Polypeptide SPIRM and application thereof
By analyzing whole transcriptome sequencing data from renal cell carcinoma samples, a novel peptide, SPIRM, was screened out. This solved the problem of the lack of pan-cancer analysis in existing technologies, and enabled the inhibitory effect and diagnostic application of peptide SPIRM in various tumors, providing new ideas for tumor treatment and diagnosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA PHARM UNIV
- Filing Date
- 2024-11-06
- Publication Date
- 2026-05-12
AI Technical Summary
Existing novel micropeptide discoveries mainly focus on specific functional studies in a particular type of tumor, lacking pan-cancer analysis and failing to identify micropeptides that play a common regulatory role in different cancers, thus failing to provide more new options for tumor diagnosis and treatment.
By combining translational and proteomics analysis, based on whole transcriptome sequencing data of renal cell carcinoma samples, a novel peptide SPIRM encoded by lncRNA was screened out, and pan-cancer analysis was performed to determine its importance and application value in various tumors.
The peptide SPIRM significantly inhibits tumor growth and metastasis in renal cell carcinoma, glioma, liver cancer, thyroid cancer, and adrenocortical carcinoma. It can serve as a novel tumor marker for auxiliary diagnosis and can significantly inhibit the growth and migration of related cells through chemical synthesis or recombinant vectors.
Smart Images

Figure CN122011150A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine and relates to a polypeptide SPIRM and its applications. Background Technology
[0002] The human genome contains protein-coding and non-coding regions, with only <2% of the region annotated as protein-coding. The rapid development of high-throughput and proteomics technologies has led to broader research into the genome, its transcripts, and corresponding proteins. Recent studies have shown that the boundary between coding and non-coding transcripts is not so clear-cut. Protein translation begins at the start codon and ends at the stop codon of an open reading frame (ORF) in mRNA. Due to limitations in traditional computer algorithms, most algorithms predicting ORFs use a minimum limit of 100 amino acids. This standard leads to the misannotation of many non-coding RNAs (ncRNAs), whose ORFs are smaller than the traditional threshold; these are defined as small open reading frames (sORFs). Increasing research indicates that some ncRNAs can encode small proteins or micropeptides. Micropeptides are functional polypeptides derived from sORFs, capable of in vivo translation, and less than 100 amino acids in length. Micropeptides have a wide range of physiological and pathophysiological functions, including regulating embryonic development, tumorigenesis and development, and muscle development.
[0003] Building upon high-throughput sequencing, large-scale exploration of human-related micropeptides has begun, leading to the discovery of many tumor-related micropeptides. Huang et al. discovered the micropeptide HOXB AS3 encoded by lncRNA HOXB AS3, and their research showed that HOXB AS3 can inhibit the growth of colon cancer (CRC). HOXB AS3 is the first functional micropeptide discovered to play a role in cancer. Guo et al. used ribosome sequencing (Ribo seq) and RNA sequencing (RNA sequencing, RNA seq) to discover the cancer-suppressive micropeptide CIP2A BPBP (cancer inhibitor of PP2A cancer inhibitory factor binding peptide). Studies have shown that the competitive binding of CIP2ABP to CIP2A releases the tumor suppressor PP2A, thereby inactivating the PI3K / AKT / NFκB pathway. This leads to a decrease in the expression levels of matrix metalloproteinase 2 (MMP2), matrix metalloproteinase 9 (MMP9), and Snail, thus inhibiting the invasion and metastasis of breast cancer. Furthermore, the inventors established a micropeptide discovery platform using transcriptome sequencing data analysis, proteomics, CRISPR / Cas9 gene editing, and in vivo translation. They discovered for the first time a novel endogenous micropeptide encoded by lncRNA, MIAC (micropeptide inhibiting actin cytoskeleton), in head and neck squamous cell carcinoma. They demonstrated that MIAC directly binds to aquaporin AQP2, regulating the expression of Sept2 and ITGB4, thereby inhibiting the development and progression of head and neck squamous cell carcinoma. Tumor-related micropeptides, such as SMIM30, MPM (micropeptide in mitochondria), ASAP (ATP synthase-associated peptide), and APPLE (apeptide located in ER), have also been found in various cancers, including liver cancer and rectal cancer.
[0004] Non-coding RNA accounts for over 90% of the human genome, but relatively few novel peptides have been discovered. Therefore, combining multi-omics platforms and bioinformatics technologies to discover novel peptides and systematically study their functions and mechanisms is an important direction for original peptide drug development. However, current novel peptide discoveries mainly focus on specific functional studies in a particular type of tumor, lacking pan-cancer analysis. Discovering peptides that play a common regulatory role in different cancers would provide more new options for tumor diagnosis and treatment. Summary of the Invention
[0005] This invention is based on whole transcriptome sequencing data of renal cell carcinoma samples. By combining translatomics and proteomics analysis, as well as in vivo translational level detection, a novel polypeptide SPIRM encoded by lncRNA was screened and analyzed across various cancer types to determine the importance and application value of SPIRM in multiple tumors. Based on this, this project provides the following technical solution:
[0006] The primary objective of this invention is to provide a novel polypeptide SPIRM.
[0007] Preferably, the polypeptide is obtained through chemical synthesis or biosynthesis.
[0008] A second objective of the present invention is to provide a nucleic acid molecule encoding the aforementioned polypeptide SPIRM.
[0009] A third objective of this invention is to provide the use of the above-mentioned polypeptide SPIRM in the preparation of reagents or drugs for detecting, preventing or treating tumors.
[0010] A fourth objective of this invention is to provide a pharmaceutical composition for the prevention or treatment of tumors.
[0011] The fifth objective of this invention is to provide a tumor detection kit.
[0012] The objective of this invention can be achieved through the following technical solutions:
[0013] The polypeptide SPIRM has the amino acid sequence shown in SEQ ID NO.1.
[0014] The nucleic acid encoding the polypeptide SPIRM.
[0015] The preferred nucleotide sequence of the nucleic acid is shown in SEQ ID NO.2.
[0016] This invention is the first to discover that lncRNA VPS9D1-AS1 has coding capability, contains a small open reading frame of 105 bp, and its nucleotide sequence is shown in SEQ ID NO:2 of the sequence listing. It can also translate a novel polypeptide of 34 amino acids (named SPIRM), and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:1 of the sequence listing.
[0017] Recombinant expression vectors and lentiviruses containing the aforementioned nucleic acids. Transfection of these recombinant expression vectors or lentiviruses into different tumor cells significantly inhibited the growth and / or metastasis of renal cell carcinoma 786-O cells, glioma T98G cells, hepatocellular carcinoma HEPG2 cells, thyroid cancer SW579 cells, and adrenocortical carcinoma NCI-H295R cells.
[0018] PCR primers for specifically amplifying the nucleic acid.
[0019] The preferred PCR primers are the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4.
[0020] The application of substances that detect the aforementioned polypeptide SPIRM or nucleic acid in the preparation of tumor-associated diagnostic reagents.
[0021] The tumors mentioned are preferably renal cell carcinoma, glioma, liver cancer, thyroid cancer, and / or adrenocortical carcinoma.
[0022] The substance used to detect the polypeptide SPIRM is preferably a specific antibody against the polypeptide SPIRM, and the substance used to detect the nucleic acid is the PCR primer for specifically amplifying the nucleic acid as described in this invention.
[0023] The use of the polypeptide SPIRM in the preparation of drugs for the prevention and / or treatment of tumors; wherein the tumors are preferably renal cell carcinoma, glioma, liver cancer, thyroid cancer and / or adrenocortical carcinoma.
[0024] By co-incubating the chemically synthesized peptide SPIRM with various tumor cells, it was found that the peptide SPIRM could significantly inhibit the growth and / or metastasis of renal cell carcinoma 786-O cells, glioma T98G cells, liver cancer HEPG2 cells, thyroid cancer SW579 cells, and adrenocortical carcinoma NCI-H295R cells.
[0025] The recombinant expression vector and lentivirus are used in the preparation of drugs for the prevention and / or treatment of tumors; the tumors are preferably renal cell carcinoma, glioma, liver cancer, thyroid cancer and / or adrenocortical carcinoma.
[0026] Transfecting the coding nucleic acid of the polypeptide SPIRM into different tumor cells via a recombinant vector can significantly inhibit the growth and / or metastasis of renal cell carcinoma 786-O cells, glioma T98G cells, hepatocellular carcinoma HEPG2 cells, thyroid cancer SW579 cells, and adrenocortical carcinoma NCI-H295R cells.
[0027] A pharmaceutical composition for the prevention or treatment of tumors, comprising the aforementioned polypeptide SPIRM or comprising the aforementioned recombinant expression vector, lentivirus, or pharmaceutically acceptable vector thereof.
[0028] A tumor-aided diagnostic kit, wherein the kit contains the PCR primers described above.
[0029] Beneficial effects:
[0030] (1) This invention is the first to discover that lncRNA VPS9D1-AS1 has encoding ability and can translate a novel polypeptide of 34 amino acids in length, named SPIRM;
[0031] (2) Through high-throughput transcriptome data analysis, this invention found that the expression of peptide SPIRM in renal cell carcinoma, glioma, liver cancer, thyroid cancer and adrenocortical carcinoma was significantly lower than that in normal tissues, indicating that peptide SPIRM can be used as a new tumor marker for the auxiliary diagnosis of early tumors.
[0032] (3) By designing specific primers encoding the nucleotide sequence of SPIRM, this invention uses real-time PCR to detect the expression level of SPIRM in renal cell carcinoma, glioma, liver cancer, thyroid cancer and adrenocortical cancer cells, as well as the corresponding normal cells. It was found that SPIRM was significantly lowly expressed in the above tumor cells, suggesting that specific primers designed for the SPIRM sequence can be used for tumor diagnosis.
[0033] (5) Through extensive experiments, this invention has shown that transfecting the polypeptide SPIRM into tumor cells via a recombinant vector can significantly inhibit the growth and / or metastasis of renal cell carcinoma 786-O cells, glioma T98G cells, liver cancer HEPG2 cells, thyroid cancer SW579 cells, and adrenocortical carcinoma NCI-H295R cells.
[0034] (6) The present invention uses chemically synthesized polypeptide SPIRM to significantly inhibit the growth and / or metastasis of renal cell carcinoma 786-O cells, glioma T98G cells, liver cancer HEPG2 cells, thyroid cancer SW579 cells, and adrenocortical carcinoma NCI-H295R cells.
[0035] Based on the above findings, the expression level of the peptide SPIRM can serve as a novel biomarker to aid in the diagnosis of malignant tumors, including renal cell carcinoma, glioma, liver cancer, thyroid cancer, or adrenocortical carcinoma. The peptide SPIRM can also serve as a potential drug for treating malignant tumors, providing new ideas and prospects for the development of novel anti-tumor drugs. Attached Figure Description
[0036] Figure 1 Detection of SPIRM expression levels in renal cell carcinoma and normal tissues using quantitative real-time PCR
[0037] Figure 2 Comparison of SPIRM expression levels in tumor and normal tissues; data from the TCGA database.
[0038] Figure 3ROC curve analysis of the diagnostic value of SPIRM in different tumors (RCC: renal cell carcinoma; GBM: glioma; THCA: thyroid carcinoma; LIHC: hepatocellular carcinoma; ACC: adrenocortical carcinoma).
[0039] Figure 4 Detection of expression levels of peptide SPIRM in different tumor cells and normal cells using quantitative real-time PCR
[0040] Figure 5 Inhibitory effect of overexpressed peptide SPIRM on the proliferation of different tumor cells
[0041] Figure 6 Inhibitory effect of overexpressed peptide SPIRM on the migration of different tumor cells
[0042] Figure 7 HPLC and LC-MS results of chemically synthesized peptide SPIRM
[0043] Figure 8 Inhibitory effect of chemically synthesized peptide SPIRM on the proliferation of different tumor cells
[0044] Figure 9 Inhibitory effect of chemically synthesized peptide SPIRM on the migration of different tumor cells Detailed Implementation
[0045] Example 1: Detection of SPIRM expression levels in renal cell carcinoma and normal tissues using quantitative real-time PCR.
[0046] (1) Specimen collection
[0047] With the patient's informed consent, a total of 32 pairs of renal cell carcinoma and adjacent tissue specimens were collected during the operation. After being washed with physiological saline, they were stored in liquid nitrogen or a -80°C refrigerator for later use.
[0048] (2) Primer design
[0049] Specific primers were designed based on the sequence information of SPIRM, and the sequences are as follows:
[0050] Upstream primer: atgggcctctgggaagt (SEQ ID NO.3)
[0051] Downstream primer: tacgggaaggcaggact (SEQ ID NO.4)
[0052] (3) Real-time quantitative PCR was used to detect the expression of SPIRM in renal cell carcinoma tissue and normal adjacent normal tissue.
[0053] Total RNA was extracted from the collected samples according to the Trizol instructions from Tiangen Biotech. The purity and concentration of the extracted RNA were then quantified using a NanoDrop ND-1000 nucleic acid quantification instrument, and agarose gel permeation was performed to ensure the integrity of the extracted RNA. The extracted total RNA was subjected to reverse transcription and qPCR using the Vazyme UniPeak U+One Step RT-qPCR SYBR Green Kit. The reaction solutions were prepared in RNase-free centrifuge tubes as shown in Table 1.
[0054] Table 1 qPCR reaction system
[0055]
[0056]
[0057] Table 2 qPCR reaction procedures
[0058]
[0059] The specificity of the reaction was determined based on the melting curve, and the relative expression level of SPIRM was calculated using formula 2-ΔΔCt. Results are shown below. Figure 1 The expression level of SPIRM in renal cell carcinoma tissue was significantly lower than that in adjacent normal tissue.
[0060] Example 2: Analysis of SPIRM expression levels and diagnostic value in different human tumor tissues
[0061] The TCGA standard method was used to download RNA-seq sequencing files and clinical information for cancerous and normal tissues of 32 types of tumors, including head and neck cancer, glioma, thyroid cancer, esophageal squamous cell carcinoma, lung cancer, liver cancer, gastric cancer, kidney cancer, breast cancer, ovarian cancer, cervical cancer, bladder cancer, colorectal cancer, pancreatic cancer, osteosarcoma, and skin cancer. Statistical analysis was performed using R language (version 3.1.1) software, requiring the installation and loading of packages (heatmap, venndiagram, hist, etc.). Then, the DESeq and edgeR packages were used to analyze VPS9D1-AS1 expression levels to identify differentially expressed tumor types (as shown in Table 3 and...). Figure 2 (As shown). Criteria for differential expression: (1) |Expression level in cancer / adjacent tissue|>2, (2) P<0.05.
[0062] Table 3. Expression analysis of SPIRM in human tumor tissues and normal tissues (near-cancerous / near-cancerous).
[0063]
[0064] From Table 3 and Figure 2As shown, the expression of SPIRM in cancerous and adjacent tissues was analyzed compared with normal tissues. It was found that the expression level of SPIRM was significantly reduced in glioma, liver cancer, thyroid cancer and adrenocortical cancer tissues compared with adjacent tissues.
[0065] Using receiver operating characteristic (ROC) curves, a binary logistic regression analysis was employed to calculate the factor model for SPIRM index detection. The area under the curve (AUC) and 95% confidence interval (95% CI) were calculated to evaluate whether SPIRM could serve as a potential diagnostic marker for renal cell carcinoma, glioma, hepatocellular carcinoma, thyroid cancer, and adrenocortical carcinoma. A p-value < 0.05 was considered statistically significant. Results are as follows... Figure 3 As shown, the AUC of the ROC curves for SPIRM in the diagnosis of renal cell carcinoma, glioma, liver cancer, thyroid cancer, and adrenocortical carcinoma were all greater than 0.7. Among them, the AUC of SPIRM in the diagnosis of renal cell carcinoma reached 0.91, and the P values were all <0.05, indicating that SPIRM can effectively assist in the clinical diagnosis of the above five tumors.
[0066] Example 3: Detection of expression levels of peptide SPIRM in different tumor cells and normal cells using quantitative real-time PCR
[0067] Tumor cells include: human microglia HMC3, human glioma cells (T98G, U87 MG), human hepatocytes L02, liver cancer cells (HepG2, BEL-7402), human renal epithelial cells HEK293T, renal cancer cells (A498, 786-O, Caki-1, Caki-2, OSRC2, ACHN), thyroid cancer cells (SW579, TPC-1), and adrenocortical cancer cells NCI-H295R.
[0068] The detection methods include:
[0069] (1) Extraction of total RNA from tumor cells and normal epithelial cells
[0070] The above 16 cell types were cultured in incubators at 37℃ and 5% CO2. When the cell density reached 90%, the cells were collected by trypsin digestion, resuspended in culture medium, and counted under a microscope. The cell concentration was then adjusted to 5 × 10⁶ cells / year. 5 Cells / mL were then seeded into 6-well plates at a concentration of 2 mL per well and incubated at 37°C in a 5% CO2 incubator for 24 h.
[0071] Total RNA was extracted from the cells according to the Trizol instructions from Tiangen Biotech. The purity and concentration of the extracted RNA were then quantified using a NanoDrop ND-1000 nucleic acid quantification instrument, and agarose quality control was performed to ensure the integrity of the extracted RNA.
[0072] (2) Real-time quantitative PCR
[0073] Specific primers were designed based on the nucleic acid sequences of the SPIRM and GAPDH genes, and ABM kits were used. Premix Ex Taq TM qPCR reactions were performed using TliRNaseH Plus II. The upstream and downstream primer sequences for SPIRM are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and the upstream and downstream primer sequences for GAPDH are shown in TGCACCACCAACTGCTTAGC (SEQ ID NO.5) and GGCATGGACTGTGGTCATGAG (SEQ ID NO.6), respectively. Total RNA extracted was reverse transcribed and qPCR was performed using the Vazyme UniPeak U+One Step RT-qPCR SYBR Green Kit. The reaction system is shown in Table 1, and the qPCR reaction program is shown in Table 2.
[0074] See results Figure 4 Compared with normal human cells, SPIRM expression was significantly reduced in human glioma cells (T98G, U87 MG), liver cancer cells (HepG2, BEL-7402), kidney cancer cells (A498, 786-O, Caki-1, Caki-2, OSRC2, ACHN), thyroid cancer cells (SW579, TPC-1), and adrenocortical cancer cells (NCI-H295R), consistent with the results of the detection and analysis of the above clinical samples.
[0075] Example 4: Effects of overexpressed peptide SPIRM on the proliferation of different tumor cells
[0076] Lentiviral expression plasmids containing nucleotide sequences encoding the polypeptide SPIRM were constructed, and human glioma cells U87 MG, hepatocellular carcinoma cells HepG2, renal cell carcinoma cells 786-O, thyroid cancer cells SW579, and adrenocortical carcinoma cells NCI-H295R (named SPIRM-OE) overexpressing SPIRM were constructed using lentiviral transfection technology.
[0077] (1) A lentiviral recombinant plasmid overexpressing SPIRM was constructed in advance. Based on the DNA sequence of SPIRM, upstream and downstream specific primers were designed (upstream primer: ATGGGCCTCTGGGAAGT, downstream primer: CTACGGGAAGGCAGGACT). The target fragment was amplified by PCR (the specific target sequence is shown in SEQ ID NO.2). At the same time, the linearized expression vector was obtained by digestion with restriction endonucleases EcoRI and BamHI. The vector recovered from the enzyme digestion gel was ligated with the target fragment and transformed into competent DH5α cells. Colony PCR and sequencing were used to confirm that the target sequence was successfully inserted.
[0078] (2) Culture 293T cells in T75 cell culture flasks. When the density reaches 50%, transfection can be performed. Gently pour out the 293T cell culture medium and add 9 ml of complete culture medium, then wait for transfection.
[0079] (3) Take four 1.5ml EP tubes and add 500μl of DMEM empty culture to each. Add the following to one tube: packaging plasmid Pspax2: 7.50μg, packaging plasmid PMD2G: 2.50μg, and lentiviral recombinant plasmid overexpressing SPIRM: 10μg; add the following to another tube: Pspax2 plasmid: 7.50μg, PMD2G plasmid: 2.50μg, and Ctrl group plasmid DNA: 10μg; add the following to the other two tubes: EZ trans lentiviral transfection reagent 72μl each. Add the EZ trans solution to the lentiviral plasmid dilution and incubate at room temperature for 10min. At this time, replace the 293T medium with 9ml of fresh complete medium. After 10min, insert the pipette tip below the liquid surface and slowly add the solution in a circular motion. Replace with 10ml of complete medium after 8-10h.
[0080] (4) Collect the viral supernatant from the SPIRM and Ctrl groups on the second and third days, respectively, store it temporarily at 4°C, centrifuge at 1500 rpm for 5 min, discard the 239T cell pellet, filter the viral solution from the SPIRM and Ctrl groups into the corresponding viral tubes using a 0.45 μm sterile filter, add 6.67 ml of PEG8000 viral concentrate, and incubate overnight at 4°C on a shaker.
[0081] (5) Centrifuge at 8000 rpm and 4℃ for 1 h, discard the supernatant, resuspend the precipitate in 100 μl PBS solution, and store the virus tube at -80℃.
[0082] (6) After digesting and centrifuging the above 5 types of cells, seed 50,000 cells into 12-well plates respectively, and transfect when the cell density reaches about 80%.
[0083] (7) Melt the virus tubes at 4℃. The final concentration of polybrene is 6 μg / ml. Calculate the required volume, add 450 μl of complete culture to the virus tubes, and mix by pipetting. Discard the supernatant in the plate, add the virus mixture, and after 4 hours, replenish the liquid in the plate to the full volume. After 4-5 hours, change the medium as needed.
[0084] (8) When the cells of the SPIRM and Ctrl groups were cultured to a six-well plate, they were screened with a final concentration of 1.8 μg / ml puromycin. After one week of screening, fluorescence photography was performed to observe the fluorescence intensity of GFP for preliminary verification of transfection efficiency.
[0085] Two groups of cells were cultured at 37°C and 5% CO2 until the cell density reached over 90%. The cells were then digested with trypsin, resuspended in culture medium, and counted under a microscope. The cell concentration was adjusted to 3.0 × 10⁻⁶ cells / year. 4 Cells were seeded at a density of 100 μL / mL into 96-well plates and incubated at 37°C in a 5% CO2 incubator for 48 h. Then, 10 μL of CCK8 reagent was added to each well under dark conditions, and the plates were incubated at 37°C in the dark for 4 h. The microplate reader was preheated 30 min before incubation. After incubation, the absorbance at 450 nm was measured in each well. Data analysis was performed. The experiment was independently repeated three times. Results are expressed as mean ± SD and statistical t-tests were conducted. *P < 0.05 was considered statistically significant, and **P < 0.01 was considered highly statistically significant.
[0086] The results are as follows Figure 5 As shown, compared with the control group, overexpression of SPIRM significantly inhibited the proliferation of glioma cells U87MG, liver cancer cells HepG2, renal cancer cells 786-O, thyroid cancer cells SW579, and adrenocortical cancer cells NCI-H295R, indicating that the novel micropeptide SPIRM can exert anti-tumor effects by inhibiting the proliferation of tumor cells.
[0087] Example 5: Effects of overexpressed peptide SPIRM on the migration of different tumor cells
[0088] Tumor cells overexpressing SPIRM were constructed using the same method as in Example 4. Simultaneously, corresponding control cells (Ctrl group) were seeded into transwell chambers, 100 μL per well. Then, 0.6 mL of complete culture medium containing 10% FBS was added to the lower chamber of the transwell to stimulate cell migration, and the cells were cultured at 37°C with 5% CO2 for 48 h. The culture medium in the wells was discarded, and the cells were fixed with methanol at room temperature for 30 min, stained with 0.1% crystal violet at room temperature for 10 min, rinsed with water, and the supernatant of unmigrated cells was wiped off with a cotton swab. The cells were observed under a microscope, and four fields of view were photographed for cell counting. The experiment was independently repeated three times. The results are expressed as mean ± SD, and statistical t-tests were performed. *P < 0.05 was considered statistically significant, and **P < 0.01 was considered highly statistically significant.
[0089] The results are as follows Figure 6 As shown, compared with the control group, overexpression of SPIRM significantly inhibited the migration of glioma cells U87MG, liver cancer cells HepG2, renal cancer cells 786-O, thyroid cancer cells SW579, and adrenocortical cancer cells NCI-H295R, indicating that the peptide SPIRM can exert anti-tumor effects by inhibiting the migration of tumor cells.
[0090] Example 6: Inhibitory effect of chemically synthesized polypeptide SPIRM on the proliferation of different tumor cells
[0091] The peptide SPIRM was synthesized using a solid-phase peptide synthesis method. The synthesized peptide SPIRM was separated and purified by preparative HPLC, and the purity of the peptide SPIRM was determined by analytical RP-HPLC. The molecular weight of the peptide SPIRM was determined by LC-MS to confirm that the peptide SPIRM could meet the requirements of subsequent experiments.
[0092] Human glioma cells U87 MG, hepatocellular carcinoma cells HepG2, renal cell carcinoma cells 786-O, thyroid cancer cells SW579, and adrenocortical carcinoma cells NCI-H295R were cultured in an incubator at 37°C and 5% CO2 until the cell density reached 90%. The cells were then collected by trypsin digestion, resuspended in culture medium, and counted under a microscope. The cell concentration was adjusted to 3.0 × 10⁻⁶ cells / year. 4Cells were seeded at a concentration of 100 μL / mL into 96-well plates and incubated overnight at 37°C in a 5% CO2 incubator. After complete cell adhesion, different doses of the peptide SPIRM were added as the drug treatment group, and the culture medium without any drug was used as the blank control group. The culture medium was diluted to the predetermined concentrations. Each dilution was added to a 96-well plate at 100 μL / well and incubated at 37°C in a 5% CO2 incubator for 48 h. Under light-protected conditions, 10 μL of CCK8 reagent was added to each well, and the plate was incubated at 37°C in the dark for 4 h. The microplate reader was preheated 30 min before incubation. After incubation, the absorbance at 450 nm was measured in each well, and the data were analyzed. The experiment was independently repeated three times. The results are expressed as mean ± SD and statistically analyzed using a t-test. *P < 0.05 was considered statistically significant, and **P < 0.01 was considered highly significant.
[0093] The results are as follows Figure 7 As shown, the purity of the in vitro chemically synthesized peptide SPIRM was 97.4% as determined by HPLC, and the molecular weight of the peptide SPIRM was correct, indicating that the peptide SPIRM can be used for subsequent experiments.
[0094] The results are as follows Figure 8 As shown, compared with the blank control group, at doses of 10 μM and 100 μM, the peptide SPIRM significantly inhibited the proliferation of glioma cells U87 MG, liver cancer cells HepG2, renal cancer cells 786-O, thyroid cancer cells SW579, and adrenocortical cancer cells NCI-H295R, and the inhibition was dose-dependent.
[0095] Example 7: Inhibitory effect of chemically synthesized peptide SPIRM on the migration of different tumor cells.
[0096] Human glioma cells U87 MG, hepatocellular carcinoma cells HepG2, renal cell carcinoma cells 786-O, thyroid cancer cells SW579, and adrenocortical carcinoma cells NCI-H295R were cultured in an incubator at 37°C and 5% CO2 until the cell density reached 90%. The cells were then collected by trypsin digestion, resuspended in culture medium, and counted under a microscope. The cell concentration was adjusted to 3.0 × 10⁻⁶ cells / year. 4Cells were seeded at a density of 100 μL / mL into each transwell chamber. Simultaneously, 100 μL of different doses of the peptide SPIRM was added to the upper chamber of each chamber. Then, 0.6 mL of complete culture medium containing 10% FBS was added to the lower chamber to stimulate cell migration. Cells were incubated at 37°C with 5% CO2 for 24 h. The culture medium was discarded, and the cells were fixed with 90% ethanol at room temperature for 30 min, stained with 0.1% crystal violet at room temperature for 10 min, rinsed with water, and the supernatant of unmigrated cells was gently wiped away with a cotton swab. The cells were observed under a microscope, and four fields of view were photographed for cell counting. The migration inhibition rate (MIR) was calculated using the formula:
[0097]
[0098] Where Ntest represents the number of cells that migrated in the test group, and Ncontrol represents the number of cells that migrated in the blank control group.
[0099] The experiment was independently repeated three times. The results were calculated as mean ± SD and subjected to a statistical t-test. Here, "independently repeated three times" refers to repeating the experiment three times for each dose of any cell type in the table, and then calculating the cell migration number (Mean ± SD) using the above formula. Statistically significant differences were expressed using p-values; *P < 0.05 was considered statistically significant, and **P < 0.01 was considered highly significant.
[0100] The results are as follows Figure 9 As shown, compared with the blank control group, at doses of 10 μM and 100 μM, the peptide SPIRM significantly inhibited the migration of glioma cells U87 MG, liver cancer cells HepG2, renal cancer cells 786-O, thyroid cancer cells SW579, and adrenocortical cancer cells NCI-H295R, and the effect was dose-dependent. Based on the results of the above proliferation experiments, we consider whether the peptide SPIRM can be a novel anti-tumor drug candidate.
Claims
1. A polypeptide SPIRM, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. A nucleic acid encoding the polypeptide SPIRM of claim 1; wherein the nucleic acid preferably has a nucleotide sequence as shown in SEQ ID NO.
2.
3. A recombinant expression vector or lentivirus containing the nucleic acid described in claim 2 or 3.
4. PCR primers for specifically amplifying the nucleic acid of claim 2; preferably, the upstream primer is shown in SEQ ID NO.3 and the downstream primer is shown in SEQ ID NO.
4.
5. The application of the substance for detecting the polypeptide SPIRM of claim 1 or the substance for detecting the nucleic acid of claim 2 in the preparation of tumor auxiliary diagnostic reagents, wherein the tumor is preferably renal cell carcinoma, glioma, liver cancer, thyroid cancer and / or adrenocortical carcinoma.
6. The application according to claim 5, characterized in that... The substance for detecting the polypeptide SPIRM of claim 1 is a specific antibody against the polypeptide SPIRM, and the substance for detecting the nucleic acid of claim 2 is the PCR primer for specifically amplifying the nucleic acid of claim 2 as described in claim 4.
7. The use of the polypeptide SPIRM of claim 1 in the preparation of a medicament for the prevention and / or treatment of tumors; wherein the tumor is preferably renal cell carcinoma, glioma, liver cancer, thyroid cancer and / or adrenocortical carcinoma.
8. The use of the recombinant expression vector and lentivirus according to claim 3 in the preparation of medicaments for the prevention and / or treatment of tumors; wherein the tumor is preferably renal cell carcinoma, glioma, liver cancer, thyroid cancer and / or adrenocortical carcinoma.
9. A pharmaceutical composition for the prevention or treatment of tumors, characterized in that, It contains the polypeptide SPIRM of claim 1 or the recombinant expression vector, lentivirus, or pharmaceutically acceptable vector of claim 3.
10. A tumor auxiliary diagnostic kit, characterized in that, The kit contains the PCR primers as described in claim 4.