Preparation and application of bispecific nano antibody targeting PEDV (porcine epidemic diarrhea virus) and PDCoV (PDCoV)

Abstract

The invention relates to the technical field of biology, and discloses preparation and application of a bispecific nano antibody targeting PEDV (porcine epidemic diarrhea virus) and PDCoV (PDCoV). The bispecific nano-antibody targeting PEDV and PDCoV is constructed by using a flexible connecting peptide (G4S) 3 aiming at S protein RBD regions of PEDV and PDCoV, the bispecific nano-antibody can be synchronously and specifically combined with RBD antigens of PEDV and PDCoV, cross reaction with other diarrhea-related viruses such as TGEV and SADS-CoV is avoided, and the bispecific nano-antibody has excellent specificity and applicability; the kit can be used as an ideal detection tool for double detection in one tube, the diagnosis accuracy of PEDV / PDCoV mixed infection samples is remarkably improved, the technical bottleneck of current PEDV and PDCoV prevention and control is effectively broken, and the kit has outstanding innovativeness, practical value and industrialization conversion prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the preparation and application of bispecific nanobodies targeting PEDV and PDCoV. Background Technology

[0002] Porcine Epidemic Diarrhea Virus (PEDV) and Porcine Deltacoronavirus (PDCoV) are porcine enteric coronaviruses and two important pathogens that cause acute watery diarrhea, vomiting, dehydration, and even death in piglets. They often co-infect in pig farms, seriously threatening the healthy development of the global pig industry and causing huge economic losses. PEDV belongs to the genus *A*-coronavirus of the family Coronaviridae. Its spike (S) protein's receptor-binding domain (RBD) primarily initiates infection by interacting with sialic acid receptors on the host cell membrane. PDCoV belongs to the genus *Deltacoronavirus* of the family Coronaviridae. The RBD of its encoded S protein specifically recognizes and binds to the aminopeptidase N (APN) receptor on the host cell surface, mediating viral invasion. Both viruses' S protein RBDs are core functional regions for viral invasion and are also major antigenic targets for inducing the production of neutralizing antibodies, making them key targets for disease diagnosis and antiviral strategy development.

[0003] Currently, the prevention and control of PEDV mainly relies on traditional vaccines, but these have limitations in cross-protection and insufficient coverage of variant strains. Meanwhile, no commercially available vaccine has been approved for PDCoV, and studies have shown that it exhibits broad host tropism (including human cell lines), revealing a potential risk of cross-species transmission, which has attracted significant attention in the public health field. For the prevention and control of PEDV / PDCoV co-infection, there is a lack of rapid, precise, and broad-spectrum novel molecular tools. Existing diagnostic methods mostly rely on polyclonal or monoclonal antibodies, which struggle to distinguish PEDV, PDCoV, and other co-circulating porcine enteric coronaviruses (such as transmissible gastroenteritis virus (TGEV) and porcine acute diarrhea syndrome virus (SADS-CoV), easily leading to false positives or missed detections, and failing to meet the need for accurate diagnosis of co-infections.

[0004] Nanobodies, derived from the variable domains (VHH) of natural heavy chain antibodies in camels, possess advantages such as small molecular weight (approximately 12-15 kDa), high stability (tolerant to extreme pH and high temperatures), strong tissue penetration, and ease of genetic engineering modification, showing promising applications in animal disease detection and treatment. Among these, bispecific nanobodies can simultaneously recognize two pathogen targets by linking two specific VHH domains targeting different antigens via a linker peptide, providing a new research direction for the prevention and control of mixed infections. However, there are currently no reports of nanobodies simultaneously targeting the RBD domains of PEDV and PDCoV S proteins, indicating a significant technological gap in this field. Summary of the Invention

[0005] In light of the above, it is necessary to construct nanobodies targeting the S protein RBD domains of PDCoV and PEDV. These nanobodies can simultaneously target and validate PEDV and PDCoV, avoid cross-reaction with other viruses that cause swine diarrhea, such as TGEV and SADS-CoV, and possess high stability and dual-target recognition capabilities. They can serve as an ideal detection tool for "one tube, two tests," significantly improving the diagnostic accuracy of PEDV / PDCoV mixed infection samples.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A bispecific nanobody targeting PEDV and PDCoV, the bispecific nanobody comprising a first antigen-binding domain PEDV-VHH specific to PEDV and a second antigen-binding domain PDCoV-VHH specific to PDCoV; the amino acid sequence of PEDV-VHH is shown in SEQ ID NO.1; the amino acid sequence of PDCoV-VHH is shown in SEQ ID NO.2.

[0008] Furthermore, the first antigen-binding domain PEDV-VHH and the second antigen-binding domain PDCoV-VHH are connected via a linker.

[0009] Furthermore, the amino acid sequence of the connector is shown in SEQ ID NO.4.

[0010] The amino acid sequence of the bispecific nanobody described in this invention is shown in SEQ ID NO.3.

[0011] The present invention also includes isolated nucleic acid molecules containing nucleic acid sequences encoding the bispecific nanobody described above.

[0012] The present invention also includes a carrier containing the nucleic acid molecule described herein.

[0013] The present invention also includes a host cell containing the said nucleic acid molecule or the said vector.

[0014] The present invention also includes a method for preparing the bispecific nanobody, the method comprising: culturing the host cells under conditions that allow protein expression, and recovering the bispecific antibody from the cultured host cell culture.

[0015] The present invention also includes a reagent or kit for detecting PEDV and / or PDCoV, said reagent or kit comprising the bispecific nanobody described above.

[0016] The present invention also includes the use of the bispecific nanobody or the bispecific nanobody constructed by the construction method in the preparation of drugs for the prevention or treatment of PEDV and / or PDCoV infection.

[0017] The present invention has the following beneficial effects:

[0018] This invention utilizes the flexible linker peptide (G4S)3 to construct bispecific nanobodies targeting the RBD regions of PEDV and PDCoV S proteins. These bispecific nanobodies can simultaneously and specifically bind to the RBD antigens of both PEDV and PDCoV, and do not cross-react with other diarrhea-associated viruses such as TGEV and SADS-CoV, exhibiting excellent specificity and applicability. The bispecific nanobodies of this invention possess high stability and dual-target recognition capabilities, making them an ideal detection tool for "two-in-one" testing, significantly improving the diagnostic accuracy of PEDV / PDCoV mixed infection samples. These bispecific nanobodies provide a key molecular tool for rapid on-site detection of PEDV / PDCoV, epidemiological surveillance, and the development of oral / inhaled antiviral agents, effectively overcoming current technical bottlenecks in PEDV and PDCoV prevention and control, and demonstrating outstanding innovation, practical value, and promising prospects for industrialization. Attached Figure Description

[0019] Figure 1 This is an SDS-PAGE analysis of the expression and purification of PEDV-RBD protein in *E. coli* according to this invention. The left image shows the expression identification, and the right image shows the purification results. In the left image: M is the protein marker, 1 is the empty pCZN1 vector, 2 is the uninduced pCZN1-PEDV-RBD recombinant bacteria, 3 is the pCZN1-PEDV-RBD induced recombinant bacteria, 4 is the supernatant from the ultrasonic lysis of the pCZN1-PEDV-RBD induced recombinant bacteria, and 5 is the ultrasonic lysis precipitate from the pCZN1-PEDV-RBD induced recombinant bacteria. In the right image: M is the protein marker; 1 is the purified PEDV-RBD.

[0020] Figure 2This is an SDS-PAGE analysis of the expression and purification of PDCoV-RBD protein in *E. coli* in this invention. The left image shows the expression identification, and the right image shows the purification results. In the left image: M is the protein marker; 1 is the empty pCZN1 vector; 2 is the uninduced pCZN1-PDCoV-RBD recombinant bacteria; 3 is the pCZN1-PDCoV-RBD induced recombinant bacteria; 4 is the supernatant from the ultrasonic lysis of the pCZN1-PDCoV-RBD induced recombinant bacteria; 5 is the ultrasonic lysis and precipitation of the pCZN1-PDCoV-RBD induced recombinant bacteria. In the right image: M is the protein marker; 1 is the processed sample after ultrasonic lysis and precipitation of the pCZN1-PDCoV-RBD induced recombinant bacteria; 2 is the eluent; 3 is the purified PDCoV-RBD.

[0021] Figure 3 It is a nanobody Library P Agarose gel electrophoresis image of CR products. In the figure, M is the DNA marker; 1-24 are PCR products of colony amplification.

[0022] Figure 4 This is a graph of the Phage-ELISA results for PEDV-VHH.

[0023] Figure 5 This is a graph showing the Phage-ELISA results for PDCoV-VHH.

[0024] Figure 6 This is a diagram showing the binding results of nanobodies with PEDV-RBD protein. The left image shows PEDV-VHH and PEDV-RBD protein; the right image shows PDCoV-VHH and PDCoV-RBD protein.

[0025] Figure 7 This is a structural diagram of the bispecific nanobody VHHs.

[0026] Figure 8 This is a result image of the pCZN1-VHHs recombinant plasmid. In the image: M is the DNA marker, 1 is the double enzyme digestion product of the pCZN1-VHHs recombinant plasmid, and 2 is the pCZN1-VHHs vector.

[0027] Figure 9 This is a graph showing the prokaryotic expression results of the bispecific nanobody VHHs. In the graph: M is the protein marker, 1 is the empty pCZN1 vector, 2 is the uninduced recombinant bacteria of pCZN1-VHHs, 3 is the recombinant bacteria induced by pCZN1-VHHs, 4 is the supernatant of the ultrasonic lysis of the recombinant bacteria induced by pCZN1-VHHs, and 5 is the ultrasonic lysis and precipitation of the recombinant bacteria induced by pCZN1-VHHs.

[0028] Figure 10 The figure shows the purification results of PDCoV-VHH, PEDV-VHH, and bispecific nanobody VHHs. In the figure: M is the protein marker, 1 is the PEDV-VHH protein, 2 is the PDCoV-VHH protein, and 3 is the VHHs protein.

[0029] Figure 11 This is a graph showing the reactivity evaluation results of the bispecific nanobody VHHs.

[0030] Figure 12 This is a structural diagram of the binding site between the molecular docking-simulated bispecific nanobody VHHs and the PEDV-RBD protein.

[0031] Figure 13 This is a structural diagram of the binding site between molecular docking-simulated bispecific nanoantibodies VHHs and PDCoV-RBD protein.

[0032] Figure 14 This is a graph showing the evaluation results of the neutralizing activity of VHHs.

[0033] Figure 15 This is an ELISA result of the binding activity of VHHs to porcine enteric diarrhea virus. Detailed Implementation

[0034] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0035] The reagents and materials used in this embodiment are as follows:

[0036] The pCZN1-PEDV-RBD vector, pCZN1-PDCoV-RBD vector, PEDV strain, PDCoV strain, TGEV strain, and SADS-CoV strain were preserved by our team; helper phage M13K07 was purchased from New England Biolabs, and horseradish peroxidase (HRP)-labeled anti-M13 phage antibody was purchased from Sino Biological; plasmid extraction kit, agarose gel extraction kit, DNA marker, PVDF membrane, and BCA protein quantification kit were purchased from Tiangen Biotech Co., Ltd.; isopropyl-β-D-thiogalactoside (IPTG), BSA, and 3,3′,5,5′-methylbenzidine (TMB) were also used. The chromogenic solution and stop solution were purchased from Shanghai Sangon Biotech Co., Ltd.; TG1, BL21(DE3) competent cells, ampicillin (Amp), kanamycin (Kan), yeast extract peptone (YT), phosphate buffered saline (PBS), agarose, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) preparation kit, and ECL chromogenic solution were purchased from Beijing Solarbio Science & Technology Co., Ltd.; restriction endonucleases (Nde I, Xba I) and T4 ligase were purchased from New England Biolabs; Ni-NTA chromatography column was purchased from GenScript; and all other reagents were domestically produced analytical grade reagents.

[0037] Unless otherwise specified, all other reagents used in the experiment are common commercially available reagents; unless otherwise specified, all procedures used in the experiment are known in the field.

[0038] Example 1:

[0039] This example demonstrates the construction of an immune antibody library:

[0040] Step 1: Expression and purification of PEDV-RBD protein: The expression vector pCZN1-PEDV-RBD preserved by our team was transformed into E. coli BL21(DE3) competent cells, plated on LB agar plates (50 μg / mL Amp), and cultured overnight at 37°C with the plates inverted. Positive clones on the plates were selected and inoculated into 3 mL of LB medium (50 μg / mL Amp) and cultured at 37°C with shaking at 220 r / min until OD. 600 When the nm value reached 0.6~0.8, IPTG (final concentration 0.2 mM) was added and expression was induced at 15℃ and 220 r / min for 4 h. The cells were collected by centrifugation at 8000 r / min for 10 min, resuspended in pre-cooled PBS, and sonicated. The supernatant and precipitate were then analyzed by 12% SDS-PAGE. Figure 1A target fragment band was observed at 14.5 kDa, primarily in the form of inclusion bodies, consistent with the predicted size. The recombinant PEDV-RBD protein was purified using Ni-NTA affinity resin, eluted with 20 mM imidazole, and the protein expression and purification were assessed by SDS-PAGE, yielding purified PEDV-RBD protein.

[0041] Step 2: Expression and purification of PDCoV-RBD protein: Using the pCZN1-PDCoV-RBD plasmid preserved by our team as a template, it was transformed into E. coli BL21(DE3) competent cells, plated on ampicillin-containing LB agar plates, and cultured until OD2000. 600 When the nm value reached 0.6-0.8, IPTG (final concentration 0.2 mM) was added to induce expression; the induced bacterial cells were collected by centrifugation, and the supernatant and precipitate were collected separately after sonication for SDS-PAGE analysis. The results are as follows. Figure 2 As shown, the target fragment band was present at 14.5 kDa, mainly in the form of inclusion bodies, consistent with the estimated size. The recombinant PDCoV-RBD protein was purified using Ni-NTA affinity resin, eluted with 20 mM imidazole, and the protein expression and purification were confirmed by SDS-PAGE, yielding high-purity PDCoV-RBD protein.

[0042] Step 3: Construction of the immune nanobody library:

[0043] ① Alpaca Immunization: Healthy adult alpacas were selected. Purified PEDV-RBD protein and PDCoV-RBD of equal concentration were mixed evenly, then mixed with Freund's adjuvant at a 1:1 ratio. The mixture was then administered subcutaneously at multiple sites on the alpaca's back, with each immunization consisting of 300 μg / kg, spaced 2 weeks apart, for a total of 4 immunizations. Serum antibody titers >10 were measured using indirect ELISA. 6 It has a good immune effect.

[0044] ② Isolation of peripheral blood lymphocytes: 20 mL of anticoagulated blood was collected from the jugular vein of an alpaca and separated using lymphocyte separation medium. The cells were centrifuged at 2000 rpm for 30 min at room temperature. Liquid stratification was observed; the middle, cloudy liquid layer consisted of peripheral blood lymphocytes. All lymphocytes in this layer were aspirated along the tube wall and transferred to a new centrifuge tube. The cells were washed twice with 5 times the volume of balanced salt buffer, centrifuged at 1500 rpm for 15 min at room temperature, and the supernatant was discarded to obtain the lymphocytes.

[0045] ③ Total RNA extraction: Total RNA was extracted from peripheral blood lymphocytes using a total RNA extraction kit. The RNA extraction procedure was performed according to the instructions. cDNA was obtained using Oligo(dT) as a primer and M-MLV reverse transcriptase.

[0046] ④ VHH fragment amplification: Two rounds of PCR amplification were performed using reverse-transcribed cDNA as a template. First round primers: VH-F: 5'-CTTGGTGGTCCTGGCTGC-3'; VH-R: 5'-GGTACGTGCTGTTGAACTGTTCC-3'; Reaction system: 4 μL cDNA, 2 μL each primer, 4 μL dNTP Mix, 5 μL Taq Buffer, 0.25 μL Taq enzyme, and ddH2O to a final volume of 50 μL; Reaction conditions and program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 33 cycles; 72℃ extension for 10 min; Storage at 4℃, yielding approximately 900 bp VH-CH1-CH2 and approximately 600 bp... The VHH-CH2 fragment was extracted from the sample; VHH-CH2 was recovered as the template for the second round of PCR. Second-round primers: VHH-F: 5'-TGTTCCTTTCTATGCGGCCCAGCCGGCCCAGGTGCAGCTGCAGGAGTCTGGRGGAGG-3'; VHH-R: 5'-ATACGGCACCGGCGCACCTGCGGCCGCACTAGTGCGGCCGCTGGAGACG

[0047] GTGACCWGGGT-3'; Reaction system: 5 μL of first-round PCR product, 2 μL of each primer, 4 μL of dNTP Mix, 5 μL of Taq Buffer, 0.25 μL of Taq enzyme, and ddH2O to a final volume of 50 μL; Reaction conditions and program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 33 cycles; 72℃ extension for 10 min; Store at 4℃.

[0048] ⑤ Phage Display Library Construction: Using pCANTAB-5E as the phage vector, 10 μg of the vector and 5 μg of the second-round PCR product were digested with restriction endonucleases SfiI and NotI, respectively, and incubated at 37°C for 4 h. The pCANTAB-5E vector and VHH fragment digestion products were purified using a DNA purification kit. The vector and VHH fragment were ligated using a 2 mL ligation system: 2 μg VHH fragment, 5 μg pCANTAB-5E vector, 40 μL T4 ligase, 250 μL T4 buffer, and ddH2O added to a final volume of 2 mL. Ligation was performed overnight at 4°C. TG1 competent cells were thawed on ice, and the ligation products were added and mixed thoroughly before being transferred to a pre-chilled electroporation cuvette for electroporation. 100 μL of the electroporation product was serially diluted 10-fold and plated onto LB agar plates (containing AMP and GLU), and incubated overnight at 37°C. 6 The average number of positive clones obtained on the dilution plate was 200, and the calculated library volume was 2 × 10⁻⁶. 9 cfu / mL. Twenty-four positive monoclonal bacteria were randomly selected from the plate for colony PCR identification, such as... Figure 3 The recombination rate was 100%. The remaining bacterial culture was plated on LB agar plates (containing AMP and GLU), incubated overnight at 37°C, the bacterial culture was collected, glycerol was added and mixed well, and then aliquoted and stored.

[0049] Example 2:

[0050] This embodiment describes a method for obtaining the PEDV-VHH sequence:

[0051] Screening of PEDV-RBD-specific nanobodies: Purified PEDV-RBD protein was diluted to 10 μg / mL with coating buffer, and 100 μL was added to each well of a 96-well microplate. The plates were incubated overnight at 4°C. Wells containing only PBS were used as negative controls. The coating buffer was discarded, and 300 μL of PBST blocking buffer containing 1% BSA was added to each well. The plates were incubated at 37°C for 2 h, followed by washing three times with 300 μL of PBST (containing 0.1% Tween-20). The rescued immunoglobulin library was added to the coated wells, and the plates were incubated at 37°C and 220 r / min for 2 h. Discard the phage samples, wash 10 times with PBST, add 100 μL of pre-chilled 0.1 mol / L Glycine-HCl (pH 2.5) to each well, incubate at room temperature for 10 min, then add the same volume of 1 mol / L Tris-HCl (pH 7.4) to neutralize, collect the first eluent, infect TG1 competent cells, mix well, incubate at 37°C for 30 min, add 2×YT (containing 100 µg / mL ampicillin) medium, and culture at 37°C and 220 r / min to the logarithmic growth phase. Add 20 mol M13K07 helper phage for the second round of panning, and perform a total of three rounds of panning. In the subsequent second and third rounds of panning, the PEDV-RBD protein coating concentration was successively decreased to 5 μg / mL and 2.5 μg / mL to achieve effective enrichment of positive phages. Record and count the phage titers after each round of panning, and calculate the recovery rate and enrichment degree. Recovery rate = Phage output PFU / Phage input PFU; Enrichment degree = Recovery rate in this round / Recovery rate in the previous round. The results are shown in Table 1. After three rounds of screening, the recovery rate and enrichment degree of phages with binding activity increased in each of the three rounds of screening.

[0052] Table 1. Enrichment of PEDV recombinant phages after three rounds of panning.

[0053]

[0054] Phage-ELISA assay: A 96-well microplate was coated with 2 μg / mL PEDV-RBD protein. Third-round panning of positive phages was added as primary antibody (PBS was added to control wells). The plate was incubated at 37°C for 1 h. Then, 100 μL of anti-M13 phage (HRP-labeled) antibody (1:15000 dilution) was added as secondary antibody. The plate was incubated at 37°C for 1 h. 100 μL of chromogenic buffer was added, and the plate was incubated at 37°C for 15 min. Finally, 100 μL of stop buffer was added, and the OD values ​​of the sample wells were read. 450 nm value / OD of negative control well 450 A result of nm ≥ 2.1 (P / N ≥ 2.1) indicates a positive result, and 15 positive clones reacting with PEDV-RBD have been preliminarily identified.

[0055] 96-well microplates were coated with 2 μg / mL LPEDV-RBD protein (target protein) and non-target protein, respectively. The 15 positive clones obtained were used as primary antibodies for phage-ELISA retesting. The OD values ​​of the target protein wells were used as the assay result. 450 nm / non-target protein pore OD 450 A result of nm ≥ 3 is considered positive, as shown in the following figure. Figure 4 As shown: Seven positive clones were finally obtained and sent for sequencing.

[0056] High-efficiency expression and purification of PEDV-RBD nanobodies: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] 450 The VHH5 plasmid, with the highest nm value, was inserted into the pCZN1 prokaryotic vector via enzyme digestion and ligation (Nde I, Xba I) to construct the pCZN1-PEDV-VHH expression plasmid. This plasmid was then transformed into BL21(DE3) competent cells for prokaryotic expression and purification. Figure 10 As shown in lane 2, the VHH purification status was identified by SDS-PAGE, and the target protein was present at 14 kDa.

[0057] PEDV-RBD was subjected to SDS-PAGE electrophoresis and transferred to a membrane. Purified VHH was used as the primary antibody, and HRP-labeled mouse anti-M13 phage monoclonal antibody was used as the secondary antibody. Figure 6 As shown in the left figure, PEDV-RBD protein can be detected by Western blot, while no band is found in the PBS control group, indicating that the screened VHH5 can specifically recognize the PEDV-RBD fragment and has good reactivity. The amino acid sequence of PEDV-VHH is shown in SEQ ID NO.1.

[0058] Example 3:

[0059] This embodiment describes a method for obtaining the PDCoV-VHH sequence:

[0060] Screening of PDCoV-RBD-specific nanobodies: Purified PDCoV-RBD protein was diluted to 10 μg / mL with coating buffer, and 100 μL was added to each well of a 96-well ELISA plate. The plates were incubated overnight at 4°C. Wells containing only PBS served as negative controls. The screening procedure was the same as in Example 2. After three rounds of panning, the recovery rate of phages with binding activity increased in each of the three rounds.

[0061] The amount of phage introduced in each round is 1.2 × 10⁻⁶. 12 The recovery rate of PFU increased with each round, reaching 2.3 × 10⁻⁶ in the third round. -5 This shows that specific phages were effectively enriched (Table 2).

[0062] Table 2. Enrichment of PDCoV recombinant phages after three rounds of panning

[0063]

[0064] After the third round of screening, single clones were randomly selected for phage-ELISA screening. The clones were coated with PDCoV-RBD and used anti-M13-HRP as the secondary antibody. 450nm A ≥2.1-fold difference between the negative control and the target protein was considered positive. Twenty positive clones were obtained from the initial screening. These clones were then coated with 0.5 μg / mL PDCoV-RBD protein (target protein) and non-target protein onto 96-well ELISA plates. The 20 positive clones were used as primary antibodies for further ELISA identification. A positive result was defined as an OD450nm ratio ≥3 between the target protein well and the non-target protein well. Figure 5 As shown, five positive clones were finally obtained. These five positive clones were subjected to PCR amplification and sequencing. VHH5, which exhibited high specificity and the best activity against the RBD region of the PDCoV S protein, was selected. The purification results are shown below. Figure 10 As shown in lane 1, the target protein is present at 14 kDa, and as... Figure 6 The reaction activity was verified by Western blot, as shown in the right figure. The amino acid sequence of PDCoV-VHH is shown in SEQ ID NO.2.

[0065] Example 4:

[0066] This example demonstrates the construction and validation of bispecific nanobodies:

[0067] I. Construction of Bispecific Nanobodies: Using the nanobody targeting the RBD region of the PEDV S protein in Example 2, PEDV-VHH (amino acid sequence as shown in SEQ ID NO.1), and the nanobody targeting the RBD region of the PDCoV S protein in Example 3, PDCoV-VHH (amino acid sequence as shown in SEQ ID NO.2), as research subjects, and Linker:(G4S)3 (amino acid sequence as shown in SEQ ID NO.4) as the linker peptide, the structure is as follows. Figure 7 As shown, the bispecific nanobody fragment VHHs (amino acid sequence as shown in SEQ ID NO.3) was synthesized; the bispecific nanobody fragment VHHs and the pCZN1 vector were double-digested with Nde I and Xba I, respectively, ligated, and transformed into E. coli competent cells Top10. Positive clones were selected for sequencing verification. The recombinant expression vector with correct sequencing was named pCZN-VHHs and identified by agarose gel electrophoresis. Figure 8 As shown, a target band of approximately 750 bp was obtained, consistent with the expected size.

[0068] II. Prokaryotic Expression and Purification of Bispecific Nanobodies: The recombinant expression vector pCZN-VHHs constructed in step one was transformed into Escherichia coli BL21(DE3) for prokaryotic induction expression. The expression product was collected, and the protein was purified by Ni-NTA affinity chromatography. The protein was eluted with imidazole, and the expressed and purified bispecific nanobodies were identified by SDS-PAGE. Figure 9 As shown, VHHs protein was obtained at approximately 28 kDa after expression induced by 0.2 mM IPTG and identified by SDS-PAGE. Purification was performed using Ni-NTA, as shown... Figure 10 As shown in lane 3, purified VHHs protein was obtained, with a concentration of 0.6 mg / mL as determined by BCA, and a purity greater than 90%.

[0069] III. Identification of the reactivity of bispecific nanobodies: The binding activity of VHHs to PEDV-RBD and PDCoV-RBD proteins was determined by indirect ELISA. ELISA plates were coated with 2 μg / mL PDCoV-RBD, PEDV-RBD protein, and non-target protein, respectively, and incubated overnight at 4°C; blocked with 5% BSA for 2 h; 10 μg / mL PDCoV-VHH, PEDV-VHH, and VHHs were added, and incubated at 37°C for 1 h; after washing with PBST, HRP-labeled secondary antibody (1:5000 dilution) was added, and incubated at 37°C for 1 h; TMB substrate was used for color development for 15 min, and the reaction was terminated with 2 mol / L H2SO4. The absorbance (OD) at 450 nm was measured using an ELISA reader. 450 The result is as follows: Figure 11 As shown, the prepared bispecific nanobody VHHs exhibits good binding activity with PEDV-RBD and PDCoV-RBD proteins, and its binding activity is not significantly different from that of the monovalent nanobody control group. This indicates that the prepared bispecific fusion protein exhibits similar functions to the monovalent nanobody and has good binding activity with both target antigens.

[0070] IV. Molecular docking simulation of viral protein-nanobody reaction: Three-dimensional structural models of PEDV-RBD and PDCoV-RBD proteins were created using AlphaFold 2. Subsequently, HDOCK software was used to perform antigen protein-bispecific nanobody docking, yielding multiple protein-protein complex structures. These structures were sorted and screened based on their confidence scores, and the protein-protein complex structure with the highest confidence score was selected as the target. This structure was then imported into Pymol software to analyze the protein-protein binding sites. A confidence score ≥ 0.7 indicates that the two proteins are bound together.

[0071] Molecular simulation docking results showed that the bispecific nanobodies VHHs successfully docked with both PEDV-RBD and PDCoV-RBD. The simulation docking results of VHHs with PEDV-RBD are shown below. Figure 12 The amino acids ARG45, ARG106, ARG180, PHE182, TYR195, GLN235, LYS242, ARG180, and GLU181 of VHHs form hydrogen bond interactions with the amino acids ASP6, ASP5, SER1, PRO29, GLN72, ASN104, HIS34, ASN32, GLN72, and TYR106 of PEDV-RBD, respectively. The amino acids ARG45 and ARG106 of VHHs form salt bridge interactions with the amino acids ASP5 and ASP3 of PEDV-RBD, respectively. The confidence score for docking is 0.9274. The simulated docking results of VHHs and PDCoV-RBD are shown in […]. Figure 13 The amino acids GLN3, ASN168, GLN235, SER238, LYS237, GLN235, MET239, PRO236, and LYS237 of VHHs form hydrogen bonds with the amino acids THR56, ASP57, CYS59, VAL93, ASN95, and ARG55 of PDCoV-RBD, respectively, with a docking confidence score of 0.9129. Spatial structure analysis demonstrates that the bispecific nanobody exhibits good reactivity with both PEDV-RBD and PDCoV-RBD.

[0072] V. Identification of neutralizing activity of bispecific nanobodies: 10 μg / mL PDCoV-VHH, PEDV-VHH, and VHHs nanobodies were serially diluted in MEM medium (2... 1 ~2 10 ), and equal amounts of PDCoV, PEDV viral fluid and a mixture of the two viruses (100 TCID) 50 Mix the serum and incubate at 37°C for 1 hour. Inoculate 100 μL of the mixture into 96-well plates confluent with porcine kidney epithelial cells and incubate at 37°C with 5% CO2 for 5-7 days, observing cytopathic effects (CPE). Calculate the neutralizing titer using the Reed-Muench method; this value represents the highest dilution of serum capable of protecting 50% of cells from cytopathic effects. Virus controls and cell controls were also included. Figure 14 As shown, the neutralizing titer (IC50) of bispecific antibodies VHHs against PEDV is... 50 The neutralizing titer (IC50) against PDCoV was 0.1563 μg / mL. 50 The neutralizing titer (IC50) against a mixture of PEDV and PDCoV viruses was 0.3125 μg / mL. 50The concentration was 0.0781 μg / mL, indicating that the bispecific nanobody had good neutralizing activity against both PEDV and PDCoV.

[0073] VI. Antiviral specificity ELISA assay: PEDV, PDCoV, and a mixture of PEDV and PDCoV viruses were coated onto ELISA plates and incubated overnight. TGEV and SADS-CoV, two viruses that cause intestinal diarrhea in pigs during production, were used as viral controls. The viruses were diluted to 100 TCID. 50 PBS was used as a negative control. Blocking with 1% BSA for 2 hours was performed. PEDV-VHH, PDCoV-VHH, and VHHs were serially diluted to 10 μg / mL, 5 μg / mL, 2.5 μg / mL, 1.25 μg / mL, and 0.625 μg / mL as primary antibodies, and incubated for 2 hours. Secondary antibody was prepared by a 1:10000 dilution of anti-M13 phage antibody (HRP-labeled), and incubated for 1 hour. TMB was used for color development, and ELISA was performed to verify the antiviral activity of the nanobodies. The binding activity of the nanobodies to the virus at different concentrations is shown in the figure below. Figure 15 VHHs at all dilutions could specifically react with PEDV, PDCoV and a mixture of the two viruses, with a P / N ≥ 2.1, but did not react with TGEV or SADS-CoV.

[0074] In summary, this invention successfully prepared bispecific nanobodies targeting the S protein RBD domains of PDCoV and PEDV. These antibodies can simultaneously target and validate PEDV and PDCoV, avoid cross-reaction with other viruses that cause swine diarrhea, such as TGEV and SADS-CoV, and exhibit high stability and dual-target recognition capabilities. They can serve as an ideal detection tool for "one tube, two tests," significantly improving the diagnostic accuracy of PEDV / PDCoV mixed infection samples.

[0075] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A bispecific nanobody targeting PEDV and PDCoV, characterized in that, The bispecific nanobody comprises a first antigen-binding domain PEDV-VHH specific to PEDV and a second antigen-binding domain PDCoV-VHH specific to PDCoV; the amino acid sequence of PEDV-VHH is shown in SEQ ID NO.1; the amino acid sequence of PDCoV-VHH is shown in SEQ ID NO.

2.

2. The bispecific nanobody according to claim 1, characterized in that, The first antigen-binding domain PEDV-VHH and the second antigen-binding domain PDCoV-VHH are connected by a linker.

3. The bispecific nanobody according to claim 2, characterized in that, The amino acid sequence of the connector is shown in SEQ ID NO.

4.

4. The bispecific nanobody according to any one of claims 1-3, characterized in that, The amino acid sequence of the bispecific nanobody is shown in SEQ ID NO.

3.

5. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a bispecific nanobody as described in any one of claims 1-3 or a bispecific nanobody as described in claim 4.

6. A vector comprising the nucleic acid molecule as described in claim 5.

7. A host cell comprising the nucleic acid molecule as described in claim 5 or the vector as described in claim 6.

8. A method for preparing the bispecific nanobody according to any one of claims 1-3 or the bispecific nanobody according to claim 4, characterized in that, The method is as follows: culturing the host cells of claim 7 under conditions that allow protein expression, and recovering the bispecific antibody from the cultured host cell culture.

9. A reagent or kit for detecting PEDV and / or PDCoV, characterized in that, The reagent or kit contains the bispecific nanobody as described in claim 1.

10. The use of the bispecific nanobody as described in claim 1 or the bispecific nanobody constructed by the construction method as described in claim 2 in the preparation of drugs for the prevention or treatment of PEDV and / or PDCoV infection.

Images