Cordyceps carnosus mutant strain capable of producing extracellular green pigment as well as fermentation method and application of Cordyceps carnosus mutant strain

By isolating and improving *Kissus leucosus*, a stable high-yield green pigment secreted extracellularly has been achieved, solving the problems of complexity and instability in existing extraction technologies. This method is suitable for coloring food, cosmetics, and textiles.

CN122012254APending Publication Date: 2026-05-12HUILAI BIOTECHNOLOGY (SHENZHEN) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUILAI BIOTECHNOLOGY (SHENZHEN) CO LTD
Filing Date
2026-03-02
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing methods for producing chlorophyll from fungi suffer from problems such as complex intracellular extraction, low extraction rate, high cost, and environmental instability. Furthermore, no research has been reported on the production of chlorophyll by *Kissus leucosus*, making it difficult to meet the needs of large-scale industrial production.

Method used

By isolating *Kissus leucosus* from soil and using UV mutagenesis to select mutant strains that can secrete green pigments extracellularly, the fermentation process was optimized to increase pigment yield and maintain stability under different environmental conditions. Combined with compound biological enzymes and ethyl salicylate to promote the dissolution of intracellular pigments, the green pigments were finally extracted by centrifugation and precipitation.

Benefits of technology

The stability of high-yield green pigment secreted by *Kimochromatus leucosus* was achieved, simplifying the extraction process, reducing production costs, and improving the environmental stability of the pigment, making it suitable for coloring food, cosmetics, and textiles.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012254A_ABST
    Figure CN122012254A_ABST
Patent Text Reader

Abstract

The invention relates to an extracellular green pigment-producing coleus carnosus mutant strain as well as a fermentation method and application thereof, and belongs to the technical field of microorganisms. The technical problem to be solved by the invention is to provide the pediococcus carnosus which can secrete green pigment in an extracellular manner and is high in yield and good in stability, and the green pigment obtained by fermentation of the pediococcus carnosus is stable in property. According to the key point of the technical scheme, the Keitobacteria carneus BG-G1-uv03 is a strain of the Keitobacteria carneus BG-G1-uv03, the Keitobacteria carneus BG-G1-uv03 is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC (Guangdong Microbial Culture Collection Center) NO: 67281. According to the mutant strain of the extracellular green pigment-producing coleus carnosus and the optimized fermentation process, a new strain resource and a technical scheme are provided for industrial production of natural microbial pigments, and the mutant strain has important economic value and environmental significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a mutant strain of *Caryophyllum oxypetalum* that produces extracellular chlorophyll, its fermentation method, and its application. Background Technology

[0002] Pigments are widely used as important coloring agents in various industries such as food processing, cosmetics preparation, and textile printing and dyeing. Although traditional synthetic pigments have the advantages of strong coloring power and low cost, the environmental pollution and human health risks they cause have become increasingly prominent in recent years. Against this backdrop, the development of natural, safe, and biodegradable natural pigments to replace synthetic pigments has become an important development trend in the food industry, fine chemicals, and other fields.

[0003] Microbial pigments are considered the most promising sustainable alternative to synthetic pigments due to their environmentally friendly production process, wide availability of raw materials, short fermentation cycle, and scalability. They show broad application prospects in food, cosmetics, textiles, and pharmaceuticals. Fungi, as a significant source of natural pigments, produce a rich variety of pigments, including phenols, terpenes, quinones, and quinolines. Furthermore, some fungal pigments possess excellent bioactivities such as antioxidant, anti-aging, and antibacterial properties, further enhancing their application value.

[0004] Fungi can synthesize a wide variety of pigments, including complex secondary metabolites such as melanin, carotenoids, and flavonoids. However, compared to pigments of other colors, fungal resources producing green pigments are relatively rare. Existing research indicates that the green appearance of fungi is usually related to the color of conidia (asexual spores) or mycelium, a characteristic also found in the genus *Metarhizium* (*Metarhizium*). Metarhizium Trichoderma ( ) Trichoderma ), Penicillium ( Penicillium These fungi exhibit typical taxonomic characteristics of several important fungal genera, including . However, the green pigments produced by these fungi are mostly intracellular pigments, which present challenges such as complex extraction processes, low extraction rates, and high production costs, thus limiting their industrial application.

[0005] Current patents related to fungal chlorophyll mainly focus on the application of extracting chlorophyll from fungal green spores or mycelia, and there are no reports on its use in fermenting *Bacillus caryophyllus* (Fungi). Keithomyces carneus There are no reports on the production of chlorophyll. In existing research papers, studies on *Kissus leucis* are limited to culturing the bacterium in basal medium, followed by morphological observation and taxonomic identification. These studies do not cover the pigment production of the bacterium, nor do they mention how to achieve extracellular secretion and increase pigment production.

[0006] Meanwhile, existing fungal pigments generally suffer from two major technical bottlenecks: first, some fungal pigments are sensitive to environmental factors such as light and heat, and are prone to degradation during processing, storage, and application, resulting in unstable coloring effects and greatly limiting their applications; second, the pigment yield of wild-type strains is usually low, making it difficult to meet the needs of large-scale industrial production. Therefore, screening fungal strains with high pigment yield, good environmental stability, and extracellular secretion capabilities, and optimizing their fermentation processes, has become an urgent technical problem to be solved in the current research field of natural fungal pigments.

[0007] Relevant patent documents retrieved:

[0008] This document, published in China (CN112778797B) on May 11, 2021, discloses a method for extracting natural green pigment from *Metarhizium anisopliae*, belonging to the field of extraction and preparation technology of biological products. The steps include culturing a fungal strain of *Metarhizium anisopliae*, expanding the culture to collect spores, removing impurities from the spores, preparing a crude pigment extract, concentrating and drying it, refining the pigment precipitate, and drying the refined pigment precipitate to obtain a dark green powdery natural green pigment.

[0009] Relevant non-patent literature retrieved: The journal title is *Plant Protection*, the article title is "Bioactivity of *Metarhizium anisopliae* and its related fungi from litter in the Greater Khingan Mountains", volume number 2021, 47(05), publication date 2021.10.12. This article is a study on *Metarhizium anisopliae*. Metarhizium The bioactivity of *Kistome spp.* and its related fungi was investigated using morphological and molecular biological methods. Keithomyces carneus (Former name: Metarhizium anisopliae) M.carneum ) and Marquenda maseri Marquandomyces marquandii (formerly known as Metarhizium anisopliae) M.marquandii ) and Metarhizium anisopliae Metarhizium anisopliae They were identified and their activities against three pests and four plant pathogens were analyzed. Insecticidal activity assays showed that *Kistobacterium sarcodactylis* and *Makunde's bacterium* were effective against the two-spotted leaf beetle. Monolepta hieroglyphica Corn aphids Rhopalosiphum maidis Green bean weevil Callosobruchus chinensis It possesses infectious capabilities and is a non-host-specific fungus. Antimicrobial activity assays showed that *Kissella macrantha* was effective against *Rhizoctonia solani*. Rhizoctonia solani Rice bacterial blight pathogen Xanthomonas oryzae pv.oryzae It has antibacterial activity against pathogens such as...

[0010] The prior art represented by the aforementioned documents has at least the following unresolved technical problems or defects: (1) Existing green pigment-producing fungal strains and technical solutions have limitations and are difficult to balance extracellular secretion and high yield requirements. The relevant evidence is: the method for extracting natural green pigments from Metarhizium anisopliae disclosed in patent document CN112778797B relies on extracting pigments from Metarhizium anisopliae spores. It is essentially still an intracellular pigment extraction technology, which requires multiple complex steps such as expanding culture to collect spores, removing impurities, preparing crude extract, concentrating and drying, and refining. This not only increases the complexity and cost of the production process, but also makes it difficult to further increase the yield to meet the needs of large-scale industrialization due to the limited amount of intracellular pigment accumulation.

[0011] (2) There is a gap in the development and utilization of *Metarhizium anisopliae*. Existing research has not covered its pigment production potential. The relevant evidence is that the non-patent literature "Bioactivity of *Metarhizium anisopliae* and its related fungi from litter in the Greater Khingan Mountains" only focuses on the insecticidal and antibacterial biocontrol activities of *Metarhizium anisopliae*, without mentioning that the strain has the ability to produce green pigments, and without covering the relevant research on how to improve the extracellular secretion and yield of pigments through breeding. Summary of the Invention

[0012] The purpose of this invention is to provide: A mutant strain of *Caryophyllum spp.* that produces extracellular chlorophyll, its fermentation method and application, and related technologies, to solve technical problems such as providing a *Caryophyllum spp.* strain that can secrete extracellular chlorophyll with high yield and good stability, and whose fermented chlorophyll has stable properties, or a combination thereof.

[0013] This invention isolated a fungus from soil—*Kissus leucosus* ( ). Keithomyces carneus This fungus, *[unclear text]*, is a common soil fungus in temperate regions (also widely distributed in subtropical and even tropical soils and litter). Its mycelium is white and velvety, with green hyphae within the substrate, and no pigment dissolution was observed. Using ultraviolet mutagenesis, a mutant strain that releases extracellular chlorophyll was selected. Optimization of the fermentation process significantly increased the chlorophyll yield. This pigment is stable under different light environments, high temperatures, and acid-base conditions.

[0014] Terminology Explanation: Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this subject matter pertains. Unless otherwise stated, all patents, patent inventions, and disclosures cited throughout this document are incorporated herein by reference in their entirety. Where multiple definitions exist for terms herein, the definitions provided in this chapter shall prevail.

[0015] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0016] Definitions of standard terms can be found in the references “Microbiology (9th Edition), Higher Education Press, authors: Shen Ping and Chen Xiangdong, 2025.05”, “Prescott Microbiology (10th Edition), publisher: McGraw Hill, author: Joanne Willey, 2018.07”, and “Practical Handbook of Microbial Culture Media (1st Edition), Jilin Science and Technology Press, author: Ma Lehao, 2006”.

[0017] Unless otherwise stated, conventional methods within the scope of this art, such as mixing and allowing to stand, shall be used. Unless specifically defined, the use of all commercially available products used herein shall employ standard techniques. For example, the manufacturer's instructions for use of the kit may be used, or the procedures may be followed in a manner known in the art or as described herein. The techniques and methods described herein are generally performed according to conventional methods well known in the art, based on the descriptions in the various general and more specific documents cited and discussed in this specification.

[0018] The term "carnivorous kiss" as used in this article is Keithomyces carneus ")" refers to a species belonging to the genus *Kissella*. Keithomyces Filamentous fungi, whose colonies are often flesh-colored to pale pink, can be used in microbiological research for applications such as enzyme production and metabolite synthesis.

[0019] The term "compound bio-enzyme agent" as used in this article refers to a biological preparation composed of two or more bio-enzymes with different catalytic functions, supplemented by auxiliaries such as carriers, stabilizers, and protectants, which can achieve specific biocatalytic or degradation effects through the synergistic effect of multiple enzymes.

[0020] The term "cellulase" as used in this article refers to a class of complex enzymes that can specifically catalyze the hydrolysis of β-1,4-glycosidic bonds in cellulose molecules, degrading cellulose into small molecule sugars such as cellobiose and glucose. It mainly includes three functional components: endoglucanase, exoglucanase, and β-glucosidase. This enzyme system is widely found in microorganisms such as fungi and bacteria and can be applied in many fields such as biomass conversion, textiles, food, and papermaking.

[0021] The term "ethyl salicylate" as used in this article refers to: [the chemical formula is C9H]. 10O3 aromatic esters, also known as ethyl salicylate, have a wintergreen oil aroma and can be used as organic solvents, fragrances, or chemical reagents in the fields of medicine and chemical synthesis.

[0022] The term "PDA medium" used in this article refers to Potato Dextrose Agar Medium, a commonly used general-purpose culture medium for fungi. Its main components are potato extract powder, glucose, and agar, and it is suitable for the isolation, purification, and culture of fungi.

[0023] The term "Czapek-Dox medium" as used in this article refers to a synthetic medium that uses sodium nitrate as the sole nitrogen source and sucrose as the carbon source. Its main components are sucrose, sodium nitrate, dipotassium hydrogen phosphate, magnesium sulfate, potassium chloride, and ferrous sulfate.

[0024] The term "MEA medium" used in this article refers to malt extract agar medium, which is mainly composed of malt extract, peptone, and agar and is rich in nutrients.

[0025] The term "SDA medium" as used in this article refers to Sabouraud Dextrose Agar Medium, which typically contains glucose and peptone and has a slightly acidic pH.

[0026] The term "CMA medium" used in this article refers to Corn Meal Agar Medium, which is mainly composed of corn flour and agar.

[0027] The term "OA medium" used in this article refers to oatmeal agar medium, which is made with oat flour as the main nutrient and supplemented with agar, and is suitable for the cultivation of filamentous fungi.

[0028] The term "YPD medium" used in this article refers to Yeast Extract Peptone Dextrose Agar Medium, a commonly used nutrient medium for yeast and fungi. Its main components are yeast extract, peptone, glucose, and agar, providing comprehensive nutrition.

[0029] The term "PDB medium" used in this article refers to Potato Dextrose Broth Medium, which is the liquid form of PDA medium after the agar has been removed. It is suitable for liquid fermentation culture of fungi to obtain mycelia or metabolites.

[0030] The term "YPD liquid medium" as used in this article refers to the liquid medium of YPD medium after the agar has been removed, whose main components are yeast extract, peptone and glucose.

[0031] The term "sodium hexametaphosphate" used in this article refers to an inorganic polymer compound with the chemical formula (NaPO3)6, which has good dispersibility and chelation properties and can be used as a water softener, dispersant or stabilizer in the process of microbial culture or fermentation.

[0032] The term "OD" used in this article 333 "333nm" refers to the optical density value of a sample measured by a spectrophotometer under ultraviolet or visible light conditions. It is often used to quantitatively detect the concentration of substances with an absorption peak at that wavelength.

[0033] The term "defoamer" used in this article refers to an additive that is added during microbial fermentation to reduce the surface tension of the fermentation broth and inhibit or eliminate foam production. Common types include organosilicon compounds, polyether compounds, and fatty acid compounds, which can prevent the loss or contamination of microorganisms caused by foam overflow.

[0034] The term "GPE" used in this article refers to glycerol polyoxyethylene ether, a nonionic surfactant that can be used as an antifoaming agent, emulsifier, or penetrant in the fermentation industry.

[0035] The term "dissolved oxygen (DO)" used in this article refers to the amount of dissolved oxygen per unit volume of fermentation broth or culture medium, usually expressed in mg / L. It is a key environmental parameter in the aerobic fermentation process of microorganisms, which directly affects the growth, metabolism and product synthesis of the cells. In this article, dissolved oxygen is expressed as a percentage.

[0036] The term "ventilation rate" as used in this article refers to the volume of sterile air introduced into a unit volume of culture medium per unit time during microbial liquid culture. Common units are vvm and m. 3 / h or L / min is one of the core operating parameters for regulating the dissolved oxygen content in the culture medium.

[0037] The term "ITS" used in this article refers to the internal transcribed spacer, a non-coding region located between the 18S rDNA and 28S rDNA in fungal ribosomal DNA (rDNA). It includes two sequences, ITS1 and ITS2. Due to its rapid evolution and high sequence variability, it is often used as a molecular marker for fungal species identification and phylogenetic analysis.

[0038] In a first aspect, the present invention provides: a strain of *Kissus leucosus* (… Keithomyces carneus )BG-G1-uv03.

[0039] Among them is: Bacteroides nauplii BG-G1-uv03.

[0040] Among them, *Kissus leucosus* BG-G1-uv03 was selected from *Kissus leucosus* BG-G1-uv03, which is preserved at the Guangdong Provincial Center for Microbial Culture Collection with accession number GDMCC NO:67281.

[0041] Secondly, the present invention provides: an original strain for preparing the above-mentioned *Kissus leucosus* BG-G1-uv03.

[0042] This includes: the original strain.

[0043] The original strain was selected from: *Kimberella fuciformis* (… Keithomyces carneus )BG-G1.

[0044] Specifically, the flesh-colored bacteria ( Keithomyces carneus BG-G1, deposited at Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO:67280.

[0045] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the second aspect of the present invention includes: First preferred option: an original strain for the aforementioned *Kissus leucosus* BG-G1-uv03, said original strain being *Kissus leucosus* (… Keithomyces carneus BG-G1, deposited at the Guangdong Provincial Microbial Culture Collection Center, with accession number GDMCC NO:67280. This technical solution, based on solving the technical problem of "providing a Caryophyllus 'Caryophyllus' strain that can secrete green pigment extracellularly, with high yield and good stability, and whose fermented green pigment is stable," further solves the technical problem of "providing the original strain for preparing Caryophyllus 'Caryophyllus' strain that can secrete green pigment extracellularly, with high yield and good stability."

[0046] Thirdly, the present invention provides a method for preparing the above-mentioned *Bacillus thuringiensis* BG-G1-uv03.

[0047] It includes: Bacteroides carnivora BG-G1-uv03 and preparation method.

[0048] The preparation method includes: the above-mentioned BG-G1 carnivorous bacteria is irradiated under ultraviolet light and then screened and purified.

[0049] Specifically, the irradiation distance of the ultraviolet light is 20-40cm.

[0050] Preferably, the irradiation distance of the ultraviolet light is 21-22cm, 22-23cm, 23-24cm, 24-25cm, 25-26cm, 26-27cm, 27-28cm, 28-29cm, 29-30cm, 30-31cm, 31-32cm, 32-33cm, 33-34cm, 34-35cm, 35-36cm, 36-37cm, 37-38cm, 38-39cm, or 39-40cm.

[0051] More preferably, the irradiation distance of the ultraviolet light is 21-22cm, 22-23cm, 23-24cm, 24-25cm, 25-26cm, 26-27cm, 27-28cm, 28-29cm or 29-30cm.

[0052] More preferably, the irradiation distance of the ultraviolet light is 30cm.

[0053] Specifically, the irradiation time of the ultraviolet light is 10-30 seconds.

[0054] Preferably, the irradiation time of the ultraviolet light is 10-11s, 11-12s, 12-13s, 13-14s, 14-15s, 15-16s, 16-17s, 17-18s, 18-19s, 19-20s, 20-21s, 21-22s, 22-23s, 23-24s, 24-25s, 25-26s, 26-27s, 27-28s, 28-29s, or 29-30s.

[0055] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the third aspect of the present invention includes: The first preferred solution is a method for preparing the aforementioned *Caryophyllum spp.* BG-G1-uv03, wherein the preparation method includes irradiating the *Caryophyllum spp.* BG-G1 under ultraviolet light followed by screening and purification. This technical solution, based on solving the technical problem of "providing a *Caryophyllum spp.* strain capable of secreting extracellular chlorophyll with high yield and good stability, and whose fermented chlorophyll is stable," further solves the technical problem of "providing a method for preparing a *Caryophyllum spp.* strain capable of secreting extracellular chlorophyll with high yield and good stability."

[0056] Fourthly, the present invention provides the application of the above-mentioned *Bacillus thuringiensis* BG-G1-uv03 in the fermentation production of chlorophyll.

[0057] This includes: Bacteroides carnivora BG-G1-uv03, and its application.

[0058] Fifthly, the present invention provides a method for preparing a green pigment fermentation broth.

[0059] This includes: chlorophyll fermentation broth and preparation method.

[0060] The preparation method involves inoculating the above-mentioned Bacteroides rubrum BG-G1-uv03 into a culture medium for fermentation.

[0061] Specifically, the preparation method includes the following steps: S1. Inoculate the above-mentioned Bacteroides rubrum BG-G1-uv03 into the culture medium to obtain the activated strain; S2. Inoculate the activated bacterial strain into the seed culture medium and culture it to obtain a liquid bacterial strain; S3. Inoculate the liquid bacterial culture into the fermentation medium and ferment using a fed-batch fermentation process in a fermenter to obtain the green pigment fermentation broth.

[0062] Specifically, the culture medium mentioned in step S1 includes, but is not limited to: PDA medium, Czapek-Dox medium, MEA medium, SDA medium, CMA medium, OA medium or YPD medium.

[0063] Preferably, the culture medium mentioned in step S1 is PDA culture medium.

[0064] Specifically, the seed culture medium mentioned in step S2 includes, but is not limited to: PDB medium, Czapek liquid medium, malt extract liquid medium, Sabouraud dextrose liquid medium, YPD liquid medium, corn flour liquid medium or wheat bran extract medium.

[0065] Preferably, the seed culture medium in step S2 is PDB culture medium.

[0066] More specifically, the PDB culture medium consists of 6 g / L potato extract powder and 20 g / L glucose.

[0067] Specifically, the fermentation medium mentioned in step S3 is Martin's medium.

[0068] More specifically, the components of the Martin's medium include, but are not limited to: soybean peptone, glucose, potassium dihydrogen phosphate, and magnesium sulfate.

[0069] More specifically, the Martin medium, by weight-volume ratio, includes, but is not limited to: 0.4-0.6% soybean peptone, 0.5-2.5% glucose, 0.05-0.15% potassium dihydrogen phosphate, and 0.03-0.07% magnesium sulfate.

[0070] Preferably, the Martin's medium comprises, by weight-volume ratio: 0.4-0.45%, 0.45-0.5%, 0.5-0.55%, or 0.55-0.6% soybean peptone; 0.5-0.6%, 0.6-0.7%, 0.7-0.8%, 0.8-0.9%, 0.9-1.0%, 1.0-1.1%, 1.1-1.2%, 1.2-1.3%, 1.3-1.4%, 1.4-1.5%, 1... 0.5-1.6%, 1.6-1.7%, 1.7-1.8%, 1.8-1.9%, 1.9-2.0%, 2.0-2.1%, 2.1-2.2%, 2.2-2.3%, 2.3-2.4%, 2.4-2.5%; potassium dihydrogen phosphate 0.05-0.1% or 0.1-0.15%; magnesium sulfate 0.03-0.04%, 0.04-0.05%, 0.05-0.06% or 0.06-0.07%.

[0071] More preferably, the Martin medium comprises, by weight-volume ratio: 0.5% soybean peptone, 2% glucose, 0.1% potassium dihydrogen phosphate, and 0.03% anhydrous magnesium sulfate.

[0072] Specifically, the feed-fed fermentation process in step S3 includes a microbial propagation stage and a feed-fed stage.

[0073] More specifically, the process parameters for the bacterial cell propagation stage include, but are not limited to: pH 6.0-7.0, aeration rate of 2.5-4.0 L / min or 0.3-0.5 m³ / min. 3 The incubation period is 46-50 hours, with a temperature of 26-29℃, a rotation speed of 150-180 rpm, and the addition of 35-45% GPE defoamer during the incubation period.

[0074] Preferably, the process parameters for the bacterial cell reproduction stage are pH 6.5 and aeration rate of 0.4 m³ / h. 3 The incubation period was 48 hours, with a temperature of 28℃ and a rotation speed of 180 rpm.

[0075] More specifically, the feeding stage includes, but is not limited to, the addition of carbon sources and trace elements to the fermentation system.

[0076] Preferably, the carbon source is glucose, and the trace element is zinc salt.

[0077] More preferably, the concentration of glucose is 100 g / L.

[0078] More preferably, the zinc salt is 0.5% zinc sulfate.

[0079] More specifically, the replenishment cycle is 50-70 minutes.

[0080] Preferably, the replenishment cycle is 60 minutes.

[0081] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the fifth aspect of the present invention includes: The first preferred solution is a method for preparing a green pigment fermentation broth, wherein the preparation method involves inoculating the aforementioned *Bacillus thuringiensis* BG-G1-uv03 into a culture medium for fermentation; the preparation method includes the following steps: S1, inoculating the aforementioned *Bacillus thuringiensis* BG-G1-uv03 into a culture medium to obtain an activated strain; S2, inoculating the activated strain into a seed culture medium for cultivation to obtain a liquid strain; S3, inoculating the liquid strain into a fermentation culture medium and fermenting using a fed-batch fermentation process in a fermenter to obtain a green pigment fermentation broth. This technical solution, based on solving the technical problem of "providing a *Bacillus thuringiensis* strain capable of secreting green pigment extracellularly with high yield and good stability, and the green pigment obtained from its fermentation being stable," further solves the technical problem of "providing a method for preparing a green pigment fermentation broth."

[0082] In a sixth aspect, the present invention provides: a green pigment fermentation broth.

[0083] It includes: chlorophyll fermentation liquid.

[0084] The green pigment fermentation broth is selected from the green pigment fermentation broth prepared by the above preparation method.

[0085] In a seventh aspect, the present invention provides: a method for promoting the dissolution of intracellular pigments from the above-mentioned *Carnivora spp.* BG-G1-uv03.

[0086] Among them are: *Kissus leucosus* BG-G1-uv03 and methods.

[0087] The method includes adding a compound biological enzyme and ethyl salicylate to the above-mentioned green pigment fermentation broth.

[0088] Specifically, the compound bio-enzyme is cellulase.

[0089] Specifically, the method includes the following steps: adding 0.3% cellulase and 0.2% ethyl salicylate to the green pigment fermentation broth by mass-volume ratio, controlling the pH at 6.2-6.5 and the temperature at 30℃ and stirring for 60 min, raising the temperature to 80℃ and holding for 30 min, then lowering the temperature to 55℃, adding 0.2% sodium hexametaphosphate, aerating the mixture, and then centrifuging to collect the pigment solution.

[0090] Specifically, the ventilation rate of the ventilation treatment is 0.2-0.4 m³ / s. 3 / h, ventilation duration is 15-25min.

[0091] Preferably, the ventilation rate of the ventilation treatment is 0.3 m³ / s. 3 / h, ventilation duration is 20min.

[0092] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the seventh aspect of the present invention includes: The first preferred solution is a method for promoting the dissolution of intracellular pigments from *Bacillus thuringiensis* BG-G1-uv03, comprising adding a compound biological enzyme and ethyl salicylate to the fermentation broth containing the green pigment; the method includes the following steps: adding 0.3% cellulase and 0.2% ethyl salicylate to the fermentation broth at a mass-volume ratio, controlling the pH at 6.2-6.5, stirring at 30℃ for 60 min, raising the temperature to 80℃ and holding for 30 min, then cooling to 55℃, adding 0.2% sodium hexametaphosphate, aerating, and then centrifuging to collect the pigment solution. This technical solution, based on solving the technical problem of "providing a *Bacillus thuringiensis* strain capable of secreting green pigments extracellularly with high yield and good stability, and whose fermented green pigments are stable," further solves the technical problem of "providing a method for promoting the dissolution of intracellular pigments from *Bacillus thuringiensis* BG-G1-uv03."

[0093] Eighthly, the present invention provides a method for preparing green dye by extracting green pigment from the above-mentioned green pigment fermentation broth.

[0094] It includes: green pigment fermentation broth, green dye solution, and method.

[0095] The method includes the following steps: centrifuging the green pigment fermentation broth, adding calcium chloride solution to the supernatant, mixing well and letting it stand to obtain a yellow-green turbid liquid, centrifuging to discard the supernatant to obtain a green precipitate, air-drying it to obtain the purified green pigment, and adding dilute hydrochloric acid solution to obtain the final product.

[0096] Specifically, the volume ratio of the supernatant to the calcium chloride solution is 1-3:1.

[0097] Preferably, the volume ratio of the supernatant to the calcium chloride solution is 2:1.

[0098] Specifically, the concentration of the calcium chloride solution is 1-3M.

[0099] Preferably, the concentration of the calcium chloride solution is 2M.

[0100] Specifically, the mass ratio of the green precipitate to the dilute hydrochloric acid solution is 1:1-3.

[0101] Preferably, the mass ratio of the green precipitate to the dilute hydrochloric acid solution is 1:2.

[0102] Specifically, the concentration of the dilute hydrochloric acid solution is 1-3M.

[0103] Preferably, the concentration of the dilute hydrochloric acid solution is 2M.

[0104] Specifically, the settling time is 24 hours.

[0105] Specifically, the air-drying time is 60 minutes.

[0106] Specifically, the green dye solution has the highest absorption peak at a wavelength of 333 nm and the second highest absorption peak at 291 nm.

[0107] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the eighth aspect of the present invention includes: The first preferred solution is a method for extracting green pigment from the aforementioned green pigment fermentation broth to prepare a green dye solution, comprising the following steps: centrifuging the green pigment fermentation broth, adding calcium chloride solution to the supernatant, mixing well, and allowing it to stand to obtain a yellow-green turbid liquid, centrifuging to discard the supernatant to obtain a green precipitate, air-drying it, and adding dilute hydrochloric acid solution to obtain the final product. This technical solution, based on solving the technical problem of "providing a strain of *Gynostemma pentaphyllum* that can secrete green pigment extracellularly, has high yield and good stability, and whose fermented green pigment is stable," further solves the technical problem of "providing a method for preparing a green dye solution."

[0108] Ninthly, the present invention provides the application of the green dye liquor prepared by the above method in food processing, cosmetic preparation, and textile printing and dyeing.

[0109] This includes: green dyeing solutions, food processing, cosmetics preparation, textile printing and dyeing, and applications.

[0110] The textiles used in textile printing and dyeing include fabrics made of silk, cotton, linen, wool, cashmere, leather, cellulose fibers, or chemical fibers.

[0111] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the ninth aspect of the present invention includes: The first priority solution is the application of the green dye solution prepared by the above method in food processing, cosmetics preparation, and textile printing and dyeing. This technical solution, having solved the technical problem of "providing a strain of *Caryophyllum oxypetalum* that can secrete green pigment extracellularly, has high yield and good stability, and whose fermented green pigment is stable," further solves the technical problem of "providing applications for the green dye solution."

[0112] In this invention, Example 2 at least supports the protection scope of "Kissus leucobacter BG-G1-uv03".

[0113] "Bacterium leucosus BG-G1-uv03" is a term derived from the aforementioned explanation and / or Example 2, specifically from the description of "strains exhibiting extracellular pigment secretion characteristics (a green diffusion ring around the colony)" and "mutant strains with significant extracellular chlorophyll secretion ability," summarizing the common characteristic of "Bacterium leucosus mutant strains with significant extracellular chlorophyll secretion ability." Therefore, those skilled in the art, through reasonable presumption, can conclude that "Bacterium leucosus BG-G1-uv03," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional and common knowledge based on the existing level of technology, should all fall within the protection scope of "Bacterium leucosus BG-G1-uv03," and that "Bacterium leucosus BG-G1-uv03" should be replaced with "Bacterium leucosus BG-G1-uv03." Keithomyces carneus BG-G1-uv03” and others are still within the scope of protection of this invention.

[0114] Examples 1-2 of this invention at least support the protection scope of "Kissus leucosus BG-G1".

[0115] "Kissus leucosus BG-G1", as explained above and / or the corresponding "in Examples 1-2" in this document. Keithomyces carneus The description of "no obvious extracellular pigment diffusion in BG-G1 colonies (front and back) before mutagenesis" is derived from the common characteristic of "carnivorous bacteria without obvious extracellular pigment diffusion." Therefore, those skilled in the art can reasonably presume that "carnivorous bacteria BG-G1," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional and common knowledge based on the current level of technology should all fall within the protection scope of "carnivorous bacteria BG-G1." Replacing "carnivorous bacteria BG-G1" with " Keithomyces carneus BG-G1” and others are still within the scope of protection of this invention.

[0116] Examples 2-7 of this invention at least support the protection scope of "the application of the carnivorous bacteria BG-G1-uv03 in the fermentation production of green pigment".

[0117] The phrase "the application of *Bacillus thuringiensis* BG-G1-uv03 in the fermentation production of green pigment" is summarized from the aforementioned explanation and / or the corresponding descriptions in Examples 2-7, such as "the color of the BG-G1-uv03 bacterial solution is dark green" and "by optimizing the fermentation process, the pigment yield is increased from 1.04 g / L to 13.61 g / L," through the common characteristic that "*Bacillus thuringiensis* BG-G1-uv03 can ferment to produce green pigment." Therefore, those skilled in the art can reasonably presume that "the application of *Bacillus thuringiensis* BG-G1-uv03 in the fermentation production of green pigment," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional and common knowledge based on the existing level of technology should all fall within the protection scope of "the application of *Bacillus thuringiensis* BG-G1-uv03 in the fermentation production of green pigment."

[0118] Examples 2-7 of this invention at least support the protection scope of "method for preparing green pigment fermentation broth".

[0119] "Preparation method of chlorophyll fermentation broth" is explained above and / or in Examples 2-7 as follows: "Preparation of fermentation medium", "Fermentation temperature at 27°C in the later stage, aeration rate controlled at 0.2 vvm, cultured for 48 h", "Optimization of fermentation medium in fermentation broth, chlorophyll OD". 333 The value of 27.11 is summarized from the common feature of "preparation method of green pigment fermentation broth". Therefore, by reasonable presumption, those skilled in the art can determine that "preparation method of green pigment fermentation broth", its subordinate concepts, its basically equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing technical level should all fall within the protection scope of "preparation method of green pigment fermentation broth".

[0120] Examples 2-7 of this invention at least support the protection scope of "green pigment fermentation liquid".

[0121] "Green pigment fermentation broth" refers to the "OD value of extracellular pigments in the fermentation broth of the feed group" as explained above and / or in Examples 2-7. 333 The value was 14.71, and the mass concentration was 6.44 g / L. "In the fermentation broth using the optimized fermentation medium, the chlorophyll OD..." 333The value is 27.11, and the calculated yield is 11.79 g / L, etc., which are summarized from the common characteristics of "green pigment fermentation broth". Therefore, those skilled in the art can reasonably presume that "green pigment fermentation broth", its subordinate concepts, its basically equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing technical level should all fall within the protection scope of "preparation method of green pigment fermentation broth". Replacing "flesh-colored bacteria BG-G1" with "green pigment microbial fermentation broth", "green pigment fermentation preparation broth", etc., still falls within the protection scope of this invention.

[0122] Examples 8-9 of this invention at least support the protection scope of "method for promoting the dissolution of intracellular pigments of the bacterium 'Carnivora' BG-G1-uv03".

[0123] The "method for promoting the dissolution of intracellular pigments in *Bacillus thuringiensis* BG-G1-uv03" is summarized from the aforementioned explanation and / or the corresponding "adding 0.3% of the above-mentioned compound biological enzyme cellulase and 0.2% ethyl salicylate to the fermentation broth at a mass-volume ratio" and "controlling pH 6.2-6.5, raising the temperature to 30°C, stirring at 150 rpm, and maintaining for 60 min" in Examples 8-9, etc., all sharing the common characteristic of "method for promoting the dissolution of intracellular pigments in *Bacillus thuringiensis* BG-G1-uv03". Therefore, those skilled in the art can reasonably presume that the "method for promoting the dissolution of intracellular pigments in *Bacillus thuringiensis* BG-G1-uv03", its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing technical level, should all fall within the protection scope of the "method for promoting the dissolution of intracellular pigments in *Bacillus thuringiensis* BG-G1-uv03". Replacing "a method for promoting the dissolution of intracellular pigments in *Bacillus carnosus* BG-G1-uv03" with "a method for promoting the dissolution of intracellular pigments in *Bacillus carnosus* BG-G1-uv03" or similar terms still falls within the scope of protection of this invention.

[0124] In this invention, Example 5 at least supports the protection scope of "a method for preparing green dye by extracting green pigment from the green pigment fermentation broth".

[0125] The method for preparing green dye from the fermentation broth of the green pigment is summarized from the common feature of "purification method of green dye" in the foregoing explanation and / or Example 5, such as "take 10 mL of supernatant, add 5 mL of 2M calcium chloride solution, mix well, and let stand at room temperature for 24 h to obtain a yellow-green turbid liquid" and "centrifuge at 12000 rpm for 3 min to obtain a green precipitate, discard the supernatant, and air-dry the green precipitate for 60 min to obtain the purified green pigment". Therefore, those skilled in the art can reasonably presume that the method for preparing green dye from the fermentation broth of the green pigment, its subordinate concepts, its basically equivalent technical means, and technical means that can replace it within the conventional technical means and common knowledge based on the existing technical level should all fall within the protection scope of the method for preparing green dye from the fermentation broth of the green pigment. Replacing the method for preparing green dye from the fermentation broth of the green pigment with the method for preparing green dye based on the extraction of green pigment from the fermentation broth of the green pigment, etc., still falls within the protection scope of this invention.

[0126] Examples 2-9 of this invention at least support the protection scope of "the application of the green dye".

[0127] The term "application of the green dye liquor" is summarized by the common characteristic of "application of microbial pigments" as described in the foregoing explanation and / or Examples 2-9, such as "pigments are widely used as important colorants in various industries including food processing, cosmetics preparation, and textile printing and dyeing" and "microbial pigments are considered the most promising sustainable alternative to synthetic pigments due to their advantages such as environmental friendliness in production, wide availability of raw materials, short fermentation cycle, and ability to be produced on a large scale." Therefore, those skilled in the art can reasonably presume that "application of the green dye liquor," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional and common knowledge based on the existing level of technology should all fall within the protection scope of "application of the green dye liquor."

[0128] The present invention has at least the following beneficial effects: Compared with existing technologies, the present invention has better technical effects in terms of green pigment production.

[0129] According to experimental tests, this invention enables the chlorophyll OD... 333 The value has increased from 19.35 in the prior art to over 27.11.

[0130] According to experimental tests, the present invention increases the yield of chlorophyll from 8.44 g / L in the prior art to over 11.79 g / L.

[0131] Preservation Instructions Preserved strain: *Kimberella carnosa* (Keithomyces carneus BG-G1; Category Naming: Keithomyces carneus ; Accession number: GDMCC NO:67280; Preservation period: November 12, 2025; Preservation institution: Guangdong Provincial Center for Microbial Culture Collection; Address: Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province.

[0132] Preserved strain: *Kimberella carnosa* ( Keithomyces carneus BG-G1-uv03; Category Naming: Keithomyces carneus ; Accession number: GDMCC NO:67281; Preservation period: November 12, 2025; Preservation institution: Guangdong Provincial Center for Microbial Culture Collection; Address: Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province. Attached Figure Description

[0133] Figure 1 Colony morphology of BG-G1 (pre-UV mutagenesis strain) and BG-G1-uv03 (UV mutagenesis screening strain); Figure 1 In the text, 'a' represents the frontal colony morphology of BG-G1. Figure 1 In this context, 'b' represents the reverse colony morphology of BG-G1. Figure 1 In the text, 'c' represents the frontal colony morphology of BG-G1-uv03. Figure 1 In the figure, d represents the reverse colony morphology of BG-G1-uv03.

[0134] Figure 2 To measure the OD of pigment production by strains BG-G1 and BG-G1-uv03 at different culture times 333 Absorbance value.

[0135] Figure 3 Comparison of the appearance of bacterial cultures of strains BG-G1 and BG-G1-uv03 after 7 days of culture.

[0136] Figure 4 The UV-Vis spectra of extracellular metabolic pigments of strains BG-G1-uv03 and BG-G1 are shown.

[0137] Figure 5 The graph shows a comparison of the absorbance values ​​of the pigments produced by strains BG-G1-uv03 and BG-G1 in different culture media. Different letters indicate significant differences (P < 0.05).

[0138] Figure 6 This is a standard curve showing the relationship between the concentration of pigments obtained from fermentation of strain BG-G1-uv03 and their absorbance.

[0139] Figure 7 The graph shows the effect of different temperature conditions on the absorbance of pigments obtained from fermentation by strain BG-G1-uv03.

[0140] Figure 8 The graph shows the effect of different light environments on the absorbance of pigments obtained from fermentation by strain BG-G1-uv03.

[0141] Figure 9 The figure shows the results of pigment retention rate determination obtained by BG-G1-uv03 strain fermentation under different pH conditions. Detailed Implementation

[0142] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following content is merely an exemplary description of the scope of protection claimed by the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, and such changes should also fall within the scope of protection claimed by the present invention.

[0143] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all instruments, devices, equipment, reagents, products, etc., used in the embodiments of the present invention are obtained through conventional commercial means.

[0144] Example 1: Isolation, identification and preservation of *Kissus leucosus* 1. Strains Isolation Topsoil samples were collected (collection location: forest in Beihai, Guangxi, collection depth <10cm). After sieving and grinding, 50g of soil sample was added to 200mL of sterile water and soaked for 5 minutes. 5mL of the soil solution was then extracted and further soaked in 45mL of sterile water for 10 minutes. -1 Dilute, then repeat this step 10 times. -2 and 10 -3 Serial dilution. Pipette 0.5 mL of each dilution onto a PDA plate, performing three replicates for each dilution; incubate at 28°C for 5 days. After incubation, select green fungal colonies from the plates and purify them using the streak plating method on PDA plates to obtain purified strains.

[0145] The PDA plates are prepared as follows: Place 26g of potato dextrose aqueous culture medium into an Erlenmeyer flask, add 15g of agar powder, then add 1L of hot water at approximately 80℃, stir well, seal with sealing film, and sterilize at 121℃ for 20 minutes. Once the culture medium temperature has dropped to 70℃, pour the culture medium into sterile disposable plastic petri dishes in a laminar flow hood and allow it to solidify before use.

[0146] 2. Strain identification (1) Morphological identification The purified strain was inoculated onto PDA plates and cultured at 28°C for 7 days. Colony morphology was observed. The results showed that the colonies of *Kissus leucosus* were white and velvety on the front, with some colonies having transverse wrinkles. A small amount of powdery spores were produced on the surface, but no obvious pigment production was observed. The hyphae in the substrate were green, and the wrinkles corresponded to those on the front. The conidiophores were multi-branched, with 3-4 small conidiophores at the base. The small conidiophores were flask-shaped, and the conidia were transparent, nearly spherical or globular, with a diameter of approximately 2.2-4.3 μm.

[0147] (2) Molecular biological identification 1) The genomic DNA of the strain was identified using ITS sequence analysis. The target ITS gene fragment was amplified by PCR and sequenced, ultimately obtaining an ITS gene sequence of 491 bp, as shown below: SEQ ID NO:1: GTGAACATACCTATCTTACTGTTGCTTCCCCGCCGTGGGTAAAACCGCTGCGGGGGAGGACACAGCCACAAACTCTGTAATTTACTACTGTAACTGTCTGAGTAAACATCATTTATAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGC CAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGTCCCCGTGGACTTGGTGTTGGGGACCGGCAACAGGAAAAGAACCCCCCCCCGGCGCCGCCCCCTAAATGAATTGGCGGCCTCGTCGCGGTCTTTTCCTCTGCGTAGTAGAAAACACCTCGCAATAGGAGCCCGACGGTGGCCACTGCCGTAAAACGCCCCAAACTTTTTCAAAGTGACCTCGAATCAGGTAGAAATC.

[0148] 2) The above ITS gene sequence was compared with the ITS sequence in GeneBank. The results are shown in Table 1: This strain is similar to... Keithomyces carneus The strain WCPX-FS04 (Accession: KR296911.1) showed a homology of 98.03%. Based on morphological characteristics, the isolated strain was identified as *K. caryopsis*. Keithomyces carneus ), named BG-G1.

[0149] Table 1. Results of ITS sequence alignment

[0150] 3. Preservation of bacterial strains The *Kissus spp.* BG-G1 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 12, 2025, with accession number GDMCC NO:67280. The Latin name of this bacterium is... Keithomyces carneus .

[0151] Example 2: Preparation and preservation of UV-induced mutant strains 1. Preparations before mutagenesis The *Kissus spp.* BG-G1 strain purified in Example 1 was inoculated onto PDA slant agar and incubated at 28°C for 168 h. When colonies emerged and produced a small number of conidia, 5 mL of sterile water was added to each of the three slant agars to rinse them. The mycelium and conidia were then transferred to sterile 50 mL centrifuge tubes, shaken to disperse the mycelium, and the spores were collected. A hemocytometer was used to count the spores, and the concentration of the spore suspension was diluted to 1 × 10⁻⁶. 3 Spores / mL are prepared for later use.

[0152] 2. Ultraviolet mutagenesis treatment Using a pipette, pipette 0.5 mL of the above bacterial suspension and spread it evenly onto a PDA plate. Place the plate in a sterile operating room, open the lid, and place it under a 20W UV lamp for irradiation to induce mutagenesis. The irradiation distance is 30 cm, and the irradiation time is set at three gradients: 10 s, 20 s, and 30 s. The bacterial suspension irradiated for 0 s serves as a blank control. After irradiation, replace the lid and incubate in the dark at 28℃ for 3 days to avoid photoreactivation.

[0153] 3. Screening and purification of mutant strains Single colonies grown from each mutagenesis-treated plate were picked and inoculated into PDA plates. After incubation at 28°C for 5 days, the metabolism of chlorophyll in the single colonies was observed, and strains exhibiting extracellular pigment secretion characteristics (a green diffusion zone around the colony) were screened. One mutant strain with significant extracellular chlorophyll secretion ability was obtained through screening and named BG-G1-uv03. This mutant strain was purified three times on PDA plates to obtain the purified mutant strain.

[0154] Morphological observation such as Figure 1 As shown, the BG-G1 colonies (front and back) before mutagenesis showed no obvious extracellular pigment diffusion, while the BG-G1-uv03 colonies (front and back) after mutagenesis showed obvious intracellular pigment metabolism and extracellular migration, and a green halo could be seen around the colonies.

[0155] 4. Preservation of bacterial strains The aforementioned *Kissus spp.* BG-G1-uv03 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 12, 2025, with accession number GDMCC NO:67281. The Latin name of this bacterium is... Keithomyces carneus .

[0156] Example 3: Extracellular pigment production capacity and pigment spectral characteristics of different strains This embodiment compares the ability of liquid culture strains BG-G1 and BG-G1-uv03 to produce extracellular pigments and the absorbance of the fermentation pigment solution across the entire wavelength range.

[0157] 1. Liquid culture pigments and assay methods Prepare PDB liquid culture (6 g / L potato extract, 20 g / L glucose, 1 L water, pH 6.5 ± 0.2). Cut five approximately 3 mm × 3 mm mycelial blocks from PDB plates containing strains BG-G1 and BG-G1-uv03, respectively, and inoculate them into 250 mL Erlenmeyer flasks containing 100 mL of sterile PDB medium. Set the shaker speed to 150 rpm and the culture temperature to 28℃. Samples were taken at 48 h, 72 h, 96 h, 120 h, 144 h, and 168 h, centrifuged at 8000 rpm for 3 min, and the supernatant was used to determine the OD. 333 The absorbance value.

[0158] The dynamic changes in pigment production are as follows: Figure 2 As shown: the absorbance values ​​of both strains increased with increasing culture time, and tended to stabilize after 144 h, entering the pigment synthesis plateau phase. The absorbance value of the mutant strain BG-G1-uv03 was significantly higher than that of the original strain BG-G1 throughout the entire culture period. At 144 h, the OD values ​​of both strains were significantly higher. 333 The maximum values ​​were 5.69 and 2.69, respectively, indicating that the pigment synthesis ability of the mutant strain was significantly enhanced after mutagenesis.

[0159] 2. Compare the ability of normal and mutant strains to produce extracellular pigments. After culturing in PDB medium for 7 days (168 hours), the color changes in the shake flasks were observed, and the results are as follows: Figure 3 As shown: the bacterial culture of BG-G1-uv03 is dark green, while the bacterial culture of strain BG-G1 is light green. In addition, it can be seen that strain BG-G1-uv03 releases more intracellular pigments into the extracellular space than strain BG-G1, making it appear more green.

[0160] 3. Determine the peak uptake values ​​of normal and mutant plants. BG-G1 and BG-G1-uv03 bacterial cultures were centrifuged at 8000 rpm for 3 min, and the supernatant was collected and diluted several times. The absorbance was measured across the entire wavelength range using a UV-Vis spectrophotometer. PDB medium was used as a blank control. A full wavelength scan was performed in the 200-700 nm range. The results are as follows: Figure 4 As shown: the scan shows the highest absorption peak at a UV wavelength of 333 nm and the second highest absorption peak at 291 nm. The absorption peaks of the two strains are similar, indicating that the pigment properties of the mutant and the original strain have not changed significantly.

[0161] 4. Stability verification of mutant strains The mutant strain BG-G1-uv03 obtained by screening was subjected to a passage stability test: PDB liquid medium was used. The first generation was defined as PDB plates inoculated into shake flasks containing PDB liquid medium. Subsequent passages were performed by subculturing the liquid medium in shake flasks once, for a total of 9 passages. The same culture conditions were used for each passage: shaker speed 150 r / min, culture temperature 28℃, and culture time 144 h. The OD of the fermentation broth supernatant was measured. 333 Absorbance values. The results are shown in Table 2, OD values ​​of 9 generations of culture. 333 The average absorbance values ​​ranged from 5.80 to 6.65. One-way ANOVA confirmed that the p-value for absorbance values ​​between generations was 0.1666 (P>0.05), indicating no statistically significant difference. These results demonstrate that the extracellular chlorophyll production capacity of the mutant strain BG-G1-uv03 is stably inherited and exhibits good transgenerational genetic stability.

[0162] Table 2. Statistical analysis of genetic stability of mutant strains through generations (n=3)

[0163] Example 4: Effects of different culture media on pigment production of strains BG-G1 and BG-G1-uv03 1. Cultivation Methods PDB (potato extract powder 6 g / L, glucose 20 g / L, water 1 L), Czapek's liquid medium (sucrose 3%, sodium nitrate 0.3%, dipotassium hydrogen phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, ferrous sulfate 0.01%, sodium chloride 0.05%), and Martin's liquid medium (soybean peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate heptahydrate 0.05%) were selected as the pigment-producing media for strains BG-G1 and BG-G1-uv03. The pH of all media was 6.3 ± 0.2.

[0164] Five 3mm × 3mm bacterial blocks were cut from each of the BG-G1 and BG-G1-uv03 PDA plates and inoculated into 250mL Erlenmeyer flasks containing 100mL of sterile test medium. The shaker was set to 150rpm, the culture temperature to 28℃, and the culture was carried out in the dark for 144h. The fermentation broth was then centrifuged at 8000rpm for 3min, and the supernatant was used to determine the OD value. 333 Absorbance values ​​were used to compare the extracellular pigment production capacity of different strains in different culture media.

[0165] 2. Experimental Results The results are as follows Figure 5As shown, the absorbance values ​​of the mutant strain BG-G1-uv03 in all three culture media were significantly higher than those of the original strain BG-G1 (P < 0.05); the OD values ​​of extracellular chlorophyll in Martin's medium for both strains were higher than those in Czapek's medium and PDB medium (P < 0.05). Specifically, the OD values ​​of extracellular pigments in BG-G1-uv03 in Martin's medium... max The value was 6.32, indicating that Martin's medium is the optimal medium for producing chlorophyll.

[0166] Example 5 Purification of chlorophyll from fermentation broth 1. Pigment purification: Take 20 mL of the fermentation broth of BG-G1-uv03 in Martin's medium from Example 4, centrifuge at 8000 rpm for 3 min, take 10 mL of the supernatant, add 5 mL of 2M calcium chloride solution, mix well, and let stand at room temperature for 24 h to obtain a yellow-green turbid liquid; after centrifugation at 12000 rpm for 3 min, a green precipitate is obtained, discard the supernatant, and air dry the green precipitate for 60 min to obtain the purified green pigment; add 1 mL of 2M dilute hydrochloric acid solution to obtain a yellow-green solution, which is the pigment stock solution.

[0167] 2. Establishment of Standard Curve: The green precipitate obtained by the above method was diluted with 2M dilute hydrochloric acid to prepare eight different concentrations of pigment solution: 1, 2, 4, 6, 8, 10, 12, and 16 g / L. The absorbance of each concentration was measured at a wavelength of 333 nm using a spectrophotometer. A standard curve equation was established with pigment concentration as the abscissa (x) and absorbance value as the ordinate (y).

[0168] The results are as follows Figure 6 As shown: The standard curve equation for the relationship between the absorbance and concentration of BG-G1-uv03 is y = 0.4315x + 0.0943, R 2 =0.9985; indicating that the pigment concentration has a good linear relationship with the absorbance value in the range of 1-16 g / L, and can be used for quantitative calculation of pigment yield.

[0169] Example 6: Optimization of Feeding Process for 5L Fermenter 1. Seed liquid preparation Prepare PDB medium, inoculate with BG-G1-uv03 bacterial strain, and culture at 28℃ and 150rpm for 5 days to obtain a thick bacterial seed culture for later use.

[0170] 2.5L Fermentation Medium Preparation Prepare 3.5L of Martin's liquid medium containing 0.1% defoamer GPE according to 70% of the fermenter volume: soybean peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, and defoamer GPE 0.1%; autoclave at 121℃ for 25 minutes, and then cool to the fermentation temperature.

[0171] 3. Fermentation process setup Two experimental groups were set up: one group without material replenishment (control) and one group with material replenishment. The specific process parameters are as follows: (1) Initial stage: Adjust the pH of the fermentation medium to 6.5±0.2, inoculate the seed liquid at a rate of 3%, set the aeration rate to 3.0L / min, the temperature to 26℃, the rotation speed to 120rpm, and culture for 30h; (2) Cell reproduction stage: When the dissolved oxygen (DO) value is 30%, adjust the aeration rate to 3.5 L / min, the temperature to 28℃, the rotation speed to 150 rpm, and culture for 48 h. During this period, 200 mL of 50% defoamer GPE is automatically added. (3) Feeding stage (feeding group only): After fermentation for 30 hours, start adding 100 mL of 100 g / L glucose and 100 mL of 0.5% ZnSO4 solution. The flow rate is set to 5 mL / min, the control cycle is 60 min, and the working time is 12 s. (4) Later stage: The ventilation rate was adjusted to 2L / min, the temperature was 27℃, the rotation speed was 100rpm, and the culture time was 48h.

[0172] 4. Indicator Measurement After fermentation, the fermentation broth was centrifuged at 8000 rpm for 3 minutes, and the OD of the supernatant was measured. 333 The absorbance value was used to calculate the pigment mass concentration using the standard curve from Example 5.

[0173] 5. Experimental Results OD of extracellular pigments in the fermentation broth of the fed group 333 The value was 14.71, and the mass concentration was 6.44 g / L; the OD of the non-feeding group was... 333 The value was 12.12, and the mass concentration was 5.32 g / L. The feed-in process increased the yield by 21.0%, indicating that feed-in can significantly improve pigment yield.

[0174] Example 7: Process Validation of a 30L Fermenter 1. Seed liquid preparation The preparation method is the same as in Example 6.

[0175] 2. Preparation of fermentation culture medium The optimized fermentation medium was prepared according to the optimized formula: 0.5% soybean peptone, 2% glucose, 0.2% rice flour, 0.1% potassium dihydrogen phosphate, 0.03% anhydrous magnesium sulfate, 0.1% GPE defoamer, and pH adjusted to 6.5±0.2; it was then autoclaved at 121℃ for 25 minutes and cooled to the fermentation temperature after sterilization.

[0176] 3. Fermentation process parameters: ① Initial stage: Inoculation amount 4%, ventilation rate 0.3 m³ / h 3 / h, temperature 27℃, rotation speed 120rpm, culture for 30h; ② Bacterial cell reproduction stage: When the DO value is 30%, the ventilation rate is 0.4 m³ / h. 3 / h, temperature 28℃, rotation speed 180rpm, culture for 48h, automatically add 200mL of 40% defoamer GPE; ③ Feeding stage: When the DO value drops below 10%, at a temperature of 28℃ and a rotation speed of 150 rpm, start adding 500 mL of 100 g / L glucose and 400 mL of 0.5% ZnSO4 solution at a flow rate of 60 mL / min, control the cycle at 60 min, work time at 30 s, adjust the pH to 7.2, and incubate for 48 h. ④ Later stage: The temperature in the later stage of fermentation is 27℃, the aeration rate is controlled at 0.2vvm, and the culture time is 48h.

[0177] 4. Control group setup The fermentation medium used was on-tank (0.5% soybean peptone, 2% glucose, 0.2% rice flour, 0.012% lysine, 0.004% tryptophan, 0.0001% compound vitamin B, 0.03% anhydrous magnesium sulfate, 0.2% defoamer GPE, pH 6.5±0.2), with other process parameters being the same.

[0178] 5. Indicator Measurement After fermentation, the OD of the fermentation broth supernatant was measured. 333 Absorbance value is used to calculate pigment yield.

[0179] 6. Experimental Results In the fermentation broth using an optimized fermentation medium, the chlorophyll OD 333 The value was 27.11, and the calculated yield was 11.79 g / L; the OD of the control group (fermentation medium on the tank) was... 333 The value was 19.35, and the yield was 8.44 g / L. The results indicate that the optimized fermentation medium and process significantly improved pigment yield and are suitable for large-scale fermentation production.

[0180] Example 8: Comparison of Intracellular Pigment Dissolution Processes 1. Three intracellular pigment leaching processes were set up to treat the BG-G1-uv03 fermentation broth obtained from the optimized process in the 30L fermenter in Example 7. The pigment concentration before and after treatment was measured, and the growth rate was calculated. (1) Process 1 (high temperature treatment): After the fermentation broth is heated at 80℃ for 1 hour, the stirring speed is 150 rpm and the aeration rate is 3 L / min. After cooling, the bacteria are removed by a 150 mesh filter bag and the pigment solution is collected.

[0181] (2) Process 2 (enzyme treatment): Add 0.6% food-grade cellulase (purchased from Nanning Shanwan Biotechnology Co., Ltd., enzyme activity unit is 20000U / g) to the fermentation broth, adjust the pH to 6.5, raise the temperature to 40℃ and keep it for 30min; then raise it to 80℃ and keep it for 40min, then lower the temperature to 60℃; add 0.5% sodium hexametaphosphate, stir at 100rpm, aeration rate of 0.2vvm, aeration time of 20min; after cooling to 35℃, remove the cells with a 150 mesh filter bag to obtain the fermentation green pigment stock solution.

[0182] (3) Process 3 (enzyme + auxiliary agent synergistic treatment): Add 0.3% of the above-mentioned food-grade cellulase (purchased from Nanning Shanwan Biotechnology Co., Ltd.) and 0.2% ethyl salicylate to the fermentation broth by mass-volume ratio, control the pH at 6.5, raise the temperature to 30℃, stir at 150 rpm, and maintain for 60 min; then raise the temperature to 80℃ and maintain for 30 min, then lower the temperature to 55℃; add 0.2% sodium hexametaphosphate, stir at 100 rpm, and aerate at 0.3 m³ / min. 3 / h, aeration time 20min; remove bacterial cells with a 150 mesh filter bag to obtain fermented green pigment stock solution.

[0183] The formula for calculating the pigment growth rate is: Growth rate (%) = (pigment concentration after treatment - pigment concentration before treatment) / pigment concentration before treatment × 100%.

[0184] 2. Experimental Results The treatment effects of the three processes are shown in Table 3: The pigment growth rate of process 1 was 6.82%-9.78%, that of process 2 was 13.90%, and that of process 3 was 15.44%-16.47%. Among them, after treating a 30L fermentation broth (yield of 11.79 g / L before treatment) with process 3, the pigment concentration reached 13.61 g / L, which was significantly higher than that of other processes. This indicates that the synergistic effect of enzyme and ethyl salicylate can effectively promote intracellular pigment dissolution and increase the total yield. Therefore, process 3 was determined to be the optimal intracellular pigment dissolution process.

[0185] Table 3

[0186] Example 9: Determination of Pigment Stability 1. Take a certain volume of the green pigment stock solution obtained from process 3 in Example 8, centrifuge at 8000 rpm for 3 minutes, take several 50 mL glass beakers, and take 10 mL of the supernatant (i.e., pigment solution) into each 50 mL beaker. Measure the initial OD. 333 The value is 6.22; The pigment solution was tested for temperature stability, light stability, and acid-base stability, with the corresponding culture medium serving as a blank control. (1) Temperature stability: The pigment solution was placed in environments of 4℃, 20℃, 40℃, 60℃, 80℃ and 100℃ respectively, and samples were taken at 0h, 2h, 4h, 6h and 8h respectively to measure OD. 333 Absorbance value.

[0187] (2) Light stability: The pigment solution was placed in dark, low light (natural light) and strong light (ultraviolet light) environments, and samples were taken at 0h, 2h, 4h, 6h and 8h, respectively, and the OD was measured. 333 Absorbance value.

[0188] (3) Acid-base stability: The pigment solution was dissolved in acidic and alkaline solutions with pH values ​​of 3, 5, 7, 9, and 11, respectively. After thorough mixing, the solution was allowed to stand at room temperature in the dark for 2 hours, and the OD was measured. 333 The absorbance value is used to calculate the pigment retention rate using the formula: Pigment retention rate = A1 / A0 × 100% (A1 is the absorbance value after treatment, and A0 is the initial absorbance value).

[0189] 2. Experimental Results (1) Temperature stability: The results are as follows Figure 7 As shown, the absorbance values ​​of the pigment at 4℃, 20℃, 40℃, 60℃ and 80℃ changed little with the extension of the treatment time; although there was a slight decrease at 100℃, the decreasing trend was not obvious, indicating that the pigment has excellent thermal stability.

[0190] (2) Light stability: The results are as follows Figure 8 As shown, under the same treatment time conditions, dark and low light (natural light) environments have almost no effect on the absorbance of the pigment; after 8 hours of strong light (ultraviolet light) irradiation, the absorbance of the pigment decreased slightly, but the decrease was small, indicating that the pigment has good resistance to strong light and ultraviolet light.

[0191] (3) Acid-base stability: The results are as follows Figure 9 As shown, the pigment retention rate was above 70% in a wide range of pH 3-11, indicating that the pigment of *Carnivora spp.* has good tolerance to acid and alkali; the retention rate was even higher in the acidic range of pH < 7, indicating that the pigment has better tolerance to acid.

[0192] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A strain of flesh-colored bacteria ( Keithomyces carneus BG-G1-uv03, characterized in that, The *Kissus leucosus* BG-G1-uv03 strain is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC NO:67281.

2. An original strain for preparing the *Bacillus carnivora* BG-G1-uv03 according to claim 1, characterized in that, The original strain was *Kistobacterium flesh-coloredum* (… Keithomyces carneus BG-G1, deposited at Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO:67280.

3. The method for preparing *Bacillus thuringiensis* BG-G1-uvO3 according to claim 1, characterized in that, The preparation method includes irradiating the *Bacillus carnivora* BG-G1 described in claim 2 under ultraviolet light and then screening and purifying it.

4. The application of the *Brachys cerevisiae* BG-G1-uv03 as described in claim 1 in the fermentation production of chlorophyll.

5. A method for preparing a green pigment fermentation broth, characterized in that, The preparation method involves inoculating the *Bacillus thuringiensis* BG-G1-uv03 of claim 1 into a culture medium for fermentation.

6. The preparation method according to claim 5, characterized in that, The preparation method includes the following steps: S1. Inoculate the *Bacillus erythrorhizon* BG-G1-uv03 as described in claim 1 into a culture medium to obtain an activated strain; S2. Inoculate the activated bacterial strain into the seed culture medium and culture it to obtain a liquid bacterial strain; S3. Inoculate the liquid bacterial culture into the fermentation medium and ferment using a fed-batch fermentation process in a fermenter to obtain the green pigment fermentation broth; The feed-fed fermentation process in step S3 includes a microbial propagation stage and a feed-fed stage.

7. The green pigment fermentation broth prepared by the preparation method according to any one of claims 5-6.

8. A method for promoting the dissolution of intracellular pigments from *Bacillus carnivora* BG-G1-uv03 as described in claim 1, characterized in that, The method includes adding a compound biological enzyme and ethyl salicylate to the green pigment fermentation broth of claim 7.

9. A method for preparing green dye solution by extracting green pigment from the green pigment fermentation broth according to claim 7, characterized in that, The process includes the following steps: centrifuge the green pigment fermentation broth, add calcium chloride solution to the supernatant, mix well and let stand to obtain a yellow-green turbid liquid, centrifuge and discard the supernatant to obtain a green precipitate, air dry to obtain the purified green pigment, and add dilute hydrochloric acid solution to obtain the final product.

10. The application of the green dye liquor prepared by the method of claim 9 in food processing, cosmetic preparation, and textile printing and dyeing.