Genetic transformation method of Chinese rose

By optimizing the culture medium and culture conditions, a genetic transformation system for the 'Carola' rose was established, solving the problems of difficult somatic embryo regeneration and low transformation rate, achieving efficient genetic transformation and gene introduction, and supporting molecular breeding research.

CN122012369APending Publication Date: 2026-05-12HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2026-01-29
Publication Date
2026-05-12

Smart Images

  • Figure CN122012369A_ABST
    Figure CN122012369A_ABST
Patent Text Reader

Abstract

The invention relates to a Chinese rose genetic transformation method, and belongs to the field of plant tissue culture. Specifically, the invention develops a genetic transformation method of the Chinese rose variety corola.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for genetic transformation of roses, belonging to the field of plant tissue culture. Background Technology

[0002] The rose (Rosa hybrida) is one of the most important ornamental plants worldwide, possessing extremely high economic and cultural value. Among them, the cut rose market is enormous, and 'Carola', as a classic global red cut rose variety, occupies a core position in the industry due to its beautiful flower shape, pure color, and long vase life. However, most commercial rose varieties are hybrids with complex genetic backgrounds. Their traditional breeding cycle is lengthy, and due to factors such as gene linkage, it is difficult to selectively introduce or improve specific traits (such as disease resistance, flower color, fragrance, and post-harvest life) through sexual hybridization while preserving the original excellent overall traits.

[0003] The development of modern molecular biology and genetic engineering technologies has provided a revolutionary approach to the targeted improvement of rose traits. Through genetic transformation techniques such as Agrobacterium-mediated transformation, exogenous target genes can be directly introduced into the plant genome, breaking down reproductive isolation barriers between species and achieving precise and efficient trait improvement. Therefore, establishing an efficient and stable genetic transformation system is a prerequisite and key to conducting rose gene function research and molecular breeding.

[0004] Although the establishment of genetic transformation systems has been reported in some rose varieties (such as 'Samantha' and 'Monthly Red', a few easily regenerated cultivars) both domestically and internationally, this technology exhibits significant genotype dependence. The efficiency of in vitro regeneration and genetic transformation of roses is heavily influenced by the genotype of the variety, and a mature system established for one variety is often difficult to directly apply to other varieties. Currently, for 'Carola,' a globally important commercial variety, there are no publicly available reports of a successfully established stable and efficient genetic transformation system. Technical bottlenecks such as difficulties in somatic embryo regeneration, low post-transformation screening, and low regeneration rates severely hinder gene function research and molecular design breeding progress for this variety.

[0005] Therefore, developing an efficient and reproducible genetic transformation system for the specific and important commercial genotype 'Carola', encompassing explant selection, sterilization, tissue culture seedling cultivation, callus induction, somatic embryo regeneration, Agrobacterium infection, co-culture, resistant bud screening, regeneration, and complete plant regeneration, has become a key technical challenge urgently needing breakthroughs in this field. The establishment of this system will not only provide an indispensable technical tool for elucidating the molecular mechanisms of 'Carola's' important agronomic traits, but also lay a solid foundation for directly utilizing genetic engineering technology to improve this variety and cultivate new and superior rose varieties with independent intellectual property rights. Summary of the Invention

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention provides a method for inducing somatic embryos of the 'Carola' rose variety, characterized by comprising the following steps:

[0008] i. Obtain tissue culture seedlings;

[0009] ii. Obtaining somatic embryos:

[0010] (1) Gently scratch the unexpanded leaflets at the top of the tissue culture seedling obtained in i, inoculate them onto the callus induction medium, and culture in the dark until callus tissue is obtained; the formula of the callus induction medium is: MS + 4.0 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel;

[0011] (2) The callus obtained in (1) is inoculated onto somatic embryo induction medium and cultured in the dark until somatic embryos are obtained; the somatic embryo induction medium is formulated as follows: MS + 1.0 mg / L 2,4-D + 0.1 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel.

[0012] In some implementation schemes, the method for obtaining tissue culture seedlings, i. above, is as follows:

[0013] (1) Cut healthy, uniformly growing current-year terminal branches into stem segments with 1-2 axillary buds. Disinfect them sequentially with 0.1% (w / v) carbendazim, 75% (v / v) alcohol, and 0.1% mercuric chloride. Rinse with sterile water, blot dry with sterile filter paper, and then inoculate them into bud initiation medium to obtain axillary buds induced from the stem segments. The bud initiation medium formula is: MS + 1.0 mg / L 6-BA + 0.01 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 7.5 g / L Agar.

[0014] (2) The axillary buds obtained in (1) are inoculated onto the tissue culture seedling proliferation medium and cultured to obtain tissue culture seedlings. The tissue culture seedling proliferation medium formula is: MS + 0.05 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar.

[0015] In some implementation schemes, the disinfection time for the 0.1% mercuric chloride solution is 18 minutes.

[0016] The present invention also provides a method for somatic embryo proliferation of the 'Carola' rose, characterized in that the somatic embryos obtained by the above method are inoculated onto a somatic embryo proliferation medium and cultured in the dark to proliferate the somatic embryos; the somatic embryo proliferation medium is formulated as follows: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel.

[0017] This invention also provides a tissue culture method for the 'Carola' rose, characterized by comprising the following steps:

[0018] (1) The somatic embryos obtained by the above method are inoculated onto the differentiation medium and cultured under light until the somatic embryos differentiate into adventitious buds; the formulation of the differentiation medium is: MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 30 g / L glucose + 3.0 g / L Phytagel;

[0019] (2) The somatic embryos that have differentiated into adventitious buds obtained in (1) are inoculated onto adventitious bud elongation medium and cultured under light strips until seedlings are obtained; the formula of the adventitious bud elongation medium is: MS + 0.5 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar;

[0020] (3) The seedlings obtained in (2) are inoculated onto the rooting medium and cultured under light until complete regenerated plants are obtained; the rooting medium formula is: 1 / 2MS + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar.

[0021] This invention also provides a method for genetic transformation of the 'Carola' rose, characterized by comprising the following steps:

[0022] (1) Infect the somatic embryos obtained by the above method with Agrobacterium tumefaciens carrying the target gene expression vector. The infected somatic embryos are inoculated onto a co-culture medium and cultured in the dark for 3 days. The co-culture medium formula is: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 100 μmol / L As + 30 g / L glucose + 3.0 g / L Phytagel.

[0023] (2) Inoculate the somatic embryos cultured in (1) onto the selection and screening medium and culture in the dark for 2-3 months; the selection and screening medium formula is: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L Phytagel;

[0024] (3) The somatic embryos cultured in (2) are inoculated onto selective germination medium and cultured under light until adventitious shoots differentiate; the selective germination medium formula is: MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L Phytagel;

[0025] (4) The somatic embryos cultured in (3) are inoculated onto the selective budding medium and cultured under light until the somatic embryos differentiate into seedlings; the selective budding medium formula is: MS + 0.5 mg / L 6-BA + 0.5 mg / L NAA + 50 mg / L Kan + 150 mg / L Cef + 30 g / L sucrose + 7.5 g / L Agar;

[0026] (5) Inoculate the seedlings cultured in (4) onto the rooting medium and culture them under light until complete positive plants are obtained; the rooting medium formula is: 1 / 2MS + 0.05 mg / L NAA + 25 mg / L Kan + 50 mg / L Cef + 30 g / L sucrose + 7.5 g / L Agar.

[0027] The advantages and beneficial effects of this invention are as follows: This invention successfully established a genetic transformation system for the rose variety 'Carola' through steps such as obtaining tissue culture seedlings of 'Carola', callus induction, and somatic embryo regeneration. Attached Figure Description

[0028] Figure 1 Results of callus formation in leaflets of 'Carola' tissue culture seedlings induced by different 2,4-D concentrations. (1) Callus state at 2,4-D concentration of 1.0 mg / L; (2) Callus state at 2.0 mg / L; (3) Callus state at 2.0 mg / L; (4) Callus state at 2.0 mg / L; (5) Callus state at 2.0 mg / L. Bars = 1.5 cm.

[0029] Figure 2 Toluidine blue staining results of paraffin sections of callus. a: Non-embryonic callus; b: Initial embryonic callus; c: Globular embryo.

[0030] Figure 3Results of 2,4-D induction of leaflet callus from 'Carola' tissue culture seedlings with different cytokinins. Callus state when (KT) 2,4-D was combined with KT; callus state when (ZT) 2,4-D was combined with ZT; callus state when (6-BA) 2,4-D was combined with 6-BA; callus state when (TDZ) 2,4-D was combined with TDZ. Bars = 1 cm.

[0031] Figure 4 Results of 2,4-D and different concentrations of KT inducing callus formation in leaflets of 'Carola' tissue culture seedlings. (A) Callus formation induced by 2,4-D and KT 0.05 mg / L; (B) Callus formation induced by 2,4-D and KT 0.1 mg / L; (C) Callus formation induced by 2,4-D and KT 0.2 mg / L. Bars = 1 cm.

[0032] Figure 5 Effects of different concentrations of TDZ and GA3 on adventitious shoots of 'Carola' somatic embryos. (1) 0.5 mg / L TDZ + 0.1 mg / L GA3; (2) 0.5 mg / L TDZ + 0.5 mg / L GA3; (3) 1.0 mg / L TDZ + 0.1 mg / L GA3; (4) 1.0 mg / L TDZ + 0.5 mg / L GA3. Bars = 1 cm.

[0033] Figure 6 Flowchart of 'Carola' somatic embryo germination into a complete plant. a: Somatic embryo; b: Somatic embryo turns green under light; cd: Somatic embryo differentiates into adventitious buds; e: Adventitious bud elongates; fg: Adventitious bud develops into seedling; h: Seedling rooting; i: Plant transplanting; j: Plant transplanted 4 weeks ago. Bars = 1 cm

[0034] Figure 7 Transform MYB X Genetically chromogenic 'Carola' somatic embryos. (A1-A6) Growth status of chromogenic somatic embryo #1; (B1-B6) Growth status of chromogenic somatic embryo #2; (C1-C6) Growth status of chromogenic somatic embryo #3. Bars = 1cm.

[0035] Figure 8 Morphology of the 4th chromogenic cell embryonic tissue mass from different perspectives. Bars = 1 cm.

[0036] Figure 9 PCR detection of transformed seedlings. Detailed Implementation

[0037] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well known to those skilled in the art.

[0039] Example

[0040] Example 1: Obtaining tissue culture seedlings

[0041] Although publicly available information (Liu Juan. Study on somatic embryo induction and genetic transformation of four rose varieties [D]. Huazhong Agricultural University, 2012) provides methods for obtaining 'Carola' tissue culture seedlings and inducing somatic embryos, genetic transformation was ultimately unsuccessful. This invention aims to further optimize the specific methods of each step based on this.

[0042] The inventors selected vigorous, uniformly growing terminal shoots with axillary buds. First, the shoots were cut into stem segments with 1-2 axillary buds each. These segments were then soaked in a 0.1% (w / v) carbendazim solution for 30 min, rinsed under running water for 1.5 h, and finally placed in a clean bench. They were then sequentially soaked in 75% (v / v) alcohol for 30 s, disinfected with 0.1% mercuric chloride for 12 min, and finally rinsed 3-5 times with sterile water, each rinse lasting 1 min. After blotting the surface moisture of the explants with sterile filter paper, they were inoculated into bud initiation medium. The bud initiation medium formula was: MS + 1.0 mg / L 6-BA + 0.01 mg / L NAA + 0.1 mg / L GA3, pH=5.8. This treatment involved inoculating 60 explants. One week later, all materials showed fungal contamination. Fungal hyphae appeared at the morphological upper part of the explants (the fungi appeared as flocculent), near the buds of the stem segments (the fungi appeared as flocculent), and on the surface of the explants in contact with the culture medium (the fungi appeared as flocculent and villous). Therefore, it was determined that the sterile seedling rate was 0% after sterilizing the stem segments with 0.1% mercuric chloride for 12 min.

[0043] To further optimize the disinfection protocol, the inventors used stem segments with buds from the 'Carola' cultivar as explants. They used 75% alcohol and 0.1% mercuric chloride as disinfectants for detoxification and tested the disinfection effect of 0.1% mercuric chloride at different disinfection times. After detoxification, the explants were inoculated into bud induction medium, which had the following formulation: MS + 1.0 mg / L 6-BA + 0.01 mg / L NAA + 7.5 g / L Agar + 0.1 mg / L GA3 + 30 g / L sucrose, pH=5.8. Each group was inoculated with 30-45 explants, with three replicates. After 4 weeks, the contamination rate, survival rate, and browning rate of the explants were recorded. Specific test results are shown in Table 1. The highest survival rate (87.58%) and lowest contamination rate (8.57%) were observed after 18 minutes of disinfection; the lowest browning rate (2.28%) was observed after 15 minutes of disinfection. With prolonged disinfection time, survival initially increased and then decreased; contamination initially decreased and then increased; and the browning rate consistently increased. The browning rate was 3.85% after 18 min of disinfection, which was higher than that after 15 min of disinfection, but there was no significant difference between them. Based on comprehensive analysis and comparison of the data, the 'Carola' stem segments showed the best disinfection effect after 18 min of disinfection with 0.1% mercuric chloride.

[0044]

[0045] Seedlings induced from the bud induction medium were inoculated onto a proliferation medium. Based on publicly available information, the inventors used a proliferation medium formulated as follows: MS + 1.0 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose, pH=5.8. 15-20 explants were inoculated, with three replicates. The proliferation coefficient was calculated after 4 weeks, and the plant growth status was recorded. The results showed that under these conditions, although the induced seedlings could proliferate, they were weak, stunted, and had slightly yellow leaves, exhibiting poor overall condition.

[0046] To avoid the impact of poor seedling condition on subsequent experiments, the inventors planned to improve seedling condition by adjusting the culture medium formula. First, the amount of 6-BA added was reduced from 1.0 mg / L to 0.5 mg / L, while other components remained unchanged. The testing method was the same as above. The results showed that seedlings under this medium had dark green leaves, were tall, and had a proliferation coefficient of 3.44, indicating a significant improvement in the overall seedling condition. Therefore, the optimal culture medium formula for the proliferation of 'Carola' tissue culture seedlings is MS + 0.5 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose. The obtained tissue culture seedlings were then rooted on rooting medium (1 / 2 MS + 0.05 mg / L NAA + 30 g / L sucrose) to obtain complete plants.

[0047] Example 2: Induction of callus and somatic embryos

[0048] Callus induction is a necessary step in genetic transformation systems. Based on publicly available information (Liu Juan. Research on somatic embryo induction and genetic transformation of four rose varieties [D]. Huazhong Agricultural University, 2012), the inventors gently scratched the terminal leaflets of the 'Carola' tissue culture seedlings obtained in Example 1 and inoculated them into an induction medium: MS + 2.0 mg / L ZT + 0.1 mg / L NAA + 30 g / L glucose + 2.5 g / L plant gel, inoculating a total of 50 leaflets. After culturing in the dark for 4 weeks, it was found that the callus tissue produced by the leaves had all undergone varying degrees of hardening and appeared white; continued culturing until the 8th week revealed that all callus tissue had hardened, dried up, and turned dark brown. Callus tissue in this state could not be further cultured, indicating that the actual effect of this method was poor.

[0049] The inventors experimented with changing the induction medium. The terminal leaflets of the 'Carola' tissue culture seedlings obtained in Example 1 were gently scratched and inoculated into MS medium containing different concentrations of 2,4-D (1.0, 2.0, 3.0, 4.0, 5.0 mg / L). After 4 weeks of dark culture, the callus induction rate was measured. Each treatment was inoculated with 30 explants, and the results were repeated three times. The test results showed that all five treatments effectively induced callus, with no significant difference in callus induction rate, indicating that the 2,4-D concentration had no significant effect on the induction rate. However, the state of the callus differed under different concentrations of 2,4-D. At concentrations of 1.0 mg / L and 2.0 mg / L, the callus clusters were small, dark white, and most of the callus was browned. At a concentration of 3.0 mg / L, the callus clusters were of medium size, dark white, and some of the callus was browned. At concentrations of 4.0 mg / L and 5.0 mg / L, the callus clusters were larger and pale white, with a small portion showing browning. Callus growth improved with increasing concentration, but the callus morphology was similar at 2,4-D concentrations of 4.0 mg / L and 5.0 mg / L (Table 2 and 5). Figure 1 ).

[0050]

[0051] The inventors further identified the embryogenicity of the obtained callus tissue by paraffin sectioning and toluidine blue staining. The results showed that the obtained callus tissue was composed of a large number of lightly stained, irregularly shaped thin-walled cells with loose cell arrangement, no directional differentiation trend, and a disordered cell accumulation state. Figure 2 (a) indicates that these cells lack embryogenicity and cannot be used further. Further method optimization is needed.

[0052] Published literature shows that there are significant differences in the types and concentrations of hormones required to obtain callus and somatic embryos among different rose varieties: the rose variety 'Tannic' can be induced to produce somatic embryos under conditions of 5.0 and 7.0 mg / L 2,4-D (Zhu Zhongfeng et al., 2022); 'Coral Babylonian Eyes' was successfully induced to produce somatic embryos in a medium containing 4.0 mg / L KT (Nie Shaohu, 2020); and the optimal conditions for inducing somatic embryos in 'Huang Heping' were a medium containing 1.2 mg / L TDZ (You Yang et al., 2012).

[0053] The applicant tested the callus-inducing effect of 'Carola' according to the formula in the aforementioned materials, with the types and concentrations of hormones tested shown in Table 3. The results showed that none of these hormones or combinations could produce embryogenic callus.

[0054]

[0055] The inventors further explored combining 2,4-D with other cytokinins to see if it could improve callus condition and ultimately yield somatic embryos. The terminal leaflets of 'Carola' tissue culture seedlings were gently scratched and inoculated into MS medium containing 4.0 mg / L and 0.1 mg / L of different cytokinins (6-BA, KT, ZT, TDZ). After 4 weeks of dark culture, the callus induction rate was assessed. Each treatment was inoculated with 30-36 explants, and the experiment was repeated three times. The results showed that all four treatments induced callus, with no significant difference in callus induction rate, but the growth status of callus induced by 2,4-D and different cytokinins differed. When 2,4-D is combined with KT, the callus mass is relatively large, of moderate firmness, and exhibits hairy roots; when 2,4-D is combined with ZT, the callus mass is of medium size, with some callus hardening; when 2,4-D is combined with 6-BA, the callus mass is relatively small, with most callus hardening; when 2,4-D is combined with TDZ, the callus mass is of medium size and of moderate firmness. The production of hairy roots in the callus indicates its ability to form roots, suggesting that the induced callus under the conditions of the 2,4-D and KT combination possesses embryogenic potential. Figure 3 (Table 4). Therefore, the optimal combination for inducing callus tissue in leaflets of 'Carola' tissue culture seedlings is 2,4-D and KT.

[0056]

[0057] Further testing was conducted to determine the optimal combination of KT and 2,4-D concentrations. Leaflets of 'Carola' tissue culture seedlings were gently scratched and inoculated into MS medium containing 4.0 mg / L 2,4-D and different concentrations of KT (0.05, 0.1, and 0.2 mg / L). After 4 weeks of dark culture, callus induction rate was recorded. Each treatment was inoculated with 30-36 explants, and the experiment was repeated three times. All three treatments induced callus, with no significant difference in callus induction rate, indicating that 2,4-D and different KT concentrations had no significant effect on callus induction. However, the growth state of callus induced by 2,4-D and different cytokinins differed. The callus mass was larger and of moderate firmness when 2,4-D was combined with 0.05 mg / L KT; the callus mass was of medium size and some callus hardened when 2,4-D was combined with 0.1 mg / L and 0.2 mg / L KT. Compared with callus induced by auxin 2,4-D 4.0 mg / L alone, callus induced by 2,4-D 4.0 mg / L and KT 0.05 mg / L showed no browning and exhibited better growth (Table 5). Figure 4Therefore, the combination of 4.0 mg / L 2,4-D and 0.05 mg / L KT yields the best-quality callus tissue. Unfortunately, however, this combination still cannot produce somatic embryos.

[0058]

[0059] The inventors further experimented by increasing the KT concentration while simultaneously decreasing the 2,4-D concentration to test whether somatic embryos could be induced. Callus tissue induced by 'Carola' was seeded into MS medium containing 2,4-D (1.0, 2.0 mg / L) and KT (0.1, 0.2, 0.5, 1.0 mg / L), and cultured in the dark for 4 weeks before the somatic embryo induction rate was calculated. Each treatment was seeded with 12-15 explants, and the experiment was repeated three times. It was found that in MS medium containing 1.0 mg / L 2,4-D and 0.1 mg / L KT, relatively smaller, more densely packed, and more deeply stained cells were observed, and localized cytoplasmic condensation was also observed, indicating the formation of embryogenic cell masses. Figure 2 b). Further culturing revealed that the cells were regular spherical, uniformly and tightly packed, of the same size, without organoid primordia differentiation, and formed solid spherical cell clusters. Figure 2 c) indicates successful somatic embryo induction. The somatic embryo induction rate was calculated to be 3 / 48 × 100% = 6.25%. Meanwhile, no somatic embryos were produced under treatment with other concentrations of 2,4-D and KT. This indicates that after callus induction, somatic embryos of 'Carola' could be successfully obtained using MS medium containing 1.0 mg / L 2,4-D and 0.1 mg / L KT.

[0060] Example 3: Proliferation of Somatic Embryos

[0061] The inventors further cultured the obtained somatic embryos and tested their proliferation effect. The obtained somatic embryos were inoculated into MS medium containing 2,4-D (0.5, 1.0 mg / L) and KT (0.05, 0.1 mg / L), with 12-15 explants inoculated for each treatment. The experiment was repeated four times. Since somatic embryo proliferation in Rosa species (including other rose varieties) typically requires light conditions, the inventors cultured the above-mentioned somatic embryos under light for four weeks. The results showed that the somatic embryos readily turned green, and 56.25% differentiated into adventitious buds. This premature differentiation of the somatic embryos led to proliferation failure, thus affecting subsequent Agrobacterium infection, indicating that light culture is unsuitable for the proliferation of 'Carola' somatic embryos.

[0062] The inventors then cultured somatic embryos on MS medium containing different concentrations of 2,4-D and KT under dark conditions for 4 weeks and calculated the somatic embryo proliferation coefficients. The results are shown in Table 6. Dark conditions were more suitable for the proliferation of 'Carola' somatic embryos. There was no significant difference in the somatic embryo proliferation coefficients among different combinations of 2,4-D and KT. Therefore, 0.5 mg / L~1.0 mg / L 2,4-D + 0.05 mg / L~0.1 mg / L KT are all suitable for somatic embryo proliferation, with 0.5 mg / L 2,4-D + 0.05 mg / L KT showing the best effect.

[0063]

[0064] Example 4: Differentiation and Rooting of Somatic Embryos

[0065] To differentiate the obtained somatic embryos into adventitious shoots, the inventors inoculated the somatic embryos into MS medium containing 0.01 mg / L NAA and different concentrations of TDZ+GA3 and cultured them under light for 4 weeks. The adventitious shoot differentiation effect was observed, and the rate of differentiation was calculated. Each treatment was inoculated with 15 explants, and the results were repeated 4 times. The results are shown in [Figure number missing]. Figure 5 Table 7. When TDZ was at a level of 0.5 mg / L, as the concentration of GA3 increased, the adventitious bud differentiation rate decreased, the bud length shortened, and the number of buds produced per explant increased. When TDZ was at a level of 1.0 mg / L, as the concentration of GA3 increased, the adventitious bud differentiation rate increased, the bud length shortened, and the number of buds produced per explant increased. When GA3 was at a level of 0.1 mg / L, as the concentration of TDZ increased, the adventitious bud differentiation rate decreased, the bud length length increased, and the number of buds produced per explant decreased. When GA3 was at a level of 0.5 mg / L, as the concentration of TDZ increased, the adventitious bud differentiation rate increased, the bud length length increased, and the number of buds produced per explant increased. Range and variance analyses showed that changes in GA3 had a more significant impact than changes in TDZ, and changes in GA3 had a more significant impact on the adventitious bud differentiation rate than on bud length and the number of buds produced per explant. At a concentration of 1.0 mg / L TDZ + 0.5 mg / L... The highest adventitious shoot differentiation rate and the largest number of shoots per explant were observed on GA3 medium. Although the shoot length was 0.65 cm in the 1.0 mg / L TDZ + 0.1 mg / L GA3 medium, which was longer than the 0.53 cm in the 1.0 mg / L TDZ + 0.5 mg / L GA3 medium, the difference was not significant. In conclusion, the combination of 1.0 mg / L TDZ + 0.5 mg / L GA3 was optimal for the differentiation of adventitious shoots from somatic embryos.

[0066]

[0067] Somatic embryos that had differentiated adventitious buds were inoculated into MS medium supplemented with 0.5 mg / L 6-BA, 0.05 mg / L NAA, 30 g / L sucrose, and 7.5 g / L Agar. After 4 weeks of culture under light, the adventitious buds elongated. Cultured on this medium for another 4 weeks, the adventitious buds further differentiated into seedlings. The seedlings were then inoculated into rooting medium (1 / 2 MS medium supplemented with 0.05 mg / L NAA, 30 g / L sucrose, and 7.5 g / L Agar). After 4 weeks of culture under light, the seedlings rooted, yielding complete regenerated plants.

[0068] Using the method established above, it is possible to achieve the germination of a complete plant from a somatic embryo. Figure 6 ).

[0069] Example 5: Establishment and optimization of genetic transformation system

[0070] Somatic embryos of 'Carola' that are growing vigorously on proliferation medium were selected as recipient materials for genetic transformation, and the anthocyanin-visible marker gene MYB was used. X Using (NCBI: KC335202.1) as the reporter gene and the kanamycin resistance gene as the selection marker gene, an attempt was made to establish an Agrobacterium-mediated genetic transformation system based on the above somatic embryo regeneration system. The specific method was as follows: Agrobacterium culture carrying 35S::MYBx (OD) was used... 600 =0.6) Infect somatic embryos. After 40 min of infection, transfer to co-culture medium MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 100 μmol / L As + 30 g / L glucose + 3.0 g / L plant gel. After 3 days of co-culture, transfer to selection medium MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L plant gel. After 2-3 months of selection culture, transfer to selection germination medium MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L plant gel. Inoculate 12 somatic embryo tissue masses into each dish, for a total of 4 dishes. The selected somatic embryonic tissue masses ranged in diameter from 0.3 to 0.5 cm, and a total of 48 somatic embryonic tissue masses were infected. Based on the staining results, the genetic transformation efficiency was preliminarily calculated.

[0071] After approximately 14 days of dark culture in selective proliferation medium, a small portion of somatic embryonic tissue masses showed browning, while others exhibited antibacterial activity. Replacing the medium with fresh medium and removing the browned tissue allowed the somatic embryonic tissue masses to proliferate normally. After a two-month selection phase using 80 mg / L Kan, the cells were transferred to a light germination phase. Two months into the selection germination phase, four somatic embryonic tissue masses turned red. These colored tissues initially appeared bright red, but with continued anthocyanin accumulation, the color gradually deepened, slowly turning purplish-red or even purplish-black. Figure 7 Among them, the fourth chromoplast cell embryonic tissue mass showed the fastest growth, and has already produced purplish-red adventitious buds and red roots on the selective germination medium. Figure 8 Based on the color development, the positive rate was 8.3%.

[0072] Tissue clusters that have differentiated into adventitious buds were inoculated into a selected bud-strengthening medium: MS + 0.5 mg / L 6-BA + 0.5 mg / L NAA + 50 mg / L Kan + 150 mg / L Cef + 30 g / L sucrose + 7.5 g / L Agar. The culture was carried out under light for 2-4 months, and the adventitious buds further differentiated into seedlings.

[0073] Seedlings were inoculated into a medium containing 1 / 2 MS, 0.05 mg / L NAA, 25 mg / L Kan, 50 mg / L Cef, 30 g / L sucrose, and 7.5 g / L Agar. The plants were cultured under light for 4-8 weeks until they rooted, resulting in complete transgenic plants.

[0074] Genomic DNA was extracted from transgenic materials using the 2×CTAB method. Wild-type rose 'Carola' genomic DNA was used as a negative control template, and PCR was performed to detect positive results in the transgenic materials. The reaction program was as follows: pre-denaturation: 95℃, 3 min; denaturation: 95℃, 30 s (35 cycles); annealing: 58℃, 30 s (35 cycles); extension: 72℃, 1 min (35 cycles); complete extension: 72℃, 10 min. Primers: MYB X -F(CGGGATCCATGAAGCCAGATTTTAGTGAGATGT),MYB X -R(GCGTCGACTCATTCAAAATTCCAAAAGTTCAAGT), product 714 bp. See results below. Figure 9 All transformed genetically modified materials showed positive results, indicating that the exogenous gene was successfully transferred into the plant.

[0075] In publicly available information (Liu Juan. Study on somatic embryo induction and genetic transformation of four rose varieties [D]. Huazhong Agricultural University, 2012), the genetic transformation system for 'Carola' was not successfully established. When using Agrobacterium, the transient expression rate of GUS was extremely low after 40 min of infection and 3 days of co-culture, and the somatic embryos showed extremely poor growth on the germination medium, turning brown and dying. However, the somatic embryo tissue masses carrying the reporter gene in this invention showed good growth on the germination medium, without browning or death, and gradually differentiated into red adventitious roots and buds, indicating that this invention successfully established the genetic transformation system for 'Carola'.

[0076] The complete process of the genetic transformation system for 'Carola' established in this invention is as follows:

[0077] 1. Obtaining tissue culture seedlings:

[0078] (1) Select vigorous, uniformly growing terminal shoots with axillary buds. Cut the shoots into stem segments with 1-2 axillary buds, soak them in 0.1% (w / v) carbendazim solution for 30 min, then rinse the stem segments under running water for 1.5 h, and finally place them in a clean bench. Soak them in 75% (v / v) alcohol for 30 s, disinfect them with 0.1% mercuric chloride for 18 min, and finally rinse them with sterile water 3-5 times, 1 min each time. After drying the surface of the explants with sterile filter paper, inoculate them into bud initiation medium with the following formula: MS + 1.0 mg / L 6-BA + 0.01 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 7.5 g / L Agar to obtain axillary buds induced from the stem segments.

[0079] (2) Axillary buds are inoculated into tissue culture seedling proliferation medium with the following formula: MS + 0.05 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar, which can produce sterile tissue culture seedlings.

[0080] 2. Obtaining somatic embryos:

[0081] (1) Gently scratch the small, unexpanded leaves at the top of the tissue culture seedlings and inoculate them onto the callus induction medium. The formula is: MS + 4.0 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel. Culture in the dark for 4 weeks to obtain callus tissue.

[0082] (2) The callus tissue was inoculated onto somatic embryo induction medium with the following formula: MS + 1.0 mg / L 2,4-D + 0.1 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel. The medium was cultured in the dark for 4 weeks to obtain somatic embryos.

[0083] (3) Somatic embryos were inoculated onto somatic embryo proliferation medium with the following formula: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel. The somatic embryos could proliferate continuously under dark conditions.

[0084] 3. Differentiation and rooting of somatic embryos:

[0085] (1) The somatic embryos from step 1 were inoculated onto differentiation medium with the following formula: MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 30 g / L glucose + 3.0 g / L Phytagel. The medium was cultured under light for 4 weeks, and the somatic embryos differentiated into adventitious buds.

[0086] (2) Somatic embryos that have differentiated into adventitious buds were inoculated into MS medium containing 0.5 mg / L 6-BA, 0.05 mg / L NAA, 30 g / L sucrose, and 7.5 g / L Agar. After culturing under light for 4 weeks, the adventitious buds elongated. After culturing on this medium for another 4 weeks, the adventitious buds further differentiated into seedlings.

[0087] (3) Inoculate the seedlings onto the rooting medium with the following formula: 1 / 2MS + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar. Cultivate the seedlings under light for 4 weeks until they root and complete regenerated plants are obtained.

[0088] 4. Genetic transformation:

[0089] (1) Agrobacterium bacterial suspension carrying the expression vector of the target gene and kanamycin resistance gene was used to infect the somatic embryos in step 1. The bacterial suspension concentration was OD 600 The value was 0.6. The cells were infected at 28℃ for 40 min, and then the somatic embryos were transferred to co-culture medium with the following formula: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 100 μmol / L As + 30 g / L glucose + 3.0 g / L Phytagel. The cells were co-cultured in the dark for 3 days.

[0090] (2) After co-culturing for 3 days, the somatic embryos were transferred to the selection and screening medium with the following formula: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L Phytagel. The selection and screening culture was carried out in the dark for 2-3 months.

[0091] (3) After culturing for 2-3 months, the transformed somatic embryos were transferred to selective germination medium: MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L Phytagel, and cultured for 2 months under light conditions.

[0092] (4) Inoculate the tissue mass that has differentiated into adventitious buds into the selected bud-strengthening medium: MS + 0.5 mg / L 6-BA + 0.5 mg / L NAA + 50 mg / L Kan + 150 mg / L Cef + 30 g / L sucrose + 7.5 g / L Agar, and culture under light for 2-4 months. The adventitious buds will further differentiate into seedlings.

[0093] (5) Inoculate the seedlings onto 1 / 2MS medium containing 0.05 mg / L NAA, 25 mg / L Kan, 50 mg / L Cef, 30 g / L sucrose, and 7.5 g / L Agar. Culture under light for 4-8 weeks until the plants take root and complete positive plants are obtained.

[0094] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for inducing somatic embryos in the 'Carola' rose variety, characterized in that, Includes the following steps: i. Obtain tissue culture seedlings; ii. Obtaining somatic embryos: (1) Gently scratch the unexpanded leaflets at the top of the tissue culture seedling obtained in i, inoculate them onto the callus induction medium, and culture in the dark until callus tissue is obtained; the formula of the callus induction medium is: MS + 4.0 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel; (2) The callus obtained in (1) is inoculated onto somatic embryo induction medium and cultured in the dark until somatic embryos are obtained; the somatic embryo induction medium is formulated as follows: MS + 1.0 mg / L 2,4-D + 0.1 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel.

2. The method according to claim 1, characterized in that, The method for obtaining tissue culture seedlings, i. is as follows: (1) Cut healthy, uniformly growing current-year terminal branches into stem segments with 1-2 axillary buds. Disinfect them sequentially with 0.1% (w / v) carbendazim, 75% (v / v) alcohol, and 0.1% mercuric chloride. Rinse with sterile water, blot dry with sterile filter paper, and then inoculate them into bud initiation medium to obtain axillary buds induced from the stem segments. The bud initiation medium formula is: MS + 1.0 mg / L 6-BA + 0.01 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 7.5 g / L Agar. (2) The axillary buds obtained in (1) are inoculated onto the tissue culture seedling proliferation medium and cultured to obtain tissue culture seedlings. The tissue culture seedling proliferation medium formula is: MS + 0.05 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar.

3. The method according to claim 2, characterized in that, The disinfection time for the 0.1% mercuric chloride solution is 18 minutes.

4. A method for somatic embryo proliferation of the 'Carola' rose variety, characterized in that, The somatic embryos obtained by the method according to any one of claims 1-3 are inoculated onto somatic embryo proliferation medium and cultured in the dark to proliferate the somatic embryos; the somatic embryo proliferation medium is formulated as follows: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L Phytagel.

5. A method for tissue culture of the 'Carola' rose, characterized in that, Includes the following steps: (1) The somatic embryos obtained by the method of any one of claims 1-4 are inoculated onto a differentiation medium and cultured under light until the somatic embryos differentiate into adventitious buds; the formulation of the differentiation medium is: MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 30 g / L glucose + 3.0 g / L Phytagel; (2) The somatic embryos that have differentiated into adventitious buds obtained in (1) are inoculated onto adventitious bud elongation medium and cultured under light strips until seedlings are obtained; the formula of the adventitious bud elongation medium is: MS + 0.5 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar; (3) The seedlings obtained in (2) are inoculated onto the rooting medium and cultured under light until complete regenerated plants are obtained; the rooting medium formula is: 1 / 2MS + 0.05 mg / L NAA + 30 g / L sucrose + 7.5 g / L Agar.

6. A method for genetic transformation of the 'Carola' rose variety, characterized in that, Includes the following steps: (1) Infect the somatic embryos obtained by the method according to any one of claims 1-4 with Agrobacterium bacterial suspension carrying the target gene expression vector, and inoculate the infected somatic embryos onto a co-culture medium and culture in the dark for 3 days; the co-culture medium formula is: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 100 μmol / L As + 30 g / L glucose + 3.0 g / L Phytagel; (2) Inoculate the somatic embryos cultured in (1) onto the selection and screening medium and culture in the dark for 2-3 months; the selection and screening medium formula is: MS + 0.5 mg / L 2,4-D + 0.05 mg / L KT + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L Phytagel; (3) The somatic embryos cultured in (2) are inoculated onto selective germination medium and cultured under light until adventitious shoots differentiate; the selective germination medium formula is: MS + 1.0 mg / L TDZ + 0.5 mg / L GA3 + 0.01 mg / L NAA + 80 mg / L Kan + 300 mg / L Cef + 30 g / L glucose + 3.0 g / L Phytagel; (4) The somatic embryos cultured in (3) are inoculated onto the selected budding medium and cultured under light until the somatic embryos differentiate into seedlings; the selected budding medium formula is: MS + 0.5 mg / L 6-BA + 0.5 mg / L NAA + 50 mg / L Kan + 150 mg / L Cef + 30 g / L sucrose + 7.5 g / L Agar; (5) Inoculate the seedlings cultured in (4) onto the rooting medium and culture under light until complete positive plants are obtained; the rooting medium formula is: 1 / 2MS + 0.05 mg / L NAA + 25 mg / L Kan + 50 mg / L Cef + 30 g / L sucrose + 7.5 g / L Gar.