Monascus purpureus M25 with functions of reducing blood pressure and blood fat and application of monascus purpureus M25

By co-fermenting purple Monascus M25 with Aspergillus oryzae, the adaptability and functionality of Monascus in Pixian Doubanjiang (fermented broad bean paste) were solved, achieving stable production and quality improvement of functional red Monascus Doubanjiang, which has the effects of lowering blood pressure and blood lipids.

CN122012247APending Publication Date: 2026-05-12SICHUAN GAOFUJI FOOD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN GAOFUJI FOOD
Filing Date
2025-12-12
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The existing technologies lack effective solutions to the problems of adaptability and functional maintenance of red yeast in high-salt, multi-strain fermentation environments, as well as the potential conflict between the flavor and quality of traditional Pixian Doubanjiang (fermented broad bean paste) caused by the introduction of exogenous red yeast.

Method used

Using purple red yeast rice M25, red yeast wheat flour is prepared through synergistic fermentation with Aspergillus oryzae, and integrated into the traditional process of Pixian Doubanjiang (Pixian broad bean paste) to ensure the transfer of functional activity and optimize the product's flavor and physicochemical indicators.

Benefits of technology

While maintaining the traditional flavor, the purple red yeast rice M25 was stably present in Pixian broad bean paste, significantly improving the overall quality of the product and ensuring the effective content of blood pressure-lowering and blood lipid-lowering functional components.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012247A_ABST
    Figure CN122012247A_ABST
Patent Text Reader

Abstract

The invention relates to the field of fermented food, and particularly discloses monascus purpureus M25 with functions of reducing blood pressure and blood fat, and the preservation number of the monascus purpureus M25 is CCTCC (China Center for Type Culture Collection) NO: M20252285. Meanwhile, the invention also discloses an innovative application method of the strain in preparation of the red yeast rice thick broad-bean sauce, which is characterized in that the M25 strain is inoculated to wheat kernels to prepare red yeast rice wheat flour rich in active ingredients, and then the flour is used as a functional ingredient and is subjected to synergistic fermentation with aspergillus oryzae in a koji-making stage of the Pixian thick broad-bean sauce to prepare the red yeast rice thick broad-bean sauce. And carrying out high-salt fermentation and other traditional processes subsequently. The method successfully solves the industrial problem that the functional strain is difficult to survive and express efficacy in the traditional high-salt fermentation system. The prepared thick broad-bean sauce keeps the traditional flavor, the content of amino acid nitrogen far exceeds the standard, the delicate flavor and nutritional value of the product are remarkably improved, more importantly, the content of monacolin K in the final product is stable, and the thick broad-bean sauce has the dual health-care functions of reducing blood pressure and blood fat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of microbial fermentation, and more specifically, to a purple Monascus M25 with functions of lowering blood pressure and blood lipids and its applications. Background Technology

[0002] Monascus spp., a traditional food fermentation agent, is well-known for the lipid-lowering function of its metabolite, Monacolin K, and has been successfully developed into functional foods or dietary supplements. However, effectively integrating Monascus spp., especially its functional strains, into complex traditional high-salt fermented food systems like Pixian Doubanjiang (Pixian chili bean paste) has consistently faced significant challenges, resulting in unsatisfactory application effects. This is mainly reflected in the following two aspects: 1. The Adaptability and Functional Maintenance of Strains in High-Salt, Multi-Strain Fermentation Environments. The production of Pixian Doubanjiang (Pixian chili bean paste) is a long-term, multi-stage process involving several steps, including Aspergillus oryzae koji preparation and high-salt anaerobic fermentation. Most Monascus purpureus strains experience severe growth inhibition under these conditions, and their ability to metabolize and synthesize functional active substances (such as Monacolin K and γ-aminobutyric acid) is significantly reduced. For example, directly adding ordinary Monascus purpureus powder to Doubanjiang fails to efficiently produce functional components. Existing technologies (such as patent publication number CN112056492A) primarily focus on utilizing the coloring function of Monascus purpureus, lacking effective solutions for ensuring the stable delivery and final expression of specific health-promoting functions of Monascus purpureus under such stringent process conditions.

[0003] Secondly, there is the conflict between the introduction of exogenous red yeast and the traditional flavor and quality of the product. Pixian Doubanjiang (Pixian chili bean paste) has a unique "soy sauce aroma and ester fragrance" and a harmonious taste. Its flavor substances are mainly produced by the synergistic effect of microbial communities such as Aspergillus oryzae and yeast. Blindly introducing exogenous red yeast may bring two risks: First, the strong fermentation odor of red yeast may interfere with or even mask the inherent complex aroma of Doubanjiang, leading to an imbalance in flavor; second, red yeast may compete with native microorganisms in the system (such as Aspergillus oryzae), affecting the activity of proteolytic enzymes in Aspergillus oryzae, thus leading to insufficient koji making and incomplete fermentation of the sauce mash. Ultimately, this will cause the key quality indicators of the product—such as amino acid nitrogen content—to decrease rather than increase, damaging the basic flavor and nutritional value of the product.

[0004] Therefore, how to successfully endow Pixian Doubanjiang with clear health benefits while maintaining its traditional flavor and excellent quality is a technical problem that urgently needs to be solved in this field. Summary of the Invention

[0005] Based on the deficiencies of the existing technology, this application provides a purple red Monascus M25 with blood pressure and blood lipid lowering functions and its application, in order to solve the core problem of the poor application effect of red Monascus in traditional high-salt fermented foods.

[0006] Specifically, the technical problem to be solved by the present invention is: 1. Provide a purple red yeast strain M25 that can not only synthesize components that lower blood pressure and blood lipids, but also adapt well to the high-salt, multi-strain fermentation environment of Pixian broad bean paste.

[0007] 2. A method for integrating the strain into the traditional process of Pixian Doubanjiang (fermented broad bean paste) is provided. This method can ensure that the functional activity of the strain is effectively transferred to the final product, while not interfering with or even promoting the traditional koji-making and fermentation process, and maintaining or even optimizing the inherent flavor and physicochemical properties (such as amino acid nitrogen) of the product.

[0008] The technical solution adopted in this application is as follows: In one aspect, this application provides a purple red Monascus M25 with functions of lowering blood pressure and lowering blood lipids. The purple red Monascus M25 (Monascus purpureus M25) has the accession number CCTCC No. M20252285 and was deposited at the China Center for Type Culture Collection on October 22, 2025.

[0009] Secondly, this application provides a method for preparing red yeast wheat flour, which includes: steaming wheat kernels, inoculating them with the purple red yeast M25 as described in claim 1, fermenting them at 28-32°C for 4-6 days, drying them, and then grinding them into flour to obtain red yeast wheat flour.

[0010] Furthermore, the inoculum size of the aforementioned purple Monascus M25 was 10... 6 ~10 8 spores / g.

[0011] Furthermore, the process parameters for the above drying treatment are: treatment at 50-70℃ for 5-10 hours.

[0012] Thirdly, this application provides an application of the above-mentioned purple red Monascus M25 in the preparation of functional fermented foods that lower blood pressure and blood lipids.

[0013] Fourthly, this application provides a method for preparing functional red yeast rice bean paste, comprising: Pre-processed broad beans and chili sauce are provided; Add red yeast wheat flour obtained by the preparation method according to any one of claims 2-4 to the cooled broad bean paste, mix evenly, inoculate with Aspergillus oryzae koji at 0.05% to 0.15% of the weight of the broad bean paste, stir evenly and then carry out koji making and fermentation to obtain broad bean paste koji. After mixing fermented soybean paste with brine, fermentation is carried out at 32-40℃ for no less than 150 days to obtain sweet fermented soybean paste. After mixing the sweet fermented soybeans and chili sauce evenly, ferment them at room temperature for no less than 150 days to obtain a semi-finished Pixian Doubanjiang (Pixian chili bean paste). Then, add edible salt and water, stir and mix evenly to obtain the finished Pixian Doubanjiang.

[0014] Furthermore, the amount of red yeast wheat flour added is 5-15% of the mass of the broad bean.

[0015] Furthermore, the pretreatment method for the above-mentioned broad bean paste includes: Peeled dried broad beans are blanched in hot water at 90-98℃ for 2-6 minutes, and then cooled to 30-40℃ to obtain pretreated broad bean kernels; wherein the mass ratio of peeled dried broad beans to hot water is 1:5-7.

[0016] Furthermore, the maximum diameter of the chili fragments in the above-mentioned chili sauce is 40 mm, and the salt content of the crushed chili sauce is 15-18%.

[0017] Fifthly, this application provides a functional red yeast rice bean paste obtained by the above preparation method, wherein the finished functional red yeast rice bean paste has a total acid content ≤2.0%, an amino acid nitrogen content greater than 0.45g / 100g, a free amino acid content greater than 36.0mg / g, a protease activity greater than 550U / g, and a Monacolin K content greater than 12.0mg / g.

[0018] In summary, this application has the following beneficial effects: 1. This application is the first to isolate and preserve a purple Monascus strain M25 with a clear dual function of lowering blood pressure and lowering blood lipids. Compared with existing Monascus strains that have a single function and usually only focus on lowering blood lipids, strain M25 breaks through the limitations of traditional Monascus applications.

[0019] 2. This application designs "red yeast wheat flour" as a functional carrier, and successfully integrates purple red yeast M25 into the traditional high-salt brewing system of Pixian Doubanjiang by co-fermenting it with Aspergillus oryzae during the koji-making stage. This process ensures that the M25 strain and its functional metabolites can stably adapt to and survive in the subsequent long-term high-salt fermentation environment, effectively solving the problem that ordinary red yeast is easily inactivated and functional components cannot be effectively transferred in such systems.

[0020] 3. The functional red yeast rice bean paste provided in this application, after introducing Monascus purpureus M25, not only did not impair the product's flavor, but also significantly improved the overall quality of the product through the synergistic effect of Monascus purpureus and Aspergillus oryzae. The final product's key indicators, such as amino acid nitrogen, all exceeded national standards, proving that its umami and nutritional value were substantially optimized. This completely breaks the technical prejudice that "introducing functional strains inevitably sacrifices traditional flavor," achieving a perfect unity of health benefits and superior flavor.

[0021] 4. This application, through the organic combination of specialized strains and specific processes, ultimately ensures that beneficial functional components (such as Monacolin K) are stably retained in the final product and reach effective levels. This makes the prepared fermented soybean paste no longer an ordinary condiment, but a functional food with blood pressure and blood lipid-lowering effects proven in in vivo experiments. Attached Figure Description

[0022] Figure 1 These are colony morphology images of Monascus purpureus M25 on a PDA plate: front (left) and back (right); Figure 2 These are fluorescence micrographs of zebrafish used in the determination of their blood pressure-lowering efficacy. Figure 3 This is a bar graph of zebrafish blood vessel diameter in a study to determine the blood pressure-lowering efficacy. Figure 4 This is a bar graph showing the cholesterol content determination of zebrafish in a cholesterol-lowering efficacy assay. Detailed Implementation

[0023] The embodiments of the present invention will be described in detail below with reference to the examples. However, those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention. Specific conditions not specified in the examples shall be carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0024] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0025] Example 1 Strain screening and identification I. Strain Screening 1. Culture medium preparation The screening medium was PDA solid medium. The specific preparation method was as follows: Weigh 200.0g of potatoes, peel and cut them into pieces, add distilled water, boil for 20-30 minutes, filter through double-layer gauze, add 20.0g of glucose and 15.0-20.0g of agar, and make up to 1000mL with distilled water. Sterilize at 121℃ for 15 minutes.

[0026] 2. Enrichment and Purification Under aseptic conditions, 3g of vinegar koji sample and sterilized glass beads were added to an Erlenmeyer flask containing 45mL of 0.85% NaCl. The flask was shaken for 10 minutes on a constant temperature shaker. The mixture was then filtered through a glass funnel lined with sterile cotton. After serially diluting the filtrate by 10-fold, appropriate amounts of different concentrations of the dilution were spread onto PDA solid medium and incubated at 30℃ for 3–5 days. Single colonies with typical Monascus purpureus morphological characteristics were picked and further streaked 3–5 times to obtain purified strains. Finally, the strains were inoculated into slant test tubes and stored at 4℃.

[0027] 3. Filtering The purified strain was planted on a PDA plate and cultured at 30°C for 6 days. The growth status of each strain was observed and screened to obtain strain M25.

[0028] II. Strain Identification 1. Morphological identification After incubating strain M25 in a PDA plate at 30°C for 6 days, as follows... Figure 1 As shown, the colonies are relatively flat, grow in a localized manner, are velvety in appearance, with a flocculent center, and have a dry, opaque surface with wrinkles. They are initially milky white, then turn pink, and finally orange-red.

[0029] 2. Molecular biological identification Genomic DNA was extracted from the strain using the 2×T5 Direct PCR Kit (Plant). The specific steps were as follows: 50 μL of Lysis Buffer A was added to a 2 mL centrifuge tube. A small amount of non-spore-producing hyphae was scraped from PDA medium into the centrifuge tube using an inoculation loop. The tube was incubated at 95°C for 30 min, centrifuged at 1000g for 1 min, and the supernatant was used as the template for the reaction system. Universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') were used for PCR amplification of the ITS fragments of the DNA. The PCR amplification reaction system consisted of 12.5 μL of 2×T5 Direct PCR Mix (Plant), 1 μL of template DNA, 1 μL each of ITS1 and ITS4, and 9.5 μL of sterile ultrapure water. PCR amplification conditions: 98℃ for 3 min; 98℃ for 10 s, 60℃ for 10 s, 72℃ for 10 s, 30× cycles; 72℃ for 5 min; store at 4℃. The PCR amplification products were sequenced, and the assembled sequencing results were compared with the NCBI database using BLAST.

[0030] The ITS rDNA sequence of strain M25 is shown in SEQ ID NO.01, specifically as follows: TTCCGTAGGTGACCTGCGGAAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCA ACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCC GGAGACATCTTCTCGAACGCTGTCTTGAAAGGATTGCTGTCTGAGTAAACATACCAA ATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCG AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACA TTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGC GCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGA AAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAG TAGGTCGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT. Based on BLAST comparison analysis and colony morphology characteristics, strain M25 was identified as Monascus purpureus M25.

[0031] This strain was deposited at the China Center for Type Culture Collection (CCTCC); accession number: CCTCCNo.M20252285; deposit date: October 22, 2025.

[0032] Example 2 This application provides a functional red yeast rice bean paste, the preparation method of which includes: (1) After steaming the wheat kernels, inoculate them with Monascus purpureus M25 (inoculation amount is 5×10). 6 The spores (g) were fermented at 30℃ for 4 days, dried at 60℃ for 5-10 hours, and then ground into powder.

[0033] (2) Select peeled dried broad beans free from pests and diseases, and blanch them in 95℃ hot water for 4 minutes according to the mass ratio of peeled dried broad beans to water of 1:6. Then, use cold water to cool the blanched broad beans to 35℃ to obtain pretreated broad bean kernels. (3) Add 10% red yeast wheat flour to the cooled broad beans, mix well, and inoculate with Aspergillus oryzae koji at 1‰ of the weight of the broad beans, and stir well. Produce koji at 37℃ and 84% relative humidity for 48 hours to obtain broad bean koji.

[0034] (4) Mix the fermented soybean paste and salt water at a ratio of 1:1 and ferment at 36°C for 180 days to obtain sweet fermented soybean paste.

[0035] (5) After removing impurities, wash the chili peppers with water and then crush them (add salt or brine) to obtain chili sauce. The maximum diameter of the chili pepper fragments in the obtained chili sauce is 40 mm, and the salt content of the crushed chili sauce is 15-18%.

[0036] (6) Mix the obtained sweet bean paste and chili embryo evenly, and then ferment at room temperature for 180 days to obtain Pixian Douban semi-finished product.

[0037] (7) Add edible salt and water to the obtained Pixian Doubanjiang semi-finished product, stir and mix evenly to obtain Pixian Doubanjiang finished product; the amount of edible salt and water added is calculated based on the following standard: total acid ≤ 2.0%, amino acid nitrogen ≥ 0.18%, edible salt (calculated as sodium chloride) 15-22%, and moisture ≤ 60% in the obtained Pixian Doubanjiang finished product.

[0038] Example 3 The difference between this embodiment and Embodiment 2 lies in the preparation method of the red yeast wheat flour: After steaming the wheat kernels, inoculate them with Monascus purpureus M25 (inoculation amount: 5 × 10⁻⁶). 6 The spores (g) were fermented at 28℃ for 6 days, dried at 50℃ for 10 hours, and then ground into powder.

[0039] Example 4 The difference between this embodiment and Embodiment 2 lies in the preparation method of the red yeast wheat flour: After steaming the wheat kernels, inoculate them with Monascus purpureus M25 (inoculation amount: 5 × 10⁻⁶). 6 (spores / g), fermented at 32℃ for 4 days, dried at 70℃ for 5 hours, and then ground into powder.

[0040] Example 5 The difference between this embodiment and Embodiment 2 is that in the process of preparing broad bean curd, the amount of red yeast wheat flour added is 15% of the mass of broad beans.

[0041] Example 6 The difference between this embodiment and Embodiment 2 is that, in the process of preparing broad bean curd, the amount of red yeast wheat flour added is 5% of the mass of broad beans.

[0042] Example 7 The difference between this embodiment and Embodiment 2 lies in the pretreatment method of the broad bean paste: Peeled and dried broad beans free from pests and diseases were selected and blanched in 98℃ hot water for 2 minutes at a mass ratio of 1:5. Then, the blanched broad beans were cooled to 35℃ with cold water to obtain pre-treated broad bean kernels.

[0043] Example 8 The difference between this embodiment and Embodiment 2 lies in the pretreatment method of the broad bean paste: Peeled and dried broad beans free from pests and diseases were selected and blanched in 90℃ hot water for 6 minutes at a mass ratio of 1:7. Then, the blanched broad beans were cooled to 35℃ with cold water to obtain pre-treated broad bean kernels.

[0044] Comparative Example 1 The difference between this comparative example and Example 2 is that purple red yeast rice M25 is not added during the fermentation process.

[0045] Comparative Example 2 The difference between this comparative example and Example 2 is that Monascus purpureus M3 was added during the fermentation process. This strain is deposited by the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20241378, deposit date June 26, 2024, and deposit address: Wuhan University, Wuhan, China.

[0046] Comparative Example 3 The difference between this comparative example and Example 2 is that the purple Monascus purpureus is not pre-fermented; instead, a mixed fermentation mode is used. That is, in step (3), an equal amount of ordinary wheat flour is added to the cooled broad beans and mixed evenly, with the final concentration of purple Monascus purpureus M10 being 5 × 10⁻⁶. 6 Inoculate with Aspergillus oryzae koji at a concentration of 1‰ of the weight of broad bean spores / g of wheat flour, and mix thoroughly. Propagate at 37℃ and 84% relative humidity for 48 hours to obtain broad bean koji.

[0047] Performance testing 1. Product specifications for broad bean paste The specific physicochemical indicators of the fermented soybean paste provided in Example 1 and Comparative Examples 1-3 were determined using the methods of GB 12456-2021, GB 5009.235-2016, SB / T 10317-1999, GB / T 30987-2020 and Li et al. (2020), and the results are shown in Table 1.

[0048] Table 1. As shown in Table 1, the fermented soybean paste prepared in Example 2 is superior to the comparative example in terms of nutritional and functional indicators such as amino acid nitrogen, free amino acids, protease activity, and Monaclin K.

[0049] 2. Blood pressure lowering experiment 1. Detection Principle Zebrafish genes share 87% similarity with human genes, and their blood systems share many similarities. High blood pressure is primarily related to arterial diameter; the smaller the blood vessel diameter, the higher the blood pressure. Measuring the blood vessel diameter of zebrafish can help evaluate whether the samples have an auxiliary effect in lowering blood pressure.

[0050] 2. Experimental Methods (1) Measurement of Safety Test Concentration (MTC) Transgenic zebrafish with vascular fluorescence, 3 days post-fertilization (3dpf), were randomly selected and placed in 24-well plates, with 10 zebrafish treated in each well. The sample (provided in Example 2) was administered in water at concentrations of 5000 μg / mL, 2000 μg / mL, and 1000 μg / mL, with a blank control group included; each well contained 1 mL. One day after treatment, the MTC of the sample in zebrafish was measured.

[0051] 1. Evaluation of its auxiliary effect in lowering blood pressure The zebrafish were divided into two groups: a blank control group and a sample treatment group. The blank control group received no treatment, while the sample treatment group received the sample (provided in Example 2). After a period of cultivation, both groups of zebrafish were observed and photographed using a fluorescence microscope. The images were analyzed using software, and the data analysis results of the two groups were compared.

[0052] 2. Data Processing Methods SPSS 26 software was used for analysis, and GraphPad Prism 8 was used for plotting. Data statistics are expressed as mean ± standard deviation. The experimental results were tested for normality using SPSS software. If the data conformed to normality, the significance was determined by the T-parameter test or analysis of variance (ANOVA). If the data did not conform to normality, nonparametric tests were used (P-value < 0.05 indicates statistical significance).

[0053] 3. Test Results (1) The results of the safe concentration determination showed that there was no significant difference between the sample group with a concentration of 1000 μg / mL and the blank control group. Therefore, the concentration of 1000 μg / mL is the maximum safe concentration.

[0054] 1. Results of zebrafish blood vessel diameter values Fluorescence microscopic images of the blank control group and the sample treatment group are shown below. Figure 2 As shown.

[0055] The data processing results are shown in Table 2 and Figure 3 As shown: Table 2. The results showed that the diameter of zebrafish blood vessels in the sample treatment group provided in Example 2 increased significantly, with an improvement rate of 10.73% (P<0.05), indicating that the fermented soybean paste of Example 1 of this application has the effect of assisting in lowering blood pressure.

[0056] III. Lipid-lowering experiment 1. Detection Principle Zebrafish genomes share high homology with humans, and many genes associated with human diseases also have corresponding homologous genes in zebrafish. The components of a high-sugar, high-fat diet can mimic excessive sugar and fat intake in a human diet. This diet leads to disordered fat metabolism and elevated levels of lipids such as cholesterol in the blood. Abnormal cholesterol metabolism is a key factor in the development of atherosclerosis. Elevated total cholesterol levels in the blood promote cholesterol deposition under vascular endothelial cells. These deposited cholesterols trigger a series of inflammatory responses, attracting the aggregation of immune cells such as monocytes, leading to the formation of fatty streaks and plaques. This results in thickening and hardening of the blood vessel walls, narrowing of the lumen, and ultimately affecting normal vascular function, causing atherosclerosis-related diseases.

[0057] If a sample can reduce the total cholesterol content in zebrafish, it indicates that the sample has the effect of lowering blood lipids.

[0058] 2. Experimental Methods (1) Measurement of Safety Test Concentration (MTC) Wild-type AB strain zebrafish, 4-5 days post-fertilization (4-5 dpf), were randomly selected and encapsulated in 6-well plates, with 30 zebrafish treated in each well. The samples were administered water-soluble solutions at concentrations of 0.5%, 0.1%, and 0.02%, with a blank control group included. The MTC of the samples relative to the model zebrafish was measured one day after treatment.

[0059] (2) Evaluation of lipid-lowering function The zebrafish were divided into four groups: a blank control group, a model control group, a positive control group, and a sample treatment group. The blank control group received no treatment. The model control group, positive control group, and sample treatment group all ingested the same amount of high-sugar, high-fat feed (which was dissolved in the aquaculture water). The positive control group and sample treatment group received atorvastatin calcium tablets and the test sample solution (provided in Example 2) concurrently with the high-sugar, high-fat feed. After a period of culture, the zebrafish were crushed, and the supernatant was used for ELISA detection.

[0060] (3) Data processing methods SPSS 26 software was used for analysis, and GraphPad Prism 8 was used for plotting. Data statistics are expressed as mean ± standard deviation. Experimental results were tested for normality using SPSS software. If the data conformed to normality, the significance was determined by the T-parameter test or analysis of variance (ANOVA). If the data did not conform to normality, nonparametric tests were used (P-value < 0.05 indicates statistical significance).

[0061] 3. Experimental Results: The statistical results of cholesterol content in zebrafish from each experimental group are shown in Table 3 and... Figure 4 As shown: Table 3. The results showed that the cholesterol content in the blood of zebrafish was significantly reduced in the sample treatment group provided in Example 2 of this application, and compared with the model control group, P<0.01, indicating that the fermented soybean paste of Example 2 of this application has the effect of assisting in lowering blood lipids.

[0062] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A purple Monascus M25 strain with functions of lowering blood pressure and lowering blood lipids, characterized in that, The purple red Monascus M25, with accession number CCTCC No. M20252285, was deposited at the China Center for Type Culture Collection on October 22, 2025.

2. A method for preparing red yeast wheat flour, characterized in that, include: After steaming wheat kernels, they are inoculated with the purple red yeast M25 as described in claim 1, fermented at 28-32℃ for 4-6 days, dried, and then ground into flour to obtain red yeast wheat flour.

3. The method for preparing red yeast wheat flour according to claim 2, characterized in that, The inoculation amount of the purple red Monascus M25 was 10. 6 ~10 8 spores / g.

4. The method for preparing red yeast wheat flour according to claim 2, characterized in that, The drying process parameters are: treatment at 50~70℃ for 5~10 hours.

5. The application of the purple red Monascus M25 as described in claim 1 in the preparation of functional fermented foods that lower blood pressure and blood lipids.

6. A method for preparing a functional red yeast rice bean paste, characterized in that, It includes: Pre-processed broad beans and chili sauce are provided; Add red yeast wheat flour obtained by the preparation method according to any one of claims 2-4 to the cooled broad bean paste, mix evenly, inoculate with Aspergillus oryzae koji at 0.05%~0.15% of the weight of the broad bean paste, stir evenly and then carry out koji making and fermentation to obtain broad bean paste koji. After mixing fermented soybean paste with brine, fermentation is carried out at 32-40℃ for no less than 150 days to obtain sweet fermented soybean paste. After mixing the sweet fermented soybeans and chili sauce evenly, ferment them at room temperature for no less than 150 days to obtain a semi-finished Pixian Doubanjiang (Pixian chili bean paste). Then, add edible salt and water, stir and mix evenly to obtain the finished Pixian Doubanjiang.

7. The method for preparing functional red yeast rice bean paste according to claim 6, characterized in that, The amount of red yeast wheat flour added is 5-15% of the mass of the broad bean paste.

8. The method for preparing functional red yeast rice bean paste according to claim 6, characterized in that, The pretreatment method for the broad bean paste includes: Blanch peeled dried broad beans in hot water at 90-98℃ for 2-6 minutes, then cool to 30-40℃ to obtain pretreated broad bean kernels; The mass ratio of peeled dried broad beans to hot water is 1:5~7.

9. The method for preparing functional red yeast rice bean paste according to claim 6, characterized in that, The chili pepper fragments in the chili sauce have a maximum diameter of 40 mm, and the salt content of the crushed chili sauce is 15-18%.

10. A functional red yeast rice bean paste prepared by the preparation method provided in any one of claims 6-9, characterized in that, The functional red yeast rice bean paste product contains a total acid content ≤2.0%, an amino acid nitrogen content greater than 0.45 g / 100g, a free amino acid content greater than 36.0 mg / g, a protease activity greater than 550 U / g, and a Monacolin K content greater than 12.0 mg / g.