Yarrowia lipolytica BS-3 and application thereof in production of resveratrol
By modifying the metabolism of Yersinia lipolyticis and optimizing the fermentation parameters, the problem of instability in the fermentation process of Yersinia lipolyticis to produce resveratrol in the existing technology has been solved, and efficient and stable resveratrol production has been achieved, with a significant increase in yield and conversion rate.
Patent Information
- Application Number
- CN202610264713.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-05
- Publication Date
- 2026-05-12
AI Technical Summary
In the current process of producing resveratrol by fermentation of Yeast lipolyticis, the lack of real-time monitoring and dynamic control of key parameters leads to the failure to fully realize the metabolic potential of cells, resulting in an unstable production process and limited yield increases.
Metabolic engineering was performed on Yarrowia lipolytica Po1f to enhance the coumaric acid synthesis pathway, eliminate tyrosine feedback repression, introduce exogenous proteins related to the resveratrol synthesis pathway, construct a resveratrol-producing strain, and induce ARTP mutagenesis. Combined with optimization of ammonium ion and lysed phosphorus concentrations in the fermentation broth and a specific oxygen consumption rate-controlled oxygen supply strategy, precise regulation of cellular metabolic flux was achieved.
Under optimized fermentation conditions, resveratrol yield reached 36.9 g/L with a conversion rate of 5.9%, significantly improving production efficiency and stability.
Smart Images

Figure CN122012264A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of microbiology and fermentation technology, and in particular to a strain of Yersinia lipophila BS-3 and its application in the production of resveratrol. Background Technology
[0002] Resveratrol is a natural polyphenol compound with the chemical name (E)-3,5,4-trihydroxystilbene. It appears as white needle-like crystals, is sparingly soluble in water but readily soluble in organic solvents. It was initially isolated from the plant *Resveratrol*, and has since been found in various other plants, including grapes (especially grape skins), *Polygonum cuspidatum*, peanuts, and mulberries. Plants synthesize resveratrol as an antitoxin when subjected to stress such as fungal infection or ultraviolet radiation. Resveratrol exists primarily in two isomers, trans and cis, with the trans isomer exhibiting stronger physiological activity and greater stability. Its most promising biological properties include antioxidant, anti-inflammatory, cardiovascular protective, and potential antitumor activity.
[0003] Yarrowia lipolytica ( Yarrowia lipolytica This yeast strain is a Generally Recognized As Safe (GRAS) microbial strain certified by the U.S. Food and Drug Administration (FDA) and has significant application value in the field of industrial fermentation. It is used to synthesize various high-value-added products, including human milk oligosaccharides (such as 3-fucosylated lactose), carotenoids, microbial oils, nervonic acid, and other functional lipids. Simultaneously, it is also a highly efficient protein expression system, capable of secreting large quantities of industrial enzymes such as lipases and proteases. This strain possesses a broad substrate utilization spectrum, capable of naturally utilizing various carbon sources such as alkanes, glycerol, and organic acids, and exhibits excellent environmental robustness, tolerating extreme conditions such as hyperosmolarity, high salt, organic acids, and various inhibitors. Furthermore, its fermentation process is simple to control and easily scaled up, making it highly suitable for large-scale industrial production. In recent years, the synthesis of resveratrol, a high-value-added product, from *Yersinia lipolytica* using metabolic engineering has become a research hotspot, and significant progress has been made. For example, in 2020, the Technical University of Denmark achieved the synthesis of 12.4 g / L of resveratrol using glucose as a substrate within 90 hours through engineering modification; Jiangnan University increased the yield to 22.5 g / L within 140 hours by reconstructing the metabolic pathway in 2022; and Hunan Hongjian Biotechnology Co., Ltd.'s patent (CN117625698A) published in 2023 achieved a yield of 28.2 g / L within 162 hours through 50 L-scale process optimization. Existing research mainly focuses on the genetic engineering modification of strains and the optimization of basic fermentation parameters (such as carbon source and feeding strategy). However, systematic research on the real-time monitoring and refined dynamic control of key parameters (such as ammonia nitrogen concentration, phosphate availability, dissolved oxygen, and oxygen uptake rate) during fermentation, specifically targeting *Yersinia lipolytica* as the production host, remains lacking. The lack of this technology limits the further development of cellular metabolic potential and the stable and efficient operation of the production process. Therefore, this invention aims to fill this technological gap by providing a process control technology specifically for the fermentation production of resveratrol using *Yarrowia lipolytica*. The core of this technology lies in the online monitoring and feedback control of key parameters such as ammonia nitrogen, soluble phosphate (solubilized phosphorus), and oxygen in the fermentation broth. This dynamic regulation of nutrient supply and culture environment allows for precise guidance of cellular metabolic flow, ultimately achieving stable production, increased yield, and improved conversion efficiency. Summary of the Invention
[0004] The purpose of this invention is to provide a strain of *Yersinia lipophila* BS-3 and its application in the production of resveratrol, thereby solving the problems existing in the prior art. This invention selects *Yersinia lipophila* (… Yarrowia lipolytica Po1f was used as the chassis strain. Based on metabolic engineering, its metabolic pathway was modified using conventional genetic engineering techniques to enhance the synthesis of coumaric acid, eliminate tyrosine feedback repression, enhance malonyl-CoA supply, and introduce exogenous proteins related to the resveratrol synthesis pathway, thus constructing a basic strain for resveratrol production. This strain was then subjected to ARTP mutagenesis to obtain a high-yield resveratrol strain. Further optimization of the fermentation process (ammonium ion concentration and phosphorus solubility in the fermentation broth) and the use of a specific oxygen consumption rate control strategy to further explore the product synthesis potential of this strain were conducted.
[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides a high-yield resveratrol-producing Yersinia lipolytica strain (Yersinia lipolytica). Yarrowia lipolytica The preservation number of the Yeast lipophila BS-3 is CGMCC No. 39118.
[0006] This invention provides the application of the above-mentioned Yersinia lipophila BS-3 in the preparation of microbial preparations for the production of resveratrol.
[0007] The present invention provides a microbial preparation for producing resveratrol, the microbial preparation comprising the above-mentioned Yersinia lipophila BS-3.
[0008] Optionally, the microbial preparation may also include excipients.
[0009] This invention provides the application of the above-mentioned Yeast BS-3 or the microbial preparation described above in the production of resveratrol.
[0010] The present invention provides a method for increasing resveratrol production, the method comprising the step of fermenting and culturing the above-mentioned Yeast BS-3.
[0011] Alternatively, during the fermentation process, ammonia water, glucose solution, potassium dihydrogen phosphate solution, and ammonium sulfate solution may be added.
[0012] Optionally, the fermentation culture has an aeration rate of 6 L / min, a stirring rate of 700-900 rpm, a pH of 5±0.1, a temperature of 30℃, a dissolved oxygen level of 20%, a tank pressure maintained at 0.04-0.05 MPa, and a specific oxygen consumption rate controlled between 1.5-3 mmol / g / h.
[0013] Optionally, when the glucose concentration in the culture medium used for fermentation is below 2 g / L, a glucose solution is added; the initial flow rate is 4 g / L / h, and the residual sugar concentration is controlled between 0.5 and 2 g / L. During the fermentation process, the concentration of dissolved phosphorus in the fermentation broth is maintained. Maintained between 200-400 mg / L; During the fermentation process, the concentration of ammonium ions in the fermentation broth is maintained between 3 and 6 g / L.
[0014] Optionally, the glucose solution contains 60% glucose by mass; the potassium dihydrogen phosphate solution contains 140 g / L potassium dihydrogen phosphate; and the ammonium sulfate solution contains 200 g / L ammonium sulfate.
[0015] As an additional method, the present invention provides a method for producing resveratrol, the method comprising the step of fermenting and culturing the above-mentioned Yeast lipophila BS-3.
[0016] Alternatively, during the fermentation process, ammonia water, glucose solution, potassium dihydrogen phosphate solution, and ammonium sulfate solution may be added.
[0017] Optionally, the fermentation culture has an aeration rate of 6 L / min, a stirring rate of 700-900 rpm, a pH of 5±0.1, a temperature of 30℃, a dissolved oxygen level of 20%, a tank pressure maintained at 0.04-0.05 MPa, and a specific oxygen consumption rate controlled between 1.5-3 mmol / g / h.
[0018] Optionally, when the glucose concentration in the fermentation broth is below 2 g / L, a glucose solution is added; the initial flow rate is 4 g / L / h, and the residual sugar concentration is controlled between 0.5 and 2 g / L. During the fermentation process, the concentration of dissolved phosphorus in the fermentation broth is maintained between 200-400 mg / L; During the fermentation process, the concentration of ammonium ions in the fermentation broth is maintained between 3 and 6 g / L.
[0019] Optionally, the glucose solution contains 60% glucose by mass; the potassium dihydrogen phosphate solution contains 140 g / L potassium dihydrogen phosphate; and the ammonium sulfate solution contains 200 g / L ammonium sulfate.
[0020] The present invention discloses the following technical effects: This invention selects Yersinia lipophila ( Yarrowia lipolytica Po1f was used as the chassis strain. Based on metabolic engineering, its metabolic pathway was modified using conventional genetic engineering techniques to enhance the synthesis of coumaric acid, eliminate feedback repression of tyrosine, enhance the supply of malonyl-CoA, and introduce exogenous proteins related to the resveratrol synthesis pathway. A basic strain for resveratrol production was constructed. Then, this strain was subjected to ARTP mutagenesis to obtain a high-yield resveratrol strain—Yersinia lipolytica. Yarrowia lipolytica BS-3. Subsequently, this invention optimized the fermentation process of this strain (optimization of ammonium ion concentration and soluble phosphorus concentration in the fermentation broth) and further explored the product synthesis potential of this strain by controlling the oxygen supply strategy through specific oxygen consumption rate. Results from specific embodiments of this invention show that, during the fermentation process of this invention, by controlling chemical parameters such as ammonium ion and soluble phosphorus concentrations in the fermentation environment and the physiological parameter of specific oxygen consumption rate, the resveratrol yield of this strain can reach 36.9 g / L, with a conversion rate of 5.9%. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 The results of the screening of batches of mutagenic strains; Figure 2 The results of the shake flask re-screening; Figure 3 OD of RS0 strain and mutant strain RS93 600 Among them, RS93 is Yersinia lipophila BS-3; Figure 4 The resveratrol yields of strain RS0 and mutant strain RS93 were measured; RS93 was Yersinia lipophila BS-3. Figure 5 OD of RS93 strain under different phosphorus solubility concentrations 600 ; Figure 6 To determine the resveratrol yield of strain RS93 under different phosphorus solubility concentrations; Figure 7 OD of RS93 strain under different ammonium ion concentrations 600 ; Figure 8 The resveratrol yield of strain RS93 under different ammonium ion concentrations was determined. Figure 9 OD of RS93 strain under different oxygen consumption rates 600 ; Figure 10 The resveratrol yield of RS93 strain under different oxygen consumption rates was determined. Detailed Implementation
[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0028] Unless otherwise specified, all examples were performed under standard experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or as recommended by the manufacturer's instructions.
[0029] Example 1: Construction of the starting strain using metabolic engineering methods Based on the construction method described in the reference "Engineering the oleaginous yeast Yarrowia lipolytica for high-level resveratrol production" (Sáez-Sáez J, Wang G, Marella ER, et al.Engineering the oleaginous yeast Yarrowia lipolytica for high-level resveratrol production[J]. Metabolic Engineering, 2020, 62: 51-61.), using Yarrowia lipolytica ( Yarrowia lipolytica Using strain Po1f as the starting host, through the introduction of Flavobacterium johnsonii (… Flavobacterium johnsoniae Tyrosine ammonia-lyase gene from () FjTAL genes), Arabidopsis thaliana ( Arabidopsis thaliana 4-CoA ligase gene from ( ) At4CLGenetics) and European grapes ( Vitis vinifera The resveratrol synthase gene from which the resveratrol synthase was derived ( VvVST1 Gene), and overexpress the feedback-resistant 3-deoxy-D-arabinohepenolate-7-phosphate synthase gene ( YlARO4 fbr Gene) and cladistic acid mutase gene ( YlARO7 fbr (Genes), to construct an engineered strain capable of synthesizing resveratrol, denoted as X1.
[0030] FjTAL
[0031] At4CL The nucleotide sequence of the gene is shown in SEQ ID NO.2, as follows:
[0032] VvVST1 The nucleotide sequence of the gene is shown in SEQ ID NO.3, as follows:
[0033] YlARO7 fbr The nucleotide sequence of the gene is shown in SEQ ID NO. 4 as follows: ATGGACTTCACTAAAGCCGACACCGTTCTGGATCTCGCCAACATCCGAGACTCGCTGGTCCGAATGGAGGACACTATTGTCTTCAATCTGATTGAGCGGGCTCAGTTCTGCCGTTCCGAGTTTGTGTACAAGGCCGGCAACTCGGACATTCCCGGCTTCAAGGGCTCTTACCTCGACTGGTTTCTGCAGGAGTCGGAAAAGGTGCACGCCAAACTGCGTCGGTACGCTGCCCCGGACGAGCAGGCCTTCTTCCCCGACGATCTACCCGAGGCCATTCTGCCCCCCATCGATTATGCGCCAATTCTGGCACCCTACAGCAAGGAGGTGAGCGTCAACGACGAGATTAAAAAGATTTACACCGACGACATTGTGCCCCTGGTGTGTGCTGGCACTGGAGATCAGCCCGAGAACTATGGGTCGGTCATGGTGTGCGACATCGAGACGCTGCAGGCGCTGTCGCGACGAATCCACTTTGGCAAGTTTGTGGCCGAGTCCAAGTTTCTGAGTGAAACCGAGCGATTCACCGAGCTCATCAAGAACAAGGACATTGCTGGTATTGAGGCGGCCATCACAAACTCCAAGGTGGAAGAGACGATTCTGGCCCGGCTGGGAGAAAAGGCACTGGCCTACGGCACAGACCCCACTCTCCGGTGGTCGCAGAGAACCCAGGGAAAGGTTGATTCCGAGGTTGTCAAGCGAATCTACAAGGAGTGGGTGATTCCACTCACCAAGAAGGTCGAGGTGGACTACCTGCTCCGGCGGTTGGAGTAG。
[0034] YlARO4 fbr The nucleotide sequence of the gene is shown in SEQ ID NO. 5 as follows:
[0035] Furthermore, based on the reference "Remodeling metabolism for high-level resveratrol production in..." Yarrowia lipolytica 》(Liu M, Wang C, Ren X, et al. Remodellingmetabolism for high-level resveratrol production in Yarrowia lipolytica The strategy disclosed in [J]. Bioresource Technology, 2022, 365: 128178., using the aforementioned X1 engineered strain as the starting strain, involves knocking out its diacylglycerol O-acyltransferase 1 gene ( DGA1 By using a gene to increase the supply of intracellular malonyl-CoA, a final engineered strain that produces high levels of resveratrol was constructed and named RS0.
[0036] DGA1 The nucleotide sequence of the gene is shown in SEQ ID NO.6, as follows:
[0037] The strains used in this embodiment are shown in Table 1.
[0038] Table 1. Details of the strains used in this embodiment. Example 2: ARTP Mutagenesis and Screening 1. Culture medium preparation YPD solid medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose and 20 g / L agar powder.
[0039] YPD seed culture medium: 10 g / L yeast extract, 20 g / L peptone and 20 g / L glucose.
[0040] YNB medium: ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, sodium chloride 0.1 g / L, calcium chloride 0.1 g / L, 1 mL micronutrient solution and 1 mL vitamin mixture.
[0041] Trace elements: boric acid 0.5 g / L, copper sulfate 0.04 g / L, potassium iodide 0.1 g / L, ferric chloride 0.2 g / L, manganese sulfate 0.4 g, sodium molybdate 0.2 g / L, and zinc sulfate 0.4 g / L.
[0042] Vitamin mixture: Biotin 2.0 mg / L, D-calcium pantothenate 0.4 g / L, folic acid 2.0 mg / L, inositol 2 g / L, niacin 0.4 g / L, para-aminobenzoic acid 0.2 g / L, vitamin B6 0.4 g / L, riboflavin 0.2 g / L and vitamin B1 0.4 g / L.
[0043] Shake flask fermentation medium (L): YNB medium containing 30 g glucose.
[0044] 2. Shake-flask fermentation test The glycerol tube culture of the engineered strain RS0 obtained in Example 1 was streaked onto YPD solid medium and cultured at 30°C for 48-60 h.
[0045] Three to five fresh single colonies were inoculated into 5 mL of YPD seed culture medium and incubated at 30°C and 220 rpm for 20 h. The inoculum was then transferred to 50 mL of shake flask fermentation medium at a 5% (v / v) inoculation rate and incubated at 30°C and 200 rpm for 72 h. At the end of fermentation, 0.9 g / L of resveratrol was detected. 3. ARTP mutagenesis and screening (1) Preparation of bacterial suspension: The engineered strain RS0, which was activated in YPD liquid medium, was transferred to 50 mL of YPD seed medium at an inoculation rate of 5% (v / v). The culture was carried out at 30℃ and 220 rpm until the logarithmic growth phase. After centrifugation at 6000 r / min for 5 min, the supernatant was discarded. The bacterial pellet was washed with sterile physiological saline and the OD of the bacterial suspension was adjusted. 600 The value is 0.6-0.8, for use in mutagenesis.
[0046] (2) Mutagenesis treatment procedure: Transfer 10 μL of bacterial culture onto a slide, slowly move the slide to the stage and fix it. Set the ARTP mutagenesis instrument operating parameters to 120 W processing power, 2 mm distance, 10 L / min carrier gas flow rate, and 15 s processing time. After treatment, wash off the bacterial cells, resuspend and dilute, and spread for culture.
[0047] (3) Orifice plate screening Single colonies that showed good growth on the selected solid culture medium were picked and cultured in 5 mL of YPD seed medium for 16-18 h. Then, an initial inoculum of 5% (v / v) was added to 1 mL of shake-flask fermentation medium and mixed thoroughly. 150 μL of this mixture was then transferred to a 96-well plate and cultured at 30℃ and 600 rpm for 72 h using a microbial growth curve analyzer. The fermentation broth after plate culture was extracted with 95% (v / v) ethanol and analyzed. A yield increase of over 20% compared to the engineered strain RS0 cultured in the same well plate was used as a screening indicator.
[0048] Taking the batches of mutant strains used in this invention as an example, the resveratrol yields of strains RS6, RS12, RS41, and RS93 were more than 20% higher than that of strain RS0. In particular, the yield of mutant strain RS93 was more than 45% higher (see...). Figure 1 ).
[0049] (4) Secondary screening by shaking flask Because the edge effect in the well plate environment causes differences in evaporation rate and temperature between the peripheral and central wells, further screening was carried out in shake flasks, with engineered strain RS0 as a control.
[0050] The four selected bacterial strains were activated on YPD solid plates, and then single colonies were picked and cultured overnight at 30℃ and 220 rpm for 20 h. Afterward, they were transferred to 50 mL shake flask fermentation medium at a 5% inoculum and cultured at 30℃ and 200 rpm for 72 h. Among them, strains RS6 and RS41 showed no difference from the engineered strain RS0 in shake flasks, while strain RS12 showed a 13.2% increase in yield, and strain RS93 showed a 29% increase in yield. Figure 2 ).
[0051] Therefore, RS93 was biopreserved and named *Yersinia lipophila*. Yarrowia lipolytica BS-3. This strain of Yersinia lipophila BS-3 was deposited on January 6, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 39118.
[0052] Example 3: Yeast Extraction Test in BS-3 Fermenter To further investigate the fermentation performance of Yersinia lipophila BS-3, a fed-batch fermentation test was conducted in a 5L fermenter.
[0053] 1. Culture medium preparation: Seed culture medium: 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.
[0054] Fermentation medium: YNB liquid medium containing 30g glucose.
[0055] 2. Fermentation culture in a fermenter: (1) Streak Yersinia lipophila BS-3 and engineered strain RS0 on YPD solid medium and incubate at 30℃ for 48-60 h.
[0056] (2) Inoculate 3-5 well-grown single colonies into 100 mL of seed culture medium and culture at 30℃ and 200 rpm for 20 h to obtain seed culture solution.
[0057] (3) Transfer all the seed culture obtained in step (2) to a 5 L fermenter containing 2 L of fermentation medium. The initial aeration rate is 2 L / min, the stirring rate is 200 rpm, the temperature is controlled at 30℃, and 25% ammonia water is automatically added to stabilize the pH at about 5±0.1 and maintain the dissolved oxygen at about 20%. The fermenter is stirred at 700-900 rpm, the maximum aeration rate is 6 L / min, and the tank pressure is maintained at 0.04-0.05 MPa. When the initial glucose consumption is below 2 g / L, that is, when the glucose in the culture medium used for fermentation is below 2 g / L, start adding 60% glucose feed at an initial feed rate of 4 g / L / h. With the glucose in the fermentation broth below 1 g / L as the indicator, the amount of glucose added is increased by 1 g / L / h each time, and the residual sugar concentration is controlled at 0.5-2 g / L. Fermentation is carried out continuously for 96 h. The fermentation results are as follows. Figures 3-4 As shown in Table 2.
[0058] Fermentation results showed that after 96 hours of fermentation in a Yersinia lipophila BS-3 fermenter, the highest yield of resveratrol reached 5.02 g / L, and the maximum biomass OD was [not specified]. 600The resveratrol yield reached 70.5%. Compared to the engineered strain RS0, the resveratrol yield increased by 20.5%, while the maximum biomass decreased by 17.7%. This indicates that the resveratrol synthesis capacity per cell and the total yield of Yersinia lipophila BS-3 were significantly improved.
[0059] Table 2. Comparison of fermentation performance of engineered strain RS0 and Yersinia lipophila BS-3 after 96 h of fermentation. Example 4 Fermentation Optimization To further improve the production capacity of Yersinia lipophila BS-3, this embodiment optimizes the fermentation process by controlling the concentration of dissolved phosphorus, the concentration of ammonium ions, and the specific oxygen consumption rate during fermentation.
[0060] 1. Optimization of phosphorus dissolution concentration control The seed culture medium was prepared and the fermenter process was controlled according to Example 3 (conditions and parameters were the same as in Example 3). The phosphorus solubility in the fermentation broth was controlled by adding a 140 g / L potassium dihydrogen phosphate solution. The phosphorus solubility concentration was controlled by detecting the phosphorus solubility concentration and adjusting the flow rate of the potassium dihydrogen phosphate solution. Four different concentration control schemes were established: Group 1: phosphorus solubility concentration maintained between 50-200 mg / L throughout; Group 2: phosphorus solubility concentration maintained between 200-400 mg / L throughout; Group 3: phosphorus solubility concentration maintained between 400-800 mg / L throughout; Group 4: phosphorus solubility concentration maintained between 800-1200 mg / L throughout. A control group was used without adding the 140 g / L potassium dihydrogen phosphate solution. The results are as follows: Figures 5-6 As shown in Table 3.
[0061] The results showed that the optimal phosphorus concentration during fermentation was 200-400 mg / L. At the end of fermentation, the resveratrol yield was 8.2 g / L. Further increasing the phosphorus concentration in the environment did not increase the yield further.
[0062] Table 3 Comparison of fermentation performance at different phosphorus concentrations 2. Optimization of ammonium ion concentration control Following the optimal phosphorus dissolution control in step "1. Optimization of Phosphorus Dissolution Concentration Control" and using the same fermenter process control, the fermentation cycle was extended to 168 h. The experiment controlled the ammonium ion level in the fermentation broth by adding 200 g / L ammonium sulfate solution. Ammonium ion concentration was controlled by detecting the ammonium ion level and controlling the flow rate of the ammonium sulfate solution. Simultaneously, 140 g / L potassium dihydrogen phosphate solution was added. During fermentation, the phosphorus dissolution concentration was controlled at 200-400 mg / L, and four different concentration control schemes were established: Group 1: ammonium ion concentration maintained between 1-3 g / L throughout; Group 2: ammonium ion concentration maintained between 3-6 g / L throughout; Group 3: ammonium ion concentration maintained between 6-10 g / L throughout; Group 4: ammonium ion concentration maintained between 10-15 g / L throughout. A control group without adding 200 g / L ammonium sulfate solution was used as a control. The ammonium ion level in the fermentation broth of the control group was <1. The results are as follows: Figures 7-8 As shown in Table 4.
[0063] The results showed that the optimal ammonia nitrogen concentration during fermentation was 3-6 g / L, and the resveratrol yield at the end of fermentation was 25.2 g / L.
[0064] Table 4 Comparison of fermentation performance under different ammonium ion concentrations 3. Optimization of specific oxygen consumption rate control After optimizing the concentrations of dissolved phosphorus and ammonium ions in the fermentation broth (steps "1. Optimization of Dissolved Phosphorus Concentration Control" and "2. Optimization of Ammonium Ion Concentration Control"), the dissolved oxygen (DO) could be maintained above 20% for the first 30 hours of fermentation. However, after 40 hours, the dissolved oxygen reading continuously dropped to 0%. For aerobic microorganisms like Yersinia lipolyticis, a sufficient oxygen supply plays a crucial role in their growth and product synthesis. To avoid excessive oxygen limitation due to low dissolved oxygen levels, which could inhibit the synthesis of the target product, the oxygen supply efficiency was adjusted by optimizing the specific oxygen consumption rate (QO2) of the cells after the dissolved oxygen dropped to 0. This strategy aims to regulate the metabolic oxygen consumption behavior of the microorganisms, enabling them to maintain high oxygen utilization efficiency even in low dissolved oxygen environments, thereby mitigating the adverse effects of oxygen limitation on product synthesis.
[0065] Under the optimal phosphorus dissolution concentration and ammonium ion concentration control conditions in step "2. Ammonium Ion Concentration Control Optimization", the specific oxygen consumption rate was controlled by monitoring the fermentation broth exhaust gas data, biomass during the process, and controlling the stirring speed and tank pressure (i.e., controlling it within the oxygen limit by adjusting stirring, aeration, and tank pressure). The specific oxygen consumption rate was at the following three levels: Group 1: After 40 hours of fermentation, the specific oxygen consumption rate was controlled between 0.5-1.5 mmol / g / h (i.e., the optimal ammonium ion concentration was 3-6 g / L per batch); Group 2: The specific oxygen consumption rate was maintained between 1.5-3 mmol / g / h throughout the process; Group 3: The specific oxygen consumption rate was maintained between 3-5 mmol / g / h throughout the process. The results are as follows: Figures 9-10 As shown in Table 5.
[0066] The results showed that the optimal specific oxygen consumption rate during fermentation was controlled at 1.5-3 mmol / g / h, and the resveratrol yield at the end of fermentation was 36.8.1 g / L, with a conversion rate of approximately 5.9%.
[0067] Table 5 Comparison of fermentation performance under different specific oxygen consumption rates The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A high-yield resveratrol-producing Yersinia lipolytica strain ( Yarrowia lipolytica BS-3, characterized in that, The preservation number of the Yersinia lipophila BS-3 is CGMCC No. 39118.
2. The use of Yersinia lipophila BS-3 as described in claim 1 in the preparation of microbial preparations for the production of resveratrol.
3. A microbial preparation for producing resveratrol, characterized in that, The microbial preparation includes the Yersinia lipophila BS-3 as described in claim 1.
4. The microbial preparation according to claim 3, characterized in that, The microbial preparation also includes excipients.
5. The use of the Yersinia lipophila BS-3 of claim 1 or the microbial preparation of claim 3 or 4 in the production of resveratrol.
6. A method for increasing resveratrol yield, characterized in that, The method includes the step of fermenting and culturing the Yersinia lipophila BS-3 as described in claim 1.
7. The method according to claim 6, characterized in that, During the fermentation process, ammonia water, glucose solution, potassium dihydrogen phosphate solution and ammonium sulfate solution are added.
8. The method according to claim 6, characterized in that, The fermentation culture was conducted with an aeration rate of 6 L / min, a stirring rate of 700-900 rpm, a pH of 5±0.1, a temperature of 30℃, a dissolved oxygen content of 20%, a tank pressure maintained at 0.04-0.05 MPa, and a specific oxygen consumption rate controlled between 1.5-3 mmol / g / h.
9. The method according to claim 7, characterized in that, When the glucose concentration in the culture medium used for fermentation is below 2 g / L, glucose solution is added; the initial flow rate is 4 g / L / h, and the residual sugar concentration is controlled between 0.5 and 2 g / L. During the fermentation process, the concentration of dissolved phosphorus in the fermentation broth is maintained between 200-400 mg / L; During the fermentation process, the concentration of ammonium ions in the fermentation broth is maintained between 3 and 6 g / L.
10. The method according to claim 7, characterized in that, The glucose solution contains 60% glucose by mass; the potassium dihydrogen phosphate solution contains 140 g / L potassium dihydrogen phosphate; and the ammonium sulfate solution contains 200 g / L ammonium sulfate.