence similarity. The Modeller v9.19 program is used to perform homology modeling on the FfMyosin-5 protein, thereby obtaining a reasonable three-dimensional structure model of the target protein, and the protein model is then optimized using molecular mechanics.

[0091] The FfMyosin-5 protein model was structurally optimized using the Amber7 force field. The optimization process was carried out in two steps: first, a 2000-step steepest descent method was used for optimization, and then a 2000-step conjugate gradient method was used for further optimization of the structure. The final result was used as the model for subsequent analysis.

[0092] III. Molecular docking The structures of the constructed FfMyosin-5 and FfMyosin-5-E422A proteins were optimized using molecular mechanics to serve as acceptors for molecular docking. Molecular docking was performed using the AutoDock 4.2.6 software package. The structures of the substrate cyazofamid were obtained, hydrogenated, and optimized using the MOPAC program. The atomic charges of PM3 were calculated. Finally, the structures of the ligand and acceptor were processed using Autodock Tools 1.5.6. The docking box was used to encapsulate the active site. The grid number in the XYZ direction was set to 25.6 × 25.6 × 25.6, the grid spacing was 0.375 Å, the amino acids at positions 422 and 219 were used as the center of the docking box, the number of dockings was set to 200, and the other parameters were left at their default values.

[0093] Results Analysis 1) Interaction between cyazofamid and FfMyosin-5 protein and its mutant E422A To analyze the driving force behind the binding of cyazofamid to Myosin-5 protein and the mutant E422A, this paper analyzes the interaction mode between cyazofamid and Myosin-5 protein. Cyazofamid binds to a hydrophobic pocket composed of 10 amino acid residues, namely Lys539, Ala579, Phe421, Glu422, Ile583, Ile426, Glu217, Leu216, Ser219, and Lys218. Among these, Ser219 and Glu217 bind to cyazofamid through hydrogen bonds. Figure 2 A). It can stably bind cyazofamid to FfMyosin-5, with a binding energy of -6.95 kcal / mol ( Figure 2A). However, after the E422A point mutation occurs in the FfMyosin-5 protein, cyazofamid binds to a hydrophobic pocket composed of nine amino acid residues: Lys539, Phe421, Cys425, Ala422, Ile426, Leu215, Glu217, Ser219, and Lys218. Only Glu217 binds to cyazofamid via a hydrogen bond. Figure 2 B). Not only is the number of amino acid residues involved in molecular interactions reduced, but after the E422A mutation, due to steric hindrance, the posture of cyazofamid changes, altering the amino acids involved in hydrogen bonding and resulting in a decrease in its binding energy to the target site to -6.29 kcal / mol. Figure 2 B), thus enabling the FfMyosin-5-E422A (SEQ ID NO:21 with alanine (A) amino acid at the N-terminus) mutant strain to exhibit resistance.

[0094] 2) Interaction between cyazofamid and FfMyosin-5 protein and its mutant K218N To analyze the driving force behind the binding of cyazofamid to Myosin-5 protein and the mutant K218N, this paper analyzed the interaction mode between cyazofamid and Myosin-5 protein. Cyazofamid binds to a hydrophobic pocket composed of 16 amino acid residues, including Lys218, Met377, Asp542, Ser219, Lys539, Asp538, Asn540, Ala579, Arg582, Phe421, Cys425, Glu422, Glu217, Leu215, Leu216, Ile426, and Lys218. Among these, Lys218 and Asp538 bind to cyazofamid through hydrogen bonds. Figure 7 A). It can stably bind cyazofamid to FfMyosin-5, with a binding energy of -7.17 kcal / mol ( Figure 7 A). However, after the K218N point mutation in the FfMyosin-5 protein, cyazofamid binds to a hydrophobic pocket composed of 11 amino acid residues, including Asp542, Lys574, Arg582, Pro576, Val568, Asn572, Leu549, Leu544, Glu543, Ser381, and Lys218, in which the hydrogen bond between Lys21 and cyazofamid disappears ( Figure 7 B). Not only is the number of amino acid residues involved in molecular interactions reduced, but after the K218N mutation, due to steric hindrance, the posture of cyazofamid changes, altering the amino acids involved in hydrogen bonding interactions, resulting in a decrease in its binding energy to the target site to -5.41 kcal / mol. Figure 7B), thereby enabling the FfMyosin-5-K218N (SEQ ID NO: 21) mutant strain with asparagine (N) at the N-terminus to exhibit resistance.

[0095] V. Conclusion 1) The reason for the resistance of the mutant E422A was investigated using molecular docking. Molecular docking results showed that cyazofamid can bind to the pocket of the myosin 5 binding cleft, preventing myosin from binding to F-actin (cytoskeleton), thereby exerting antibacterial activity. The mutation of Glu422 to Ala422 leads to an alteration in the binding mode of cyazofamid to the target site and a reduction in the number of surrounding amino acid residues involved in the interaction. This decreases the binding ability of cyazofamid to the active site, thus causing the FfMyosin-5-E422A mutant strain to exhibit drug resistance.

[0096] 2) The molecular docking method was used to investigate the cause of resistance in the K218N mutant. Molecular docking results showed that cyazofamid can bind to the pocket of the myosin 5 binding cleft, preventing myosin from binding to F-actin (cytoskeleton), thereby exerting antibacterial activity. The Lys218 mutation to Asn218 alters the binding mode of cyazofamid to the target site and reduces the number of surrounding amino acid residues involved in the interaction, thus decreasing the binding ability of cyazofamid to the active site, thereby causing the FfMyosin-5-K218N mutant strain to exhibit resistance.

[0097] Example 5: Genetic transformation of resistance-related mutation sites in rice bakanae disease. I. E422A genetic transformation 1. Construction of E422A vector PCR amplification of a fragment containing the gene encoding hygromycin phosphotransferase was performed on the HPH plasmid. This fragment contained Aspergillus nidulans (… Aspergillus nidulans ) trpC The promoter and terminator regions of the gene were identified. Primers hph-F / hph-R (Table 3) were designed, and plasmid HPH was used as a template for amplification via LA Tag PCR. hph The gene and PCR product were purified using a gel extraction kit, sequenced, and stored at -20°C until fusion.

[0098] Amplification of 1.2 kb of FfMYO5 using primer pair F / R was performed. Ffmyosin5 The upstream fragment of the gene was purified by PCR using a gel extraction kit, sequenced, and stored at -20°C for fusion.

[0099] Using the two fragments above as templates, the Double-joint PCR technique was used to... hph Fragments and Ffmyosin5The upstream fragment of the gene was ligated using primer pairs FfMYO51.2 kb-F and hph-R.

[0100] Table 3 Primers used for constructing the E422A vector

[0101] 2. Construction of K218N vector The vector construction method is the same as E422A, and the primers involved in K218N are shown in Table 4.

[0102] Table 4 Primers used in the construction of the K218N vector

[0103] 3. Preparation of E422A / K218N protoplasts 1) Activate the wild-type strain onto PDA medium and culture at 25℃ for 2-3 days. Then, take 15 mycelial cakes from the edge of the colony and inoculate them into 100mL of 3% mung bean soup medium. Culture at 25℃, 170 rpm, 12h / 12h light and dark alternation for 7 days. 2) Collect conidia: Filter the mung bean soup culture medium from the previous shake culture step using a sterile 3-layer miracloth filter, collect the filtrate in a 50 mL centrifuge tube, and centrifuge at 4000 rpm for 10 min (room temperature). 3) Discard the supernatant, wash twice with sterile water, centrifuge at 4000 rpm for 10 min each time to collect conidia, resuspend the conidia in YEPD liquid medium, transfer to a 300 mL Erlenmeyer flask, making the final total volume of YEPD liquid medium 100 mL, and incubate at 25℃ and 175 rpm for 12-14 h; 4) Filter the YEPD medium from the previous shaking culture using a sterile 3-layer miracloth filter, wash with 0.7 M NaCl solution, collect the larvae, and resuspend the larvae in 50 mL of 0.7 M NaCl solution; repeat this step of filtering, washing, and resuspending the larvae at least twice until there are essentially no conidia in the larval suspension. 5) Centrifuge the larval suspension at 4000 rpm for 10 min, resuspend the larvae in 30 mL of 0.7 M NaCl solution, centrifuge at 4000 rpm for 10 min, and collect the larvae; 6) Weigh 0.4~0.5 g of the filtered larvae into a 50 mL centrifuge tube (scrape with a spoon), add 20 mL of enzyme hydrolysate, mix well, and place flat in a shaker at 30℃ and 85-90 rpm for 2 h (the lysis can be checked under a microscope every 1 h or 0.5 h). 7) Once the larvae have completely lysed, filter the enzyme hydrolysate through a sterile 3-layer miracloth (or a 500-mesh "Little Sun" filter), transfer the filtrate to a 50 mL centrifuge tube, and centrifuge at 3500 rpm for 5 min. 8) Discard the supernatant, add 10 mL of 0.7 M NaCl solution to resuspend the protoplasts, mix well, centrifuge at 3500 rpm for 5 min to collect the protoplasts; repeat this step once more. 9) Discard the supernatant, add 10 mL of 1×STC Bufffer, mix well, centrifuge at 3500 rpm for 5 min to collect protoplasts; repeat this step once more. 10) Discard the supernatant and adjust the protoplast concentration to 3×10 using 1×STC Bufffer. 7 -5×10 7 Protoplasts are prepared at 8-12 cells / mL, meaning each small square of the hemocytometer contains 8-12 cells. DMSO (Sigma D4540 for cell preservation) is added to bring the final concentration to 7% (v / v). After aliquoting, protoplasts can be stored at -80°C for a short period. Do not repeatedly freeze and thaw the prepared protoplasts.

[0104] 3. PEG-mediated E422A / K218N protoplast transformation 1) Take 200 μL of wild-type protoplasts into a 50 mL centrifuge tube, add 5-10 μg of carrier, mix gently, and let stand at room temperature for 20 min; 2) Add 1 mL of sterile 40% PTC, mix gently, and let stand at room temperature for 20 min (PTC is freshly prepared and quite viscous, so a cut blue pipette tip is required); 3) Add TB3 medium (pre-added with hygromycin at a final concentration of 50 μg / mL) to a final volume of 7.5 mL, and incubate at 90 rpm for 18 h in a shaker at 25℃. 3.4) Centrifuge at 3500 rpm for 5 min, gently discard part of the supernatant leaving about 5 mL of culture, and shake well; 5) Add Bottom agar medium (the temperature should not be too hot, containing hygromycin at a final concentration of 100 μg / mL) to make a final volume of 15 mL. Mix quickly and thoroughly, then pour into a sterile petri dish (9 cm). After the medium solidifies, incubate in a 25°C incubator for 12 h. 6) Covering the plate: Pour 15 mL of Top agar medium (the temperature should not be too hot, 100 μg / mL of hygromycin) onto the upper layer of the medium in step (5). After the medium solidifies, place it in an incubator at 25℃ and incubate for about 3 days. 7) After single colonies grow, use a sterile toothpick to transfer the grown single colonies to PDA medium (containing hygromycin at a final concentration of 100 μg / mL), incubate at 25°C for about 3 days, preserve the grown colonies, and transfer them to drug-free PDA plates for subsequent drug sensitivity testing, and to drug-free PDA plates lined with cellophane for DNA extraction; 4. Verification of the E422A / K218N transformant 1) Suspected transformants were screened using 100 μg / mL hygromycin PDA plates, and genomic DNA was extracted from them for further verification. Verification primers YZ-1 / 2 and YZ-3 / 4 (Table 3) were designed for the upstream crosslinking region (the junction of the Ffmyosin-5 gene 1.2 kb upstream and the hph gene) and the downstream crosslinking region (the junction of the Ffmyosin-5 site-directed mutation 3.0 kb and the target gene). PCR amplification of the Ffmyosin5 gene fragment in the upstream and downstream crosslinking regions, as well as a portion of the hph fragment, verified whether the substitution vector was inserted into the correct position in the transformant genome. The Ffmyosin5 gene fragment was amplified using primer YZ-1 / 4 (Table 3), and the PCR product was purified using a gel extraction kit. Sequencing was then used to verify the type of point mutation.

[0105] 2) Same as the E422A transformant verification, the primers used were YZ-5 / YZ-6 (Table 4).

[0106] IV. Results Analysis 1) Interaction between cyazofamid and FfMyosin-5 protein and its mutant E422A Will FfMyosin-5 The E422A point mutation was transferred into a susceptible strain for genetic transformation, resulting in HLZ-15. E422A The cells were grown on PDA plates containing 1, 5, and 30 μg / mL. Figure 3 HLZ-15 E422A Sensitivity results for cyazofamid showed that the mutant EC 50 And to restore to the resistance level of resistant strains. In summary, it is speculated that... FfMyosin-5 The E422A point mutation is the cause of high-level resistance to cyazofamid in rice bakanae disease in the field.

[0107] 2) Interaction between cyazofamid and FfMyosin-5 protein and its mutant K218N Will FfMyosin-5The K218N point mutation was transformed into a susceptible strain for genetic transformation. The resulting K218N-3, K218N-12, and K218N-23 strains were inoculated onto PDA plates containing 0.2 μg / mL, 1 μg / mL, 5 μg / mL, and 60 μg / mL, respectively, and grown. Figure 8 The sensitivity results of K218N-3, K218N-12, and K218N-23 to cyazofamid showed that their EC50 values ​​were... 50 EC with resistant strains collected in the field 50 Consistent. In conclusion, it is speculated that... FfMyosin-5 The point mutation in K218N is the reason why rice bakanae disease pathogens in the field develop high levels of resistance to cyazofamid.

[0108] V. Conclusion 1) Using genetic transformation technology, three mutants carrying the E422A point mutation were constructed and screened, and named HLZ-15. E422A Subsequently, its susceptibility to cyazofamid was determined. The results showed that HLZ-15... E422A The mutant strain showed a significant inhibition rate at 30 μg / mL compared to the susceptible strain. The E422A mutation significantly enhanced the resistance level of *Bakanae nil* to cyazofamid, restoring its resistance to a level comparable to that of resistant strains isolated from the field. This indicates that the E422A point mutation in the FfMyosin-5 protein is the key reason for the development of cyazofamid resistance in *Bakanae nil*.

[0109] 2) Using the same construction method as described above, they were named K218N-3, K218N-12, and K218N-23, respectively. Subsequently, their susceptibility to cyazofamid was determined. The results showed that the K218N mutation significantly enhanced the resistance level of wild-type susceptible strains of *Bakanaeda jatropha* to cyazofamid, restoring its resistance to a level comparable to that of resistant strains isolated from the field. This indicates that the K218N point mutation in the FfMyosin-5 protein is the key reason for the development of cyazofamid resistance in *Bakanaeda jatropha*.

[0110] Example 6: Method for detecting mutation sites in rice bakanae disease pathogen I. Primer Design 1) The strain used in Example 1 was the same as the strain used in Example 1, and the primers are shown in Table 5. Based on the mutant... FfMyosin-5 Allele-Specific PCR primers were designed based on the gene sequence. The penultimate base of the 3' end of the forward primer was identical to the mutated base. To increase the specificity of the primers, mismatched bases A, T, G, and C were introduced into the last base of the 3' end of the forward primer, respectively. The reverse primers are shown in Table 5.

[0111] Table 5. Primers used in AS-PCR detection of rice bakanae disease pathogen resistance to cyazofamid.

[0112] This method ensures that the mutant of the last base at the 3' end of the upstream primer is consistent, while the last two bases are changed, and amplification is performed by combining different annealing temperatures to improve primer specificity.

[0113] The PCR reaction system is as follows: PCR system of 20 μL: Easy Taq 0.5 μL, dNTPs 2 μL, Easy Taq Buffer 2 μL, E422A-F (1 / 2 / 3 / 4) 0.8 μL (10 μM), E422A-R 0.8 μL (10 μM), genomic DNA 100 ng (1 μL), ddH2O to 20 μL.

[0114] The PCR reaction conditions were as follows: first, 94℃ for 3 min; then 94℃ for 30 s, 55-65℃ for 30 s, 72℃ for 45 s, for 35 cycles; finally, 72℃ for 10 min; and stored at 12℃.

[0115] PCR amplification results showed that E422A-F1 could amplify a 474 bp band from resistant strains at an annealing temperature of 58℃, but could not amplify a band from sensitive strains. Figure 4 A) Considering primer specificity, E422A-F1 / E422A-R was selected. The above results indicate that primer pair E422A-F1 / E422A-R can detect the E422A resistance site separately. Therefore, primer pair E422A-F1 / E422A-R (58℃) was selected as the AS-PCR primer to detect the aforementioned mutation site. The amplification product of primer E422A-F1 / E422A-R is nucleotides 1296-1769 of SEQ ID NO: 22.

[0116] Detecting mutation sites Using the genomic DNA of the rice bakanae disease pathogen as a template, PCR amplification was performed with primer pair E422A-F1 / E422A-R, followed by agarose gel electrophoresis detection. If a fragment could be amplified from the genomic DNA of the strain, the strain was determined to be a resistant strain; if no fragment could be amplified, the tested rice bakanae disease strain was determined to be a susceptible strain.

[0117] The PCR amplification system and reaction conditions were the same as in the experiment, and the annealing temperature of the primer pair E422A-F1 / E422A-R was 58℃.

[0118] The target strains for primer pair E422A-F1 / E422A-R were: resistant strains HLW-20, HLW-25, HLM-28 and HLM-10; and sensitive strains LD-5, HLZ-6 and HLZ-15.

[0119] The results showed that primer pair E422A-F1 / E422A-R could only amplify a 474 bp fragment from resistant strains at an annealing temperature of 58℃, but could not amplify a band from sensitive strains. Figure 4 A, 5).

[0120] Therefore, using primer pair E422A-F1 / E422A-R, under an annealing temperature of 58℃, it is possible to effectively detect rice bakanae disease pathogens resistant to cyazofamid.

[0121] 2) AS-PCR primers were designed based on the K218N mutation site on myosin. The last two bases of the 3' end of the forward primer were mismatched with the target sequence, and primers with two base mismatches of C / T / A / G were designed. The primers are shown in Table 6.

[0122] Table 6. Primers used in AS-PCR detection of rice bakanae disease pathogen resistance to cyazofamid. Primers Sequence (5'-3') K218N-1 GCTACATGGGCAAGAACCGACT (SEQ ID NO:16) K218N-2 ATCTGGCCCACCACTCGTGAGG (SEQ ID NO:17) K218N-3 ATCTGGCCCACCACTCGTGAGA (SEQ ID NO:18) K218N-4 ATCTGGCCCACCACTCGTGAGC (SEQ ID NO:19) K218N-5 ATCTGGCCCACCACTCGTGAGT (SEQ ID NO:20) The PCR reaction system is as follows: PCR system of 20 μL: Easy Taq 0.5 μL, dNTPs 2 μL, Easy Taq Buffer 2 μL, K218N-F (1 / 2 / 3 / 4) 0.8 μL (10 μM), K218N-5 0.8 μL (10 μM), genomic DNA 100 ng (1 μL), ddH2O to 20 μL.

[0123] The PCR reaction conditions were as follows: first, 94℃ for 3 min; then 94℃ for 30 s, 55-65℃ for 30 s, 72℃ for 45 s, for 35 cycles; finally, 72℃ for 10 min; and stored at 12℃.

[0124] PCR amplification results showed that K218N-1 could amplify a 388 bp band from resistant strains at an annealing temperature of 64℃, but could not amplify a band from sensitive strains. Figure 9Considering primer specificity, K218N-1 / K218N-5 was selected. The above results indicate that primer pair K218N-1 / K218N-5 can detect the K218N resistance site separately. Therefore, primer pair K218N-1 / K218N-5 (64℃) was selected as the AS-PCR primer to detect the aforementioned mutation site. The amplification product of primer K218N-1 / K218N-5 is nucleotides 341-729 of SEQ ID NO: 22.

[0125] Detecting mutation sites Using the genomic DNA of the rice bakanae disease pathogen as a template, PCR amplification was performed with primer pair K218N-1 / K218N-5, followed by agarose gel electrophoresis detection. If a fragment could be amplified from the genomic DNA of the strain, the strain was determined to be a resistant strain; if no fragment could be amplified, the tested rice bakanae disease strain was determined to be a susceptible strain.

[0126] The PCR amplification system and reaction conditions were the same as in the experiment, and the annealing temperature of the primer pair K218N-1 / K218N-5 was 64℃.

[0127] The test strains for primer pair K218N-1 / K218N-5 are: resistant strains HLM-3, HLM-7, HLW-26, ZJM-16, and ZJM-46; and sensitive strains LD-5, HLZ-6, and HLZ-15.

[0128] The results showed that primer pair K218N-1 / K218N-5 could only amplify a 388 bp fragment from resistant strains at an annealing temperature of 64℃, but could not amplify a band from sensitive strains. Figure 9 ).

[0129] Therefore, using primer pair K218N-1 / K218N-5 and annealing at 64℃, it is possible to effectively detect rice bakanae disease pathogens resistant to cyazofamid.

Claims

1. The protein associated with resistance to cyazofamid in rice bakanae disease is the protein shown in 1) or 2) below: 1) A protein consisting of the amino acid residue sequence of SEQ ID NO:21 in the sequence listing; 2) Proteins derived from SEQ ID NO:21 by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID NO:21 in the sequence listing and which are associated with cyazofamid resistance function; In SEQ ID NO:21, X = E or A from position 422 of the amino terminus, and X = K or N from position 218 of the amino terminus.

2. The gene encoding the rice bakanae disease pathogen's resistance-related protein to cyazofamid as described in claim 1.

3. The encoding gene according to claim 2, characterized in that: The genomic DNA sequence of the encoding gene is shown in 1), 2), or 3) below: 1) The nucleotide sequence of SEQ ID NO:22 in the sequence listing; 2) A DNA molecule that can recombine with the genomic DNA sequence described in 1) under strict conditions and encodes a protein associated with cyazofamid resistance; 3) A DNA molecule that has more than 90% homology with the nucleotide sequence of SEQ ID NO:22 in the sequence listing and encodes a protein related to cyazofamid resistance function; In SEQ ID NO:22, nucleotide m at position 1320 from the 5' end is either a or c. Additionally, nucleotide s at position 709 from the 5' end is either g or c.

4. An expression cassette, recombinant expression vector, or transgenic recombinant bacteria containing the coding gene as described in claim 2 or 3.

5. Application of myosin 5 or its encoding gene of rice bakanae disease pathogen in identifying rice bakanae disease resistance.

6. The application according to claim 5, characterized in that, By detecting whether the amino acid at position 422 from the N-terminus of myosin 5 of rice bakanae disease changes from glutamic acid to alanine, and whether the amino acid at position 218 from the N-terminus changes from lysine to asparagine, the above changes will increase the resistance of rice bakanae disease to cyazofamid; wherein, rice bakanae disease myosin 5 is the protein described in claim 1.

7. The application according to claim 5, characterized in that, By detecting that the genomic DNA encoding myosin 5 of *Bambusa oryzae* contains nucleotide 1320 (a) from the 5' end, a mutation at position 1320 to nucleotide 1320 results in increased resistance to cyathione; alternatively, nucleotide 709 (g) from the 5' end also results in increased resistance to cyathione if nucleotide 709 is mutated to nucleotide 1320. The encoding gene for myosin 5 of *Bambusa oryzae* is the gene shown in claim 2 or 3.

8. A primer set for detecting or assisting in the detection of whether there is a mutation site in the FfMyosin-5 gene of rice bakanae disease fungus, comprising DNA molecules shown in SEQ ID NO:11 and SEQ ID NO:15, as well as DNA molecules shown in SEQ ID NO:16 and SEQ ID NO:20 in the sequence listing.

9. A method for detecting or assisting in the detection of the presence of a mutation site in the FfMyosin-5 gene of rice bakanae disease pathogen, comprising the following steps: Using the genomic DNA of the rice bakanae disease pathogen to be tested as a template, PCR amplification was performed using a primer pair consisting of the fragment shown in SEQ ID NO:11 and the fragment shown in SEQ ID NO:

15. If the primer pair consisting of the fragment shown in SEQ ID NO:11 and the fragment shown in SEQ ID NO:15 can amplify a 474bp band, then the FfMyosin-5 gene in the rice bakanae disease pathogen to be tested has or has a candidate mutation site. Another mutation site is obtained by using the genomic DNA of the rice bakanae disease pathogen to be tested as a template and performing PCR amplification with a primer pair consisting of the fragment shown in SEQ ID NO:16 and the fragment shown in SEQ ID NO:

20. If the primer pair consisting of the fragment shown in SEQ ID NO:16 and the fragment shown in SEQ ID NO:20 can amplify a 388bp band, then the FfMyosin-5 gene in the rice bakanae disease pathogen to be tested has or is a candidate for a mutation site. Preferably, in the PCR amplification, the annealing temperature for SEQ ID NO:11 and SEQ ID NO:15 is 58°C. The annealing temperature for another mutation, SEQ ID NO:16 and SEQ ID NO:20, is 64°C. Preferably, the mutation site refers to the mutation of nucleotide 1320 from the 5' end of the FfMyosin-5 gene in rice bakanae disease to c, thereby causing amino acid 422 from the N-terminus of myosin 5 in rice bakanae disease to change from glutamic acid to alanine. Another mutation feature is that the mutation site refers to the mutation of nucleotide 709 from the 5' end of the FfMyosin-5 gene in rice bakanae disease to c, which causes the amino acid 218 from the N-terminus of myosin 5 in rice bakanae disease to change from lysine to asparagine. Preferably, the mutated myosin 5 of *Rhizoctonia solani* is shown in SEQ ID NO:21, wherein, The 422nd amino acid from the N-terminus of SEQ ID NO:21 is alanine; the FfMyosin-5 encoding gene in the mutant rice bakanae disease is shown in SEQ ID NO:22, where the 1320th nucleotide from the 5' end of SEQ ID NO:22 is c; Another characteristic is that: the mutated rice bakanae disease pathogen myosin 5 is shown in SEQ ID NO:21, wherein the 218th amino acid from the N-terminus of SEQ ID NO:21 is asparagine; the FfMyosin-5 encoding gene in the mutated rice bakanae disease pathogen is shown in SEQ ID NO:22, wherein the 709th nucleotide from the 5' end of SEQ ID NO:22 is c.

10. The application of the primer set shown in claim 8 or the method shown in claim 9 in identifying the resistance of rice bakanae disease pathogen to azoxystrobin; wherein the resistance is the resistance of rice bakanae disease pathogen to cyazofamid; Preferably, the rice bakanae pathogen with the mutation site has or is candidate to have drug resistance.

Images