Spiropolyspora pink MLY32, microbial inoculum as well as preparation method and application of microbial inoculum
A biocontrol agent was prepared by co-culturing *Alternaria pinki* MLY32 with the non-pathogenic *Phytophthora tobaccois* MLY61 using solid-state fermentation technology. This solved the problems of parasitic degradation and pathogenicity risk of *Alternaria pinki* in multi-generation culture, achieving efficient and safe control of *Phytophthora tobaccois*, which meets the requirements of green agricultural development.
Patent Information
- Application Number
- CN202411587401.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-08
- Publication Date
- 2026-05-12
AI Technical Summary
The existing *Polyspora pinkis* strain has a risk of parasitic degradation after multiple generations of non-parasitic culture and expanded culture, and there is a risk of pathogenicity when co-cultured with pathogenic *Phytophthora nicotineis*, resulting in unstable biological control effects.
A biocontrol agent was prepared by co-culturing *Polyspora pinkis* MLY32 and non-pathogenic *Phytophthora tobaccois* MLY61 using solid-state fermentation technology. The high invasiveness of MLY32 and the non-pathogenicity of MLY61 were utilized to maintain the viability of the parasites and avoid the risk of pathogenicity. During the preparation process, auxiliary materials such as wheat bran, corn starch, corn flour, soybean flour, and cassava flour were used to form the inoculum.
It achieves highly effective inhibition of Phytophthora infestans, reduces the frequency of chemical agent use, and improves the stability and safety of biological control agents, which is in line with the concept of green and sustainable development.
Smart Images

Figure CN122012246A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biological control agents, mainly to a strain of *Polyspora pinkis* MLY32, the agent, its preparation method, and its application. Background Technology
[0002] Phytophthora indicum ( Phytophthora nicotianae This fungus is a serious threat to crop health, with a very wide host range. It is estimated that it can infect 255 genera of plants from 90 plant families, causing crop diseases such as crown rot, root rot, fruit rot, stunted growth, leaf rot, and stem infection. Even without a host plant, it can survive in the soil for a long time (4-6 years) and can reproduce sexually and asexually, with a reproductive cycle of 72 hours, making it a difficult-to-control fungal pathogen.
[0003] Pink Spiral Polyporus ( Clonostachys rosea Fungi (Agromycetes var. sarcodactylis) are endophytic filamentous fungi distributed worldwide. In nature, they primarily function as saprophytes in soil, epiphytes on plants, and branching parasites, exhibiting broad nutritional plasticity. Due to their ability to parasitize and promote plant growth, and their capacity to produce various volatile organic compounds, they possess a certain degree of toxicity to other fungi, bacteria, and insects, showing promising applications in biological control and biodegradation. In recent years, solid-state fermentation technology for fungi has been increasingly applied to agricultural production. As an environmentally friendly pesticide formulation, it can not only control diseases but also promote crop growth, increase yields and efficiency, improve soil health, and contribute to sustainable agricultural development, providing crucial support for achieving green and ecological agriculture.
[0004] Cultivating *Alternaria pinki* MLY32 using solid-state fermentation technology can significantly improve its spore yield and disease resistance. During solid-state fermentation, selecting suitable solid substrates (such as sawdust, bran, etc.) and nutrient additives can provide a favorable growth environment for *Alternaria pinki* MLY32, promoting its proliferation and the generation of metabolically active products. These active products, including antibiotics, enzymes, and secondary metabolites, can effectively inhibit the growth and infection of *Phytophthora indicum*, protecting crops from disease. Furthermore, solid-state fermentation is more economical and environmentally friendly than liquid fermentation, making it suitable for large-scale production and application. Optimizing fermentation conditions, such as temperature, humidity, and aeration, can further enhance the biocontrol efficacy of *Alternaria pinki* MLY32.
[0005] However, the nutritional metabolism of parasitic fungi often has certain unique characteristics, and after multiple generations of non-parasitic culture and expansion culture, there is a high risk of degradation of parasitic ability. This is one of the main reasons for the unstable activity and application effect of some parasitic fungal agents. Co-culturing with the host pathogen (Phytophthora tobaccois) is a good method to maintain the parasitic nature of *Alternaria pinki*; however, the finished product may carry pathogenic *Phytophthora tobaccois*, posing a certain risk of pathogenicity during application. Therefore, if non-pathogenic *Phytophthora tobaccois* can be co-cultured with *Alternaria pinki*, it can effectively maintain parasitic viability while avoiding the risk of pathogenicity.
[0006] This invention utilizes solid-state fermentation co-culture technology of *Polyspora pinkis* MLY32 and non-pathogenic *Phytophthora tobaccois* MLY61 to prepare a biocontrol agent for controlling *Phytophthora tobaccois*. This method maintains the high parasitic viability of MLY32 while avoiding the pathogenic risk of *Phytophthora tobaccois*. The resulting product has broad application prospects and significant practical value. Summary of the Invention
[0007] The purpose of this invention is to provide a *Polyporus pulveratus* var. *pinnatifida*, its inoculum, preparation method, and applications. *Polyporus pulveratus*, as a branching parasite, not only produces secondary metabolites and degrading enzymes to directly participate in the control of pathogens, but also indirectly improves plant survival by inducing systemic resistance, making it a promising biocontrol strain. Utilizing it to prepare a biocontrol agent aligns perfectly with current green and sustainable development principles. The inoculum is prepared using a low-cost, high-yield solid-state fermentation method. The fermented material can serve as an initial nutrient source for *MLY32*, helping it to better colonize the soil and thus improving its control effect. The resulting inoculum can provide a novel biological agent for agricultural pest and disease control, reducing the use of chemical agents and protecting the soil environment.
[0008] The present invention is based on *Pink Spiral Polysporus* (…). Clonostachys rosea MLY32, collection number CGMCCNo.40347.
[0009] Furthermore, the pink spiral polyspora MLY32 was obtained by co-culturing wild-type strain CR032 with wild-type pathogenic strain PpN03 of Phytophthora parasitica var. nicotianae for multiple generations, and highly invasive mycelia were selected from each generation.
[0010] The application of the aforementioned *Polyspora pinkis* MLY32: for inhibiting fungi, especially *Phytophthora*. Further, it is used to inhibit *Phytophthora xylophilus*.
[0011] The present invention also provides an inhibitory agent for Phytophthora, prepared by culturing the aforementioned Polyspora pinkis MLY32.
[0012] Furthermore, the fungal agent consists of *Polyspora pinkis* MLY32 and a small amount of non-pathogenic *Phytophthora parasitica* var. *nicotianae* MLY61, with accession number CGMCC No. 40348.
[0013] This fungal agent is not pathogenic to plants, but MLY32 has a high parasitic activity against the wild-type pathogenic strain PpN03 of Phytophthora parasitica var. nicotianae.
[0014] The present invention also provides a method for preparing the aforementioned inhibitory agent for Phytophthora indica, wherein the aforementioned Polyspora pinkis MLY32 and the aforementioned Phytophthora tobaccois MLY61, along with excipients, are mixed and cultured.
[0015] The auxiliary ingredients include at least one of wheat bran, corn starch, corn flour, soybean flour, tapioca flour, and xanthan gum.
[0016] Furthermore, the specific steps include: Step 1: Mix 50-150 g of wheat bran, 100-800 g of sawdust, and 0.1-1.0 L of distilled water until well combined. Place the mixture in a high-temperature sterilizer at 120-135℃ and sterilize for 5-30 minutes. Then cool the mixture after sterilization. The second step involves cutting small mycelial blocks, each 3.0-5.0 mm in length and width, from PDYH solid culture medium containing the pink spiral polyspora strain MLY32 and the tobacco parasitic phytophthora MLY61, respectively. 5-20 small mycelial blocks are added to each 800 g of the solid fermentation material described in the first step, and the mixture is placed in a constant temperature incubator at 25-35℃ for fermentation for 15-60 days. The PDYH solid culture medium was prepared by dissolving 6.0 g of potato flour, 20.0 g of glucose, 20.0 g of agar, and 6.0 g of yeast extract in 1000 mL of distilled water and 50.0 g of humic acid in 250 mL of distilled water, which were then separately sterilized at high temperature and mixed together.
[0017] The third step is to take 100-300 g of MLY32-61 solid fermentation material and mix it with 50-100 g of corn flour after fermentation. The fourth step is to mix 300-700 g of cassava flour with 150-400 mL of boiling water at 100℃, and the cassava flour will gelatinize to form a dough. Fifth step: Mix the mixture from the third step with the cooled tapioca flour dough from the fourth step, and knead and press it so that the dough wraps around the mixture. The sixth step is to place the dough containing the mixture obtained in the fifth step into the pelleting agent and press it into 0.5-10 cm particles to obtain the bacterial agent.
[0018] The *Polyspora pinkis* strain described in this invention ( Clonostachys rosea MLY32 was obtained by parasitizing an initial wild-type strain CR032 on a wild-type pathogenic strain of Phytophthora parasitica var. nicotianae, PpN03, and then selecting highly invasive mycelia from each generation after multiple generations of co-culture.
[0019] The *Polyspora pinkis* strain MLY32 exhibited explosive growth after parasitizing the mycelia of *Phytophthora nicotinae* MLY61 and PpN03. After parasitism by MLY32, the proliferation rate of the pathogenic wild-type *Phytophthora nicotinae* strain PpN03 was significantly reduced, and mycelial growth was restricted; after 15 days, the mycelial radius was 4.5-5.0 cm, which is 56-62.5% of normal growth.
[0020] Furthermore, strain MLY32 parasitized on strain PpN03 of Phytophthora indicum and effectively inhibited the activity of Phytophthora indicum through lysis. The width of the parasitic inhibition zone can reach 0.5-5.2 cm (plate diameter 9.0 cm).
[0021] The *Alternaria pinki* strain MLY32 provided by this invention was obtained through multi-generation co-culture and domestication breeding of wild-type *Alternaria pinki* strain isolated from the rhizosphere soil of healthy tobacco plants in Xingyi, Guizhou Province, and *Phytophthora tobaccois*. This strain possesses the ability to control *Phytophthora tobaccois*. After parasitization, the proliferation rate of *Phytophthora tobaccois* strain PpN03 is significantly reduced. At 10 days, *Alternaria pinki* MLY32 exhibits explosive growth, while the mycelial growth rate of *Phytophthora tobaccois* PpN03 is limited, with a mycelial radius of 4.5-5.0 cm at 15 days, which is 56-62.5% of normal growth. Solid-state fermentation promotes its reproduction and the generation of metabolically active products, subsequently preparing a microbial agent. The preparation process is simple, easy to operate, and low in cost. Furthermore, *Alternaria pinki* is widely distributed and easy to isolate and obtain, has high nutritional plasticity, and is easy to colonize in soil. Compared with traditional biological agents, it has stronger activity, ensuring antagonistic effects against *Phytophthora tobaccois* and reducing the application of chemical agents.
[0022] Beneficial effects of the invention The strain of this invention exhibits excellent control effects against Phytophthora infestans, demonstrating high nutritional plasticity, which effectively inhibits the growth of pathogenic fungi. It shows particularly outstanding benefits in developing highly efficient biocontrol agents that simultaneously encapsulate inoculants and nutrients, and has broad application prospects in plant protection.
[0023] This invention relates to the *Polyporus pulcherrimus* strain MLY32, classified and named as: *Polyporus pulcherrimus*. Clonostachys rosea Accession number: CGMCC No.40347, deposit date: October 28, 2022; depositary institution: China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.
[0024] This invention relates to Phytophthora parasitica var. nicotianae, classified as Phytophthora parasitica var. nicotianae, with accession number CGMCC No. 40348, deposited on October 28, 2022; deposited at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. Attached Figure Description
[0025] Figure 1 The antagonistic effect of *Polyporus pulveratum* strain MLY32 used in this invention against *Phytophthora indicum* PpN03 on PDYH solid medium is shown in Figure a. Figure a shows the *Phytophthora indicum* PpN03 control after 7 days. Figures b1-b3 show the antagonistic effect of *Polyporus pulveratum* strain MLY32 against *Phytophthora indicum* PpN03 after 5, 7, and 15 days, respectively. Figure c shows the *Polyporus pulveratum* strain MLY32 control after 7 days.
[0026] Figure 2 The antagonistic effect of *Polyspora pinkis* strain MLY32 used in this invention on *Phytophthora nicotinae* PpN03 on PDA solid medium is shown in Figure a. *Polyspora pinkis* strain MLY32, Figure b. antagonistic effect of *Polyspora pinkis* strain MLY32 on *Phytophthora nicotinae* PpN03, and Figure c. *Phytophthora nicotinae* PpN03. The time periods for a and c are 30 days, and for b is 36 days.
[0027] Figure 3The images show the antagonistic effects of *Polyporus pulveratum* strain MLY32 used in this invention against *Phytophthora indicum* PpN03, *Alternaria alternata* MLY62, *Fusarium oxysporum* MLY127, and *Fusarium solani* MLY128 on PDYH medium for 15 days. a) shows the antagonistic effect of *Polyporus pulveratum* strain MLY32 against *Phytophthora indicum* PpN03 for 15 days, with the area within the red line representing the explosive growth zone; b) shows the antagonistic effect of *Polyporus pulveratum* strain MLY32 against *Alternaria alternata* MLY62 for 15 days; c) shows the antagonistic effect of *Polyporus pulveratum* strain MLY32 against *Fusarium oxysporum* MLY127 for 15 days; d) shows the antagonistic effect of *Polyporus pulveratum* strain MLY32 against *Fusarium solani* MLY128 for 15 days. *Alternaria alternata* MLY62, *Fusarium oxysporum* MLY127, and *Fusarium solani* MLY128 were all provided by Professor Liu Yong of the Microbial Engineering Laboratory at Zhejiang University of Science and Technology.
[0028] Figure 4 The image shows the 15-day culture results of the purchased *Polyspora pinkis* strain MLY196 (purchased from the China General Microbiological Culture Collection Center) against *Phytophthora tobaccois* PpN03 (a), *Fusarium oxysporum* MLY127 (b), and *Fusarium solani* MLY128 (c).
[0029] Figure 5 Comparison of solid-state fermentation culture of MLY32 alone (a) and solid-state fermentation culture of MLY32-61 (b); Figure 6 The particle morphology diagram is shown for the optimal formulation of the bacterial agent prepared according to the present invention. Figure 7 The image shows the effect of the bacterial agent prepared in this invention growing on an agar block for two days. Figure 8 The following diagram shows the application of the microbial agent prepared according to this invention in the field 15 days after transplanting (one seedling was placed on the day of transplanting, followed by the tobacco seedling; 3 seedlings were placed 15 days after transplanting (to seal the seedlings); after sealing the seedlings on the same day, the 3 seedlings were evenly distributed around the tobacco plants without touching them). Detailed Implementation
[0030] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.
[0031] Example 1:
[0032] Isolation and acclimatization of *Polyporus pulcherrimus*: Wild-type strains of *Polyporus pulcherrimus* were isolated from soil samples around the roots of healthy flue-cured tobacco plants in Qianxinan Prefecture, Guizhou Province. The isolation process involved sifting the rhizosphere soil through a 10-mesh sieve to remove small stones and withered leaves. 10 g of the sieved soil was weighed and placed in 100 mL of sterile distilled water. The sample was subjected to an ultrasonic water bath for 10 min, followed by agitation at 150 rpm for 30 min to form a soil suspension. The suspension was then diluted to a final concentration of 10 g. 3 10 4 10 5 Diluent: Spread the diluent evenly onto PDA solid medium. Incubate the plates upside down in a 25-35°C incubator for 5 days. Select colonies with different morphological characteristics and re-inoculate them into PDA solid medium. Repeat this process until a single and evenly distributed colony population is obtained. For long-term preservation, store the strain at -80°C using 15% glycerol.
[0033] The isolated strain was transferred to a PDYH plate inoculated with Phytophthora tobaccosa PpN03 (isolated and preserved by the Microbial Engineering Laboratory of Zhejiang University of Science and Technology) on one side for antagonistic effect testing. Finally, a strain, CR032, was obtained that exhibited antagonistic effects against PpN03. Subsequently, co-culturing CR032 with pathogenic wild-type Phytophthora tobaccosa PpN03 stimulated and enhanced its parasitic ability. Multiple generations of co-culturing were conducted, and highly invasive mycelia were selected from each generation, ensuring that the domesticated strain maintained excellent invasive parasitic ability, thus exhibiting a novel characteristic of explosive growth in the control of Phytophthora tobaccosa. Figure 1 2) We named the domesticated strain MLY32. After domestication, MLY32 showed improved antagonism against Phytophthora tobaccois. After 15 days of incubation, the diameter of the mycelium cake in the antagonism test was 56-62.5% of that of normal growth.
[0034] The ITS sequence of strain MLY32 is shown in SEQ ID NO.1. Sequence alignment revealed a 99.81% similarity to *Alternaria pinki* in GenBank, therefore it was identified as *Alternaria pinki*.
[0035] SEQ ID NO.1 TCTGAGGTCACCTTGGAAGTTGGGGGTTTAACGGCAGGGGCTCGTCGCTCTCCGATGCGGAATATCACTACTTCGCAGAG GAGGCCACGACGGGTCCGCCACTAGATTTAGGGGCCGGCCGTCCCTCGCGGGCTTTGGCCGATCCCCAACACCACGCCCT AGGGGCATGAGGGTTGAAATGACGCTCAGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTC GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCC GTTGTTGAAAGTTTTTATTTATTTGTAAAAACTACTCAGAAGATTCCAAAATAAAACAAGAATTAAGTTTCCTAGGCGGG CGCCTGATCCGGGGCACACGAGGCGCCCGGGGCAATCCCGCCGAAGCAACAGTAGGTATGTTCACATGGGTTTGGGAGTT GTAAACTCGGTAATGATCCCTCCGCAGGTTCACCCTACGGAA Polyspora pinkis MLY32 strain, taxonomic name: Polyspora pinkis, Latin name: Clonostachys rosea .
[0036] Phytophthora indicum strain PpN03, taxonomic name: Phytophthora indicum, Latin name: Phytophthora parasitica var. nicotianae It was isolated and preserved by the Microbial Engineering Laboratory of Zhejiang University of Science and Technology, Zhejiang Province, China.
[0037] After 7 days of incubation, the hyphae of *Phytophthora tobaccospar* PpN03 and *Alternaria pinki* MLY32 began to come into contact. Subsequently, MLY32 began to slowly attach and grow onto the hyphae of *Phytophthora tobaccospar* PpN03. After 10 days of incubation, MLY32 began to rapidly cover the hyphae of *Phytophthora tobaccospar* PpN03, exhibiting explosive growth and forming a crescent-shaped parasitic zone. However, no parasitic zone appeared during the antagonistic process with *Alternaria alternata* MLY62, *Fusarium oxysporum* MLY127, and *Fusarium solani* MLY128, nor did they exhibit explosive growth. Figure 3 After 30 days of incubation, MLY32 completely covered Phytophthora nicotineis PpN03.
[0038] Example 2:
[0039] Polyspora pinkis MLY196 strain, taxonomic name: Polyspora pinkis, Latin name: Clonostachys rosea Purchased from the China General Microbiological Culture Collection Center, catalog number 3.1890. Address: China General Microbiological Culture Collection Center, Beijing, China.
[0040] The purchased *Polyporus pulveratum* MLY196 and *Phytophthora citrinum* PpN03 were inoculated into the same petri dish for an antagonistic experiment. It was found that after their hyphae met, *Polyporus pulveratum* MLY196 did not exhibit the explosive, covering growth seen in *Polyporus pulveratum* MLY32, but instead formed an antagonistic morphology between the two strains, with neither able to further expand its growth. Figure 4 The antagonistic effect is also observed against Fusarium oxysporum MLY127 and Fusarium solani MLY128.
[0041] Example 3:
[0042] On PDYH solid medium, a piece of mycelium was taken from the frozen MLY32 sample and inoculated into the center of the medium. The culture was then incubated in a constant temperature incubator at 25-35℃ for 7-60 days. The optimal growth temperature for MLY32 is 30℃, and it can fully colonize a circular petri dish with a diameter of 9 cm in 25 days.
[0043] Example 4:
[0044] In PDA solid medium, take a frozen piece of MLY32 mycelium and inoculate it into the center of the medium. Incubate in a constant temperature incubator at 25-35℃ for 7-60 days. The optimal growth temperature for MLY32 is 30℃, and it can fully grow into a circular culture dish with a diameter of 9cm in 30 days.
[0045] Example 5:
[0046] In Czapek's solid medium, take a frozen MLY32 mycelium disc and inoculate it into the center of the medium. Incubate in a constant temperature incubator at 25-35℃ for 7-60 days. The optimal growth temperature for MLY32 is 30℃, and it can fully colonize a circular petri dish with a diameter of 9 cm in 40 days.
[0047] Example 6:
[0048] Development of MLY32-61 solid-state fermentation process: After single-factor screening, principal factor analysis, and response surface methodology, the formula for MLY32-61 solid-state fermentation culture medium was obtained. The solid-state fermentation materials in the formula are: 50-150 g wheat bran, 100-800 g sawdust, and 0.1-1.0 L distilled water.
[0049] The optimal solid fermentation medium for MLY32-61 has the following fermentation material formula (800 g): 80 g wheat bran, 200 g sawdust, and 520 mL distilled water.
[0050] The solid-state fermentation process used a control group (MLY32 solid-state fermentation substrate) inoculated with 5-20 MLY32 mycelial blocks (3.0-5.0 mm in length and width) and an experimental group (MLY32-61 solid-state fermentation substrate) inoculated with 5-20 MLY32 and MLY61 mycelial blocks (3.0-5.0 mm in length and width, respectively). During the experiment, the control group was inoculated with 10 MLY32 mycelial blocks (3.0-5.0 mm in length and width), and the experimental groups were inoculated with 10 MLY32 and 10 MLY61 mycelial blocks (3.0-5.0 mm in length and width, respectively). Spore count was determined using a hemocytocyte count method, calculated as follows: the initial MLY32 spore count in the solid-state fermentation substrate was 1.52 × 10⁻⁶. 5 ~2.04×10 5 After 7 days, the number of MLY32 spores in the control group was 1.84 × 10⁻⁶ CFU / g wet material. 7 ~2.35×10 7 CFU / g wet material; the number of MLY32 spores in the experimental group was 2.06 × 10⁻⁶. 8 ~2.27×10 8 CFU / g wet material ( Figure 5 According to GB 20287-2006, the agricultural microbial inoculants meet the technical specifications for agricultural microbial powder products.
[0051] The specific method of the hemocytometer method in Example 6 is as follows: Multiple samples are taken from different locations on the solid fermentation substrate, mixed, and then used. The solid sample is mixed with 1 mL of sterile water and homogenized for 10 min to release spores. The treated suspension is appropriately diluted to obtain a concentration suitable for counting. Spores are counted under a microscope using a hemocytometer (Neubauer counting plate). Each experiment is performed in triplicate, and the range of spore numbers is calculated using the following formula.
[0052]
[0053] Example 7: Preparation of microbial agents: The first step is to take 100-300 g of solid fermentation material of *Polyspora pinkis* strain MLY32-61 and mix it with 50-100 g of corn flour to prepare a mixture. The second step involves mixing 300-700 g of tapioca flour with 150-400 mL of boiling water at 100℃ to gelatinize it into a dough, and then cooling the dough to 35-40℃. Subsequently, the dough is kneaded to coat the mixture. The third step is to put the kneaded dough into a pellet-making machine to make microbial agent granules with a diameter of 0.5-10 cm.
[0054] The optimal inoculant formula is as follows: 150 g of solid fermentation material of *Polyspora pinkis* strain MLY32-61, 75 g of corn flour, 450 g of cassava flour, and 250 mL of boiling water. Extrude the inoculant into 1 cm diameter granules with good morphology, slightly sticking to the knife, and a pelleting rate of 95% after 10 minutes. Figure 6 The agent was placed on agar blocks and incubated at 30°C. After two days, the MLY32 spores in the agent germinated into mycelia, which spread across the agar blocks, proving that the nutrients in the material could meet the growth requirements of MLY32. Figure 7 As shown.
[0055] The microbial agent was applied to fields in Xingyi City, Guizhou Province, where blackleg disease had occurred in previous years. Figure 8 After 120 days, the relative efficacy of the experimental group reached about 60%, while the relative efficacy of the experimental group using MLY32 solid fermentation agent was about 40%, which was not satisfactory.
[0056] The formula for calculating the relative effectiveness is as follows:
[0057] Example 8: Preparation of microbial agents: The first step is to take 100-300 g of solid fermentation material of *Polyspora pinkis* strain MLY32-61 and mix it with 50-100 g of corn flour to prepare a mixture. The second step is to mix the mixture with 20-50 g of xanthan gum and 20-50 g of corn starch, and knead it into a dough; The third step is to put the kneaded dough into a pellet-making machine to make microbial agent granules with a diameter of 0.5-10 cm.
[0058] The microbial agent has the following formula: 50 g corn flour, 150 g microbial agent fermentation material, 35 g xanthan gum, and 30 g corn starch. It is extruded into 1 cm diameter granules, which are loose and difficult to form into pellets; the pelleting rate is 45% after 10 minutes.
Claims
1. A strain of *Aspergillus pinkis* (Pink Spiral Polyporus) Clonostachys rosea MLY32, collection number CGMCC No.40347.
2. The application of *Polyspora pinkisole* MLY32 according to claim 1, characterized in that, It is used to inhibit fungi, especially Phytophthora.
3. The application according to claim 2, characterized in that, Used to inhibit Phytophthora infestans.
4. A fungicide for inhibiting Phytophthora, characterized in that, It was prepared by culturing the pink spiral polyspora MLY32 as described in claim 1.
5. The microbial agent according to claim 4, characterized in that, The inoculant consists of *Polyspora pinkis* MLY32 and non-pathogenic *Phytophthora tobaccois* (…). Phytophthora parasitica var. nicotianae It consists of MLY61, and the accession number of MLY61 is CGMCC No.40348.
6. The method for preparing the antifungal agent for Phytophthora as described in claim 4 or 5, characterized in that, The *Polyspora pinkis* MLY32 and *Phytophthora nicotinae* MLY61, along with excipients, were mixed and cultured.
7. The preparation method according to claim 6, characterized in that, The auxiliary ingredients include at least one of wheat bran, corn starch, corn flour, soybean flour, tapioca flour, and xanthan gum.
8. The preparation method according to claim 6, characterized in that, Includes the following steps: Step 1: Mix 50-150 g of wheat bran, 100-800 g of sawdust, and 0.1-1.0 L of distilled water until well combined. Place the mixture in a high-temperature sterilizer at 120-135℃ and sterilize for 5-30 minutes. Then cool the mixture after sterilization. The second step involves cutting small mycelial blocks, each 3.0-5.0 mm in length and width, from PDYH solid culture medium containing the pink spiral polyspora strain MLY32 and the tobacco parasitic phytophthora MLY61, respectively. 5-20 small mycelial blocks are added to each 800 g of the solid fermentation material described in the first step, and the mixture is placed in a constant temperature incubator at 25-35℃ for fermentation for 15-60 days. The PDYH solid culture medium is potato flour. The mixture was prepared by dissolving 6.0 g of glucose, 20.0 g of agar, and 6.0 g of yeast extract in 1000 mL of distilled water and 50.0 g of humic acid in 250 mL of distilled water, and then mixing them after separate high-temperature sterilization. The third step is to take 100-300 g of MLY32-61 solid fermentation material and mix it with 50-100 g of corn flour after fermentation. The fourth step is to mix 300-700 g of cassava flour with 150-400 mL of boiling water at 100℃, and the cassava flour will gelatinize to form a dough. Fifth step: Mix the mixture from the third step with the cooled tapioca flour dough from the fourth step, and knead and press it so that the dough wraps around the mixture. The sixth step is to place the dough containing the mixture obtained in the fifth step into the pelleting agent and press it into 0.5-10 cm particles to obtain the bacterial agent.
9. The method of applying the antifungal agent for Phytophthora as described in claim 4 or 5, characterized in that, It is used to inhibit fungi, especially Phytophthora.
10. The application according to claim 9, characterized in that, Used to inhibit Phytophthora infestans.