SNR protein mutant as well as coding gene and application thereof

Abstract

The invention provides an SNR protein mutant as well as a coding gene and application thereof, and belongs to the technical field of plant genetic engineering. Three different target sequences are selected from the rice SNR gene, three different SNR gene mutants are obtained after gene knockout, and after the three SNR mutant genes are transferred into rice, the rice plant height reduction effect is mild, the progeny fertility is good, and meanwhile other agronomic characters such as thousand seed weight are not obviously changed.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to an SNR protein mutant, the encoding gene of the SNR protein mutant, and their applications. Background Technology

[0002] With a continuously growing global population, the demand for food is constantly rising. Rice, as one of the world's major food crops, is the staple food for approximately 3.5 billion people globally. Increasing rice yield per unit area directly increases total food production, alleviating food shortages and preventing famine or social unrest caused by insufficient food supply. This is especially important for countries where rice is a staple food (such as China, India, and Japan), as it reduces reliance on imported food and ensures national food security. In recent years, urbanization and industrialization have consumed vast amounts of arable land, leading to a year-on-year decrease in global arable land area. Increasing rice yield per unit area allows for the production of more food on limited arable land, avoiding excessive clearing of forests, wetlands, and other ecologically fragile areas to expand planting areas, thus protecting biodiversity and the ecological environment.

[0003] Plant height is a crucial factor determining crop yield. Excessively tall plants often result in thin stems, reduced load-bearing capacity, and increased susceptibility to lodging. Lodging in rice (stem breakage or tilting) hinders photosynthesis, affecting nutrient transport and grain filling, while also inhibiting root development, ultimately reducing yield. Lodging also exacerbates pests and diseases, further damaging the appearance and nutritional structure of rice, increasing harvesting difficulty, and lowering its processing quality and commercial value. Studies show that lodging can cause yield losses of 10%–30%, and in severe cases, even more than 50%. Semi-dwarf or dwarf varieties typically possess lodging resistance; therefore, utilizing dwarf or semi-dwarf mutant genes or resources to improve rice varieties and reduce plant height is currently the most important method for enhancing rice's lodging resistance. However, excessive dwarfing typically leads to negative consequences such as smaller seeds, difficulty in heading, reduced photosynthetic efficiency, limited yield potential, weakened stress resistance, premature aging, and difficulties in mechanized harvesting. In particular, current dwarf and semi-dwarf genes generally reduce rice plant height by 30%–50%, a reduction that is too significant and severely limits their application in breeding. More than sixty known dwarf and semi-dwarf mutants that reduce plant height cause a decrease in important agronomic traits such as thousand-grain weight, especially poor fertility, resulting in limited applicability in practical variety improvement. Therefore, most dwarf and semi-dwarf genes are difficult to utilize in agricultural production, especially in rice breeding.

[0004] Since the last century, the gibberellin-deficient semi-dwarf plant type gene (rice sd-1 gene) has been the most important resource for improving lodging resistance and increasing rice yield. However, the large-scale application of this single gene worldwide has raised a series of scientific and social issues. Therefore, we urgently need to develop new, applicable rice dwarf and semi-dwarf genes and germplasm resources. Summary of the Invention

[0005] To address the aforementioned issues, this invention selects three different segments from the SNR gene sequence of wild-type rice as target sequences for gene knockout. It was found that knocking out the SNR gene can mildly reduce the plant height of rice while maintaining good reproductive capacity in offspring, while other agronomic traits such as thousand-grain weight remain largely unchanged.

[0006] To achieve the above objectives, the first aspect of the present invention provides an SNR protein mutant, wherein the amino acid sequence of the SNR protein mutant is any one of the following three: SEQ ID No. 21, SEQ ID No. 23, or SEQ ID No. 25.

[0007] A second aspect of the present invention provides a nucleic acid molecule that encodes any one of the following SNR protein mutants: the SNR protein mutant shown in SEQ ID No. 21, the SNR protein mutant shown in SEQ ID No. 23, and the SNR protein mutant shown in SEQ ID No. 25.

[0008] In a preferred embodiment, the nucleotide sequence encoding the protein mutant shown in SEQ ID No. 21 is shown in SEQ ID No. 20; the nucleotide sequence encoding the protein mutant shown in SEQ ID No. 23 is shown in SEQ ID No. 22; and the nucleotide sequence encoding the protein mutant shown in SEQ ID No. 25 is shown in SEQ ID No. 24.

[0009] A third aspect of the present invention provides a recombinant expression vector comprising the nucleic acid molecule.

[0010] A fourth aspect of the present invention provides a genetically engineered bacterium, the genetically engineered bacterium comprising the recombinant expression vector; or the genome of the genetically engineered bacterium contains the nucleic acid molecule.

[0011] In a preferred embodiment, the host of the genetically engineered bacteria is Agrobacterium EHA105.

[0012] The fifth aspect of this invention provides the application of the SNR protein mutant, the nucleic acid molecule, the recombinant expression vector, and the genetically engineered bacteria in reducing the plant height of rice.

[0013] The sixth aspect of this invention provides the application of the SNR protein mutant, the nucleic acid molecule, the recombinant expression vector, and the genetically engineered bacteria in the cultivation of semi-dwarf rice varieties with passage function.

[0014] A seventh aspect of the present invention provides a method for cultivating semi-dwarf rice, comprising at least one of the following methods: (1) Gene editing of the target rice to make the gene of the target rice encode the SNR protein mutant of claim 1; (2) Introducing the nucleic acid molecule as described in claim 2 or 3 into the cells of the target rice; (3) Transform the recombinant expression vector of claim 4 into the target rice; (4) Transform the genetically engineered bacteria described in claim 5 or 6 into the target rice.

[0015] In the preferred embodiment, any one of the methods (1) to (4) includes the following steps: selecting three different target sequences from the rice SNR gene, using CRISPR / Cas as the gene editing tool to knock out the rice SNR gene, wherein the three different target sequences are shown as SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7 respectively.

[0016] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention provides three SNR protein mutants, each of which reduces rice plant height by 20%–23%, exhibiting a milder height reduction effect. Furthermore, the offspring all demonstrate good fertility, and important agronomic traits such as thousand-grain weight remain largely unchanged. This invention provides new tools and methods for cultivating new rice germplasm resources. Attached Figure Description

[0017] Figure 1 This is a comparison of the appearance of wild-type control rice JY199 and the semi-dwarf mutant sd13 in this invention.

[0018] Figure 2 This is a comparison of plant height and internode length between the control rice JY199 and the semi-dwarf mutant sd13 in this invention. Figure A shows a comparison of the apparent height of the main stem of rice with mature panicles; Figure B shows a comparison of the apparent length of the panicle and the five internode segments, with the control JY199 on the left and the semi-dwarf mutant sd13 on the right in each comparison group in Figure B; Figure C is a bar chart comparing rice plant height; Figure D is a bar chart comparing rice panicle length and internode length; in the figures, JY199 represents the control JY199 rice, and sd13 represents the semi-dwarf mutant sd13. "Indicates a significant difference, no " The symbol indicates that there is no significant difference.

[0019] Figure 3 These are statistical results of important agronomic traits of the control rice Jiayu 199 and the semi-dwarf mutant sd13 in this invention; wherein, Figure A is the mutant phenotypic classification diagram, Figure B is the statistical results of effective panicles, Figure C is the statistical results of thousand-grain weight, and Figure D is the pollen viability detection results; in Figures B, C, and D, JY199 represents the control rice Jiayu 199, and sd13 represents the semi-dwarf mutant sd13. "Indicates a significant difference, no " The symbol indicates that there is no significant difference.

[0020] Figure 4 Figure A shows the results of validating the semi-dwarf gene sd13 in this invention. Figure A shows the region where the semi-dwarf gene sd13 is located by BSA sequencing. E1-E9 represent the 9 exons, I1-I8 represent the 8 introns, and T represents the transmembrane domain. Figure B shows the expression level of the SNR gene in rice plants detected by qPCR. Figure C is a bar chart of rice plant height at maturity. In Figures B and C, JY199 represents the control rice Jiayu 199, sd13 represents the semi-dwarf mutant sd13, and sd13-SNR represents the transgenic plant obtained by introducing the CDS sequence of the rice SNR gene into the semi-dwarf mutant sd13.

[0021] Figure 5 This is a schematic diagram of the gene mutation sites of the semi-dwarf mutant sd13 obtained in this invention.

[0022] Figure 6 This is a schematic diagram of gene locus mutations in three rice mutants constructed using three different target sequences, SNR1, SNR2, and SNR3, in this invention.

[0023] Figure 7 The three obtained in this invention SNR Statistical results of major agronomic traits of transgenic lines with mutations at different gene sites; Figure A is a bar chart comparing plant height of transgenic lines SNR1, SNR2 and SNR3; Figure B is a bar chart comparing thousand-grain weight of transgenic lines SNR1, SNR2 and SNR3; the same letters in the figures represent no significant differences, different letters represent significant differences, and ZH11 represents Zhonghua 11 rice. Detailed Implementation

[0024] The following description, in conjunction with embodiments, clearly and completely describes the technical solutions of this application, so that those skilled in the art can fully understand this application. Obviously, the described embodiments are merely some preferred embodiments of this application, and not all embodiments. Any equivalent modifications or substitutions made by those skilled in the art to the following embodiments without creative effort are within the protection scope of this application.

[0025] The inventor of this application utilizes 60 After Co-γ-ray mutagenesis of conventional indica rice Jiayu 199 (JY199), a new rice semi-dwarf mutant with reduced plant height, sd13, was obtained (e.g., Figure 1 As shown). The plant height of the semi-dwarf mutant sd13 was significantly lower than that of the control JY199 (as shown). Figure 2 (As shown). From Figure 2 As can be seen, the spike length, first internode length, second internode length, third internode length, and fourth internode length of the semi-dwarf mutant sd13 are all significantly reduced compared to the corresponding lengths of the control JY199, with only the fifth internode length near the base showing no significant difference. Important agronomic traits of this mutant, including effective spike, thousand-grain weight, and pollen viability, were tested, and the results are as follows: Figure 3 As shown. From Figure 3 As can be seen, the effective spike and pollen viability of the semi-dwarf mutant sd13 are not significantly different from the corresponding agronomic traits of the control JY199, except that the thousand-grain weight is significantly reduced compared to the wild type.

[0026] The inventors utilized genetics combined with molecular biology techniques to construct a genetic segregating population using the semi-dwarf mutant sd13 as the parent. Individual plants exhibiting the target mutant phenotype were screened, and grouped-samples-associated-segregate (BSA) sequencing was performed. The MutMap method was then used to perform localization analysis on the sequencing data. The analysis results showed that the semi-dwarf gene controlling the mutant plant height... sd13 Located at the LOC_Os04g37670 gene locus on chromosome 4 (e.g. Figure 4 (As shown in Figure A). LOC_Os04g37670 encodes a novel steroid nuclear receptor (SNR) protein. It was also discovered that... SNR The gene showed differential expression in the control JY199 and the semi-dwarf mutant sd13; that is, it was expressed in the control JY199 but not detected in the semi-dwarf mutant sd13 (e.g., Figure 4 (As shown in Figure B). Transformed into the semi-dwarf mutant sd13. SNR The full-length CDS of the gene can be used to increase the height of transgenic plants to the same level as JY199 (e.g., Figure 4 (As shown in Figure C). This proves that, SNRThe gene is the semi-dwarf gene that controls the height of mutant plants. SNR A gene consists of 9 exons and 8 introns (e.g.) Figure 4 As shown in Figure A), its CDS sequence is shown in SEQ ID No. 1. SNR The amino acid sequence encoded by the gene is shown in SEQ ID No. 2. The semi-dwarf gene in the mutant. sd13 A 1bp thymine T (e.g., ) was inserted into the first exon of the nucleotide sequence shown in SEQ ID No. 1. Figure 5 As shown), this leads to premature termination of protein translation (e.g. Figure 4 (As shown in Figure A).

[0027] Studies have shown that in hybrid seed production, when the female parent is 10-20 cm shorter than the male parent, the pollination rate of the pistils can be increased, thereby increasing the yield of the first generation of hybrids. The inventors amplified the CDS sequence of the SNR gene from japonica rice Zhonghua 11, and sequencing revealed that it was completely identical to the CDS sequence of the SNR gene in Jiayu 199. Therefore, using Zhonghua 11 as the female parent and the semi-dwarf mutant sd13 as the male parent, a hybridization was conducted, resulting in an F2 population of 105 plants. Among them, 80 plants had a height similar to Zhonghua 11, ranging from 106 cm to 111 cm, and 25 plants had a height of 83 cm to 87 cm. This means that the height-improved offspring were approximately 21% shorter than the parent Zhonghua 11. Meanwhile, the agronomic traits of 80 rice plants were no different from those of Zhonghua 11, while the thousand-grain weight of the 25 plants with reduced plant height was 6%–8% lower than that of Zhonghua 11. Other agronomic traits did not change significantly. Therefore, the semi-dwarf gene... sd13 Under different rice backgrounds, the reduction in plant height can be kept stable at less than 25%, while the offspring retain good fertility. Except for a slight decrease in thousand-grain weight, other agronomic traits do not change significantly.

[0028] Most rice varieties grown in my country have a plant height of 80cm to 110cm. Correspondingly, dwarf and semi-dwarf genes and germplasm resources with practical application value should have a relatively gentle reduction in plant height, with a shortening rate not exceeding 25%. Therefore, based on the above research results, the inventors selected the long arm of rice chromosome 4... SNR Genes were cloned and selected. SNR Three different fragments from the gene were used as target sequences. Gene knockout vectors were constructed using a CRISPR / Cas vector kit, and then transformed into Agrobacterium tumefaciens to infect callus tissue of rice variety Zhonghua 11, resulting in three types of... SNRTransgenic rice lines with deletions at different gene loci. The T1 progeny plants of these rice lines showed a mild reduction in plant height (20%–24% lower than that of Zhonghua 11, with a reduction of less than 25%), good progeny fertility, and no significant changes in other agronomic indicators such as thousand-grain weight.

[0029] Example 1. SNR Gene cloning 1-1. Take about 50mg of young rice leaves, grind them into a fine powder in liquid nitrogen, and transfer them into a 1.5mL centrifuge tube.

[0030] 1-2. Extract total RNA using the TaKaRa MiniBEST Universal RNA Extraction Kit and store at -80℃ for later use.

[0031] 1-3. Using 2.5 μg of total RNA as a template, synthesize cDNA using the PrimeScript™ 1stStrand cDNA Synthesis Kit and store at -20°C for later use.

[0032] 1-4. Using 50 ng single-stranded cDNA as a template, PCR amplification was performed to obtain the CDS sequence of the SNR gene. The amplification primers are as follows: Forward primer SNR-F (SEQ ID No. 3): atggacaaggtgaaggcgtggg; Reverse primer SNR-R (SEQ ID No. 4): ttacacttccaattgcgttatct.

[0033] The PCR reaction system is as follows: 50 ng single-stranded cDNA, 1.25 μL 10 μmol / L forward primer, 1.25 μL 10 μmol / L reverse primer, 10 μL 5×PrimeSTAR Buffer (Mg) 2+ Plus), 4 μL dNTP mixture (2.5 mM each), 0.5 μL 2.5 U / μL PrimeSTAR HS DNA polymerase, and bring the volume to 50 μL with ddH2O.

[0034] The PCR amplification program is as follows: 30 reaction cycles, denaturation at 98℃ for 10s, annealing at 55℃ for 15s, and extension at 72℃ for 2min.

[0035] 1-5. Purify PCR products using Takara's QuickClean™ Enzyme Removal Resin solid-phase resin.

[0036] 1-6. Using the Takara Mighty TA-cloning Reagent Set, the PCR product was ligated into the pMD20-T vector and transformed into competent E. coli cells. E. coli HST08 Premium Competent Cells were cultured overnight at 37°C. White clones were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification of the SNR gene sequence.

[0037] 2. Construct transgenic rice lines with deletions at different gene loci of the SNR gene. 2-1. Select three different fragments from the correctly sequenced SNR gene: SNR1 (SEQ ID No. 5), SNR2 (SEQ ID No. 6), and SNR3 (SEQ ID No. 7) as target sequences.

[0038] 2-2. Design single nucleotide primers according to the target sequence.

[0039] Forward primer SNR1-F (SEQ ID No. 8) for the SNR1 target sequence: tgtgtgactggctttatctccggga; The reverse primer SNR1-R (SEQ ID No. 9) for the SNR1 target sequence: aaactcccggagataaagccagtca; Forward primer SNR1-F (SEQ ID No. 10) for the SNR2 target sequence: tgtgtgatacaggaagtcaaaatgg; The reverse primer SNR1-R (SEQ ID No. 11) for the SNR2 target sequence: aaacccattttgacttcctgtatca; Forward primer SNR1-F (SEQ ID No. 12) for the SNR3 target sequence: tgtgtgacaagcgctgaaaatgacg; The reverse primer SNR1-R (SEQ ID No. 13) for the SNR3 target sequence: aaaccgtcattttcagcgcttgaca.

[0040] 2-3. Constructing recombinant expression vectors Using the CRISPR / Cas vector construction kit (Catalog No. BGK032) provided by BioGLE (Nanjing, China), the primers for the three target sequences were first dissolved in water to a concentration of 10 μmol / L. Then, 18 μL of annealing buffer, 1 μL of forward primer, and 1 μL of reverse primer were mixed thoroughly (total volume 20 μL). The mixture was heated at 95°C for 3 minutes, then slowly cooled to 20°C at a rate of 0.2°C / s in a PCR instrument, and incubated at room temperature for 5 minutes to obtain the Oligo dimer. On ice, 2 μL of CRISPR / Cas vector, 1 μL of Oligo dimer, and 1 μL of Enzyme Mix were added to 6 μL of water to a total volume of 10 μL, gently mixed, and incubated at 20°C for 1 hour. Finally, 5 μL of the reaction solution was transformed into *E. coli* cells. E. coli HST08 Premium Competent Cells were cultured overnight at 37°C on LB agar plates containing kanamycin (50 μg / mL). Positive clones were selected and inoculated into LB liquid medium containing kanamycin and cultured at 37°C for 18 hours. Plasmid DNA was extracted from the bacterial culture using the QIAGEN QIAprep Spin Miniprep Kit (catalog number 27104, Germany). Sequencing was performed by Sangon Biotech (Shanghai) Co., Ltd., which identified the gene knockout vectors containing the SNR gene target sequence as BGK032-SNR1, BGK032-SNR2, and BGK032-SNR3.

[0041] 2-4. Transformation of recombinant expression vector into host cells The three recombinant expression vectors obtained in steps 2-3 were transformed into Agrobacterium EHA105 competent cells (Beijing Solarbio Science & Technology Co., Ltd., catalog number C3610) under the following conditions: 1 μL of plasmid DNA was added to a centrifuge tube containing 100 μL of Agrobacterium EHA105 competent cells on ice and gently mixed. The mixture was allowed to stand for 5 minutes. The centrifuge tube was then flash-frozen in liquid nitrogen for 5 minutes. The centrifuge tube was quickly removed and placed in a 37°C water bath for 5 minutes. The centrifuge tube was then placed back on ice for 5 minutes. 800 μL of LLB liquid medium was added, and the mixture was incubated at 28°C with shaking for 2.5 hours to revive the cells. The revive bacterial culture was then plated onto LB agar plates containing 50 μg / mL kanamycin and incubated at 28°C for 2 days.

[0042] 2-5. Preparation of transgenic plants 2-5-1. After sterilization, mature seeds of Zhonghua 11 were inoculated onto NB medium containing 2 mg / L 2,4-D and cultured in the dark at 28°C for 10-14 days to induce the formation of pale yellow, granular callus. Healthy, granular callus with a diameter of 2-3 mm was selected for subculture.

[0043] 2-5-2. Pick a single colony from the plate in step 2-4 and inoculate it into LB medium containing 50 μg / mL kanamycin. Incubate overnight at 28°C and 200 rpm with shaking. The next day, transfer the colony to 100 mL of fresh LB liquid medium containing kanamycin at a 1:100 volume ratio and incubate until OD500. 600nm Reach 0.5-0.8. Centrifuge, collect the bacterial cells, resuspend in AAM medium containing 100 μmol / L acetylsyringone (AS), and adjust OD. 600nm The concentration was adjusted to 0.1-0.2. The subcultured Zhonghua 11 callus tissue was immersed in resuspended bacterial solution for 20 minutes. The callus tissue was removed, excess bacterial solution was absorbed with sterile filter paper, and then placed on co-culture medium (NB medium containing 100 μmol / L AS) and cultured at 28°C in the dark for 2 days. After culture, the callus tissue was washed with NB liquid medium containing 250 mg / L cephalosporin, and then transferred to NB medium containing 50 mg / mL hygromycin. It was cultured at 28°C in the dark for 4-6 weeks, with fresh medium replaced every 10-14 days, and untransformed callus tissue was discarded. Vigorously growing callus tissue was transferred to differentiation medium containing 50 mg / mL hygromycin and cultured at 28°C under light for 2-4 weeks to obtain resistant shoots. The 1-2 cm resistant shoots were transferred to rooting medium containing 50 mg / mL hygromycin and cultured at 28°C under light for 1-2 weeks until they developed into complete seedlings.

[0044] 2-5-3. When the seedlings from step 2-5-2 have grown to more than 5 cm and the taproot is clearly visible, and there are more than 3 white lateral roots longer than 1 cm, harden them off for 3-5 days under 28℃ light conditions. Transplant the hardened seedlings into loose seedling soil and cultivate them into mature plants under normal natural environmental management conditions.

[0045] 2-5-4. Extract leaf DNA from the plants obtained in step 2-5-3 using the Plant Genomic DNA Extraction Kit (DP305) from Tiangen Biotech Co., Ltd. (Beijing, China). Perform PCR amplification and sequencing using specific primers. Plants with gene site mutations are selected as transgenic plants (T0 generation). Collect the seeds of these transgenic plants (T1 generation). Plants constructed by mutation of the SNR1 target sequence are designated as SNR1S, plants constructed by mutation of the SNR2 target sequence are designated as SNR2S, and plants constructed by mutation of the SNR3 target sequence are designated as SNR3S.

[0046] Forward primer for DNA amplification of SNR1S plants, SNR1S-F (SEQ ID No. 14): ggtctctacggagcagtcgttgt; DNA amplification reverse primer SNR1S-R (SEQ ID No. 15) for SNR1S plants: ttggtcgcctcctttaacagaa; Forward primer for DNA amplification of SNR2S plants, SNR2S-F (SEQ ID No. 16): aacgaatgcttctgttaaaggag; DNA amplification reverse primer SNR2S-R (SEQ ID No. 17) for SNR2S plants: cgtaaccattcagtaagatcaac; Forward primer for DNA amplification of SNR3S plants, SNR3S-F (SEQ ID No. 18): tattgataggcaatggcatcg; The reverse primer for DNA amplification of SNR3S plants, SNR3S-R (SEQ ID No. 19): caggatcttgggggatttcagca.

[0047] PCR amplification reaction system: 20 ng plant genomic DNA, 1.25 μL 10 μmol / L forward primer, 1.25 μL 10 μmol / L reverse primer, 10 μL 5×PrimeSTAR Buffer (Mg) 2+ Plus), 4 μL dNTP mixture (2.5 mM each), 0.5 μL 2.5 U / μL PrimeSTAR HS DNA polymerase, and bring the volume to 50 μL with ddH2O.

[0048] PCR amplification program: 30 reaction cycles, 98℃ for 10s, 55℃ for 5s, 72℃ for 10s.

[0049] 3. Identification of gene locus mutations in transgenic plants 3-1. Take 0.4g of leaves from the seedling stage of the transgenic plant, quick-freeze them with liquid nitrogen, and grind them into fine powder.

[0050] 3-2. Transfer the fine powder to a 1.5 mL centrifuge tube, add 1 mL of preheated 1.5×CTAB (hexadecyltrimethylammonium bromide) buffer, and incubate in a 65°C water bath for 30 min, gently inverting to mix during the process to promote lysis.

[0051] 3-3. Centrifuge the lysis mixture from step 3-2 at 12000g for 5 minutes, take 600μL of the supernatant, add an equal volume of chloroform / isoamyl alcohol mixture (chloroform to isoamyl alcohol volume ratio of 24:1), and gently mix until emulsified.

[0052] 3-4. Centrifuge the emulsion obtained in step 3-3 at 12000 rpm for 10 min. Transfer 450 μL of the supernatant to a new 1.5 mL centrifuge tube, taking care to avoid aspirating intermediate layer impurities.

[0053] 3-5. Add 0.1 volume of NaAc (3M) and 1 volume of isopropanol to the supernatant from step 3-4, let stand at -20℃ for 30 min or overnight, centrifuge at 12000 rpm for 10 min, and collect the DNA precipitate.

[0054] 3-6. Wash the precipitate twice with 1 mL of 70% ethanol, let it air dry, and then dissolve it in 40 μL of TE (tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid) buffer. Store at -20°C for later use.

[0055] 3-7. Using the specific primers from step 2-5-4, the extracted DNA fragments were amplified by PCR and sequenced to screen for plants with gene mutations at the target site. It was found that the SNR1S plant had a thymine T insertion in the SNR1 target sequence (e.g., Figure 6 As shown), this leads to premature termination of SNR protein translation; the SNR gene in the SNR2S plant contains an insertion of one thymine T in the SNR2 target sequence (as shown). Figure 6 As shown), this leads to the inactivation of the SNR protein; in the SNR gene of the SNR3S plant, there are two cytosine C insertions in the SNR3 target sequence (as shown). Figure 6 As shown in the figure, this leads to the inactivation of the SNR protein.

[0056] The sequence of the SNR mutant gene obtained by mutating the SNR1 target sequence is shown in SEQ ID No. 20, and the sequence of the protein expressed by this mutant gene is shown in SEQ ID No. 21. The sequence of the SNR mutant gene obtained by mutating the SNR2 target sequence is shown in SEQ ID No. 22, and the sequence of the protein expressed by this mutant gene is shown in SEQ ID No. 23. The sequence of the SNR mutant gene obtained by mutating the SNR3 target sequence is shown in SEQ ID No. 24, and the sequence of the protein expressed by this mutant gene is shown in SEQ ID No. 25.

[0057] The plant height and thousand-grain weight of three transgenic rice T1 generations were statistically analyzed, and the results are as follows: Figure 7 As shown. From Figure 7 As can be seen above, the plant height of the three transgenic rice varieties was 82cm-86cm, a decrease of 20%-24% compared to the 108cm plant height of the maternal parent, Zhonghua 11; however, the thousand-grain weight showed no significant difference compared to Zhonghua 11. Therefore, these three... SNRGene mutants can reduce rice plant height to a limited extent without altering other important agronomic traits such as thousand-grain weight. Based on the above experimental results, in hybrid seed production, maternal materials can be introduced to appropriately reduce the plant height of the maternal materials while simultaneously maintaining good fertility in the offspring and increasing the yield of the F1 generation. Therefore, this invention provides new tools and methods for cultivating new rice germplasm resources.

[0058] The embodiments described above are merely preferred embodiments of this application and are not intended to limit the scope of protection of this application. Various modifications and variations can be made to this application by anyone skilled in the art. Any simple equivalent changes and modifications made based on the scope of protection claimed in this application and the content of the specification should be included within the scope of protection of this application.

Claims

1. An SNR protein mutant, characterized in that, The amino acid sequence of the SNR protein mutant is any one of the following three: SEQ ID No. 21, SEQ ID No. 23, or SEQ ID No.

25.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the SNR protein mutant of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleotide sequence encoding the protein mutant shown in SEQ ID No. 21 is shown in SEQ ID No. 20; the nucleotide sequence encoding the protein mutant shown in SEQ ID No. 23 is shown in SEQ ID No. 22; and the nucleotide sequence encoding the protein mutant shown in SEQ ID No. 25 is shown in SEQ ID No.

24.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule as described in claim 2.

5. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria comprises the recombinant expression vector of claim 4; or the genome of the genetically engineered bacteria contains the nucleic acid molecule of claim 2.

6. The genetically engineered bacterium according to claim 5, characterized in that, The host of the genetically engineered bacteria is Agrobacterium EHA105.

7. The application of the SNR protein mutant of claim 1, the nucleic acid molecule of claim 2 or 3, the recombinant expression vector of claim 4, and the genetically engineered bacteria of claim 5 or 6 in reducing rice plant height.

8. The application of the SNR protein mutant of claim 1, the nucleic acid molecule of claim 2 or 3, the recombinant expression vector of claim 4, and the genetically engineered bacteria of claim 5 or 6 in the cultivation of semi-dwarf rice varieties with passage function.

9. A method for cultivating semi-dwarf rice, characterized in that, Includes at least one of the following methods: (1) Gene editing of the target rice to make the gene of the target rice encode the SNR protein mutant of claim 1; (2) Introducing the nucleic acid molecule as described in claim 2 or 3 into the cells of the target rice; (3) Transform the recombinant expression vector of claim 4 into the target rice; (4) Transform the genetically engineered bacteria described in claim 5 or 6 into the target rice.

10. The cultivation method according to claim 9, characterized in that, (1) to (4) Any of the following steps: Select three different target sequences from the rice SNR gene, use CRISPR / Cas as the gene editing tool to knock out the rice SNR gene, and the three different target sequences are shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7 respectively.

Images