II type herpes simplex virus strain HSV-2 / KM-1 and application thereof
By providing HSV-2/KM-1 virus strains, the problem of the lack of effective evaluation tools in existing technologies has been solved, a genital herpes model and vaccine evaluation system have been established, and effective evaluation and optimization of HSV-2 vaccines have been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
- Filing Date
- 2026-04-14
- Publication Date
- 2026-05-12
AI Technical Summary
In the current HSV-2 vaccine development process, relying solely on laboratory-preserved strains is insufficient to address naturally infected wild HSV-2 strains, and the lack of effective evaluation tools poses challenges to vaccine development.
A type II herpes simplex virus strain, HSV-2/KM-1, was provided and identified by gene sequencing, PCR, and immunofluorescence analysis. It is used to establish genital herpes models and evaluate vaccines. It exhibits cell tropism and tends to infect genital epithelial cells. It can provide a long duration of infection and deliver high viral titers at low MOI levels. It is suitable for studying viral load and immune response in mouse and guinea pig models.
HSV-2/KM-1 exhibits high viral load and immune response characteristics in genital herpes models, enabling effective assessment of vaccine protection and providing an evaluation tool that more closely approximates natural infection, thus helping to optimize vaccine development.
Smart Images
Figure CN122012419A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of viral and microbial technology, specifically relating to a type II herpes simplex virus strain HSV-2 / KM-1 and its applications. Background Technology
[0002] Herpes simplex virus type 2 (HSV-2) belongs to the genus Herpes simplex virus in the subfamily Alphaherpesvirinae of the family Herpesviridae. It is an enveloped double-stranded DNA virus with a genome length of approximately 152 kb. HSV-2 is the main cause of genital herpes, and its infection rate is increasing year by year. Harfouche et al. reported in 2025 that the total number of infections in 2020 accounted for 13.3% of the world's population.
[0003] Vaccines are the most economical and effective means of preventing genital herpes. Among vaccines that have entered clinical trials, BNT163 is a trivalent mRNA vaccine containing gC2-gD2-gE2 encapsulated in lipid nanoparticles. While its Phase I clinical trial is not yet complete, based on results from animal models, it is considered the closest to an ideal vaccine. However, before a vaccine can be truly put into use, it will inevitably face testing against wild-type HSV-2 strains. Therefore, relying solely on limited laboratory-preserved strains (such as HG52) is insufficient for vaccine development; new clinical isolates reflecting natural infection are an indispensable evaluation tool in vaccine research and development. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a type II herpes simplex virus strain HSV-2 / KM-1 and its applications.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a type II herpes simplex virus strain HSV-2 / KM-1, which was deposited at the China Center for Type Culture Collection on July 25, 2025, with accession number CCTCCNO: V202550, and classified as herpes simplex virus type 2 HSV-2 / KM-1 Human alphaherpesvirus 2.
[0006] The second aspect of this invention provides the application of the aforementioned type II herpes simplex virus strain HSV-2 / KM-1 in establishing a genital herpes model.
[0007] Furthermore, the model is either the Hartley guinea pig genital herpes model or the BALB / c mouse genital herpes model.
[0008] A third aspect of the present invention provides the application of the aforementioned type II herpes simplex virus strain HSV-2 / KM-1 in vaccine evaluation.
[0009] This invention isolated a virus from a herpes simplex virus sample on the right buttock of a patient. Through gene sequencing, PCR, immunofluorescence, and transmission electron microscopy morphological analysis, the virus was identified as type II herpes simplex virus and named HSV-2 / KM-1. Transmission electron microscopy, immunofluorescence, PCR, and gene sequencing analysis confirmed that the isolated virus was a spherical enveloped virus with a wavelength of 100-127 nm. The HSV-2-specific gG2 antibody recognized only this virus, and its gene sequence completely matched that of HSV-2, confirming the isolation of a single HSV-2 virus strain.
[0010] The whole genome comparison of the HSV-2 / KM-1 type II herpes simplex virus strain of this invention with the 99 most genetically similar viruses in the GenBank database and the only other HSV-2 strain from China, HJ12, in the database revealed that, in terms of distribution countries, HSV-2 / KM-1 has the highest overall similarity to the HSV-2 strains in the United States. In terms of evolution, the closest evolutionary relationships to HSV-2 / KM-1 are the US MH790606 HSV-2 strain 2015-27216 and PP099973 HSV-2 isolate 136.
[0011] This invention selected two viruses most closely related to HSV-2 / KM-1 (strains 2015-27216 and 136) and the only HSV-2 clinical isolate in China other than HSV-2 / KM-1 (MN187895 HSV-2 isolate HJ12) for genomic substitution analysis to obtain more specific pathogenic characteristics of HSV-2 / KM-1 at the protein level. Compared with strain 136, HSV-2 / KM-1 had 27 amino acid substitutions, compared with strain 2015-27216 had 24 amino acid substitutions, but compared with strain HJ12, it had 127 amino acid substitutions. This is consistent with the phylogenetic analysis results; the differences between HSV-2 / KM-1 and strains 136 and 2015-27216 are much smaller than those of HJ12. These results indicate that HSV-2 / KM-1 is more closely related to the US strain. Compared to strain 136, most mutations in HSV-2 / KM-1 occurred in the ICP4, UL52, and UL36 proteins (amino acid substitutions of more than three residues). Among them, there were 13 conserved amino acid substitutions and 14 involving polarity changes.
[0012] Compared with the prior art, the beneficial effects of this invention are as follows: The herpes simplex virus strain HSV-2 / KM-1 of this invention exhibits cell tropism and tends to infect genital epithelial cells. Under the same multiplicity of infection (MOI) inoculation conditions, among three cell lines—human non-small cell lung cancer cell line A549, human bronchial epithelial cell line Beas-2B, and human foreskin fibroblast cell line HFF-1—HFF-1 cells showed the fastest cytopathic effect, as viral protein expression was detected first in HFF-1 cells. Furthermore, the degree of gG glycoprotein glycosylation was significantly higher in HFF-1 cells than in the other two cell lines.
[0013] The HSV-2 / KM-1 type II herpes simplex virus strain of this invention yielded higher viral titers under conditions of lower MOI and longer infection duration. The highest viral titers were observed in the culture supernatants at 48, 60, and 72 hours of infection, respectively, when the MOIs were 0.1, 0.01, and 0.001, reaching 5.1 lgTCID. 50 / mL, 6.5 lgTCID 50 / mL and 7.0 lgTCID 50 / mL, providing a reference value for subsequent studies.
[0014] This invention is the first to apply HSV-2 / KM-1 to the detection of neutralizing antibodies in mouse serum, revealing its instrumental role in the evaluation of vaccine immunogenicity.
[0015] In the Hartley guinea pig genital herpes model, the median lethal dose (LD50) of HSV-2 / KM-1 was 4.1 × 10⁻⁶. 4 PFU / animal and a significantly higher viral load was detected in the dorsal root ganglion (DRG) than in the vagina and bladder, indicating the neurophagocytic nature of HSV-2 / KM-1. This model provides a tool for evaluating vaccine efficacy and demonstrates the potential of HSV-2 / KM-1 in vaccine evaluation applications.
[0016] In the BALB / c mouse genital herpes model, the median lethal dose (LD50) of HSV-2 / KM-1 was 4.7 × 10⁻⁶. 2 PFU / animal; viral load in the dorsal root ganglia and vagina was higher than in the bladder and uterus; cytokine detection showed significant immunosuppression; and viral copies were detected in whole blood, indicating viremia. This model, together with the guinea pig model, provides a tool for evaluating vaccine protective efficacy, demonstrating the potential of HSV-2 / KM-1 in vaccine evaluation applications. Attached Figure Description
[0017] Figure 1 This is an electron microscope image of virus particles isolated in Example 1 of the present invention; Figure 2This is the phylogenetic tree of HSV-2 / KM-1 evolutionary analysis in Example 1 of the present invention; Figure 3 This diagram illustrates the replication of the isolate from Example 2 of this invention in three cell lines; where A1, B1, and C1 represent the pathological changes in A549, BEAS-2B, and HFF-1 cells at different infection time points, respectively; and A2, B2, and C2 represent the protein expression of the isolate from A549, BEAS-2B, and HFF-1 cells at different infection time points, respectively. Figure 4 The results show the basic characteristics of HSV-2 / KM-1 as a research tool; where A is the one-step growth curve for HSV-2 / KM-1 replication ability analysis; and B is the instrumental test results of the neutralization test of HSV-2 / KM-1. Figure 5 This presents the results of establishing a guinea pig genital herpes model based on HSV-2 / KM-1 in this invention. A represents the changes in the weight gain rate of guinea pigs in the high, medium, and low dose groups and the negative control group over seven days; B represents the changes in the genital lesion scores of guinea pigs in the high, medium, and low dose groups and the negative control group over seven days; C represents the changes in the survival rate of guinea pigs infected with different challenge doses in the five groups in the LD50 assay test after fourteen days; D represents the viral shedding from the vagina of guinea pigs in the high, medium, and low dose groups and the negative control group over seven days; E, F, G, and H represent the viral load in the vagina, bladder, brain, and dorsal root ganglia of guinea pigs in the high, medium, and low dose groups and the negative control group on the seventh day, respectively; I represents the serum binding antibody titer of guinea pigs in the high, medium, and low dose groups and the negative control group on the seventh day; J and K represent the IL-4 and IL-10 levels in the spleen cell stimulation supernatant of guinea pigs in the high, medium, and low dose groups and the negative control group on the seventh day, respectively. Figure 6 This invention presents the results of establishing a genital herpes model in BALB / c mice based on HSV-2 / KM-1. A shows the changes in body weight gain of BALB / c mice in the high, medium, and low dose groups and the negative control over seven days; B shows the changes in genital lesion scores of BALB / c mice in the high, medium, and low dose groups and the negative control over seven days; C shows the changes in survival rate of BALB / c mice infected with different challenge doses in the five groups in the LD50 assay over fourteen days; D shows the survival rate of BALB / c mice infected with different challenge doses in the high, medium, and low dose groups and the negative control over seven days. The viral shedding was measured in the following values: E, F, G, and H represent the viral load in the dorsal root ganglia, vagina, bladder, and uterus of BALB / c mice in the high, medium, and low dose groups and the negative control group on day 7, respectively; I, J, K, and L represent the cytokine levels in the spleen cell supernatant of BALB / c mice in the high, medium, and low dose groups and the negative control group on day 7, respectively; M represents the viral load in the blood of BALB / c mice in the high, medium, and low dose groups and the negative control group on day 7; and N represents the serum binding antibody titer of BALB / c mice in the high, medium, and low dose groups and the negative control group on day 7.
[0018] The herpes simplex virus strain HSV-2 / KM-1 (Human alphaherpesvirus 2) of this invention was deposited on July 25, 2025 at the China Center for Type Culture Collection (CCTCC), CCTCC NO: V202550, located at Wuhan University, Wuhan, China, and classified as herpes simplex virus type 2 HSV-2 / KM-1 Human alphaherpesvirus 2. Detailed Implementation
[0019] The present invention will now be described in further detail with reference to the embodiments.
[0020] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.
[0021] The main cells and reagents used in the embodiments of this invention are as follows: Vero cells (African green monkey kidney cells), A549 (human non-small cell lung cancer cell line), Beas-2B (human bronchial epithelial cell line), and HFF-1 (human foreskin fibroblast cell line) were preserved in our laboratory. Vero cells, A549 cells, and Beas-2B cells were cultured in Durbecco's modified eagle medium (DMEM) containing 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) penicillin-streptomycin solution (PS), while HFF-1 cells were cultured in complete DMEM medium containing 15% (v / v) FBS and 1% PS.
[0022] Antibodies: gG antibody (catalog number: GTX76112) was purchased from Gentex. ICP5 antibody (catalog number: sc-56989) and ICP27 antibody (catalog number: sc-69806) were purchased from Santa Cruz. β-actin antibody (catalog number: 66009-1-Ig) and HRP-conjugated mouse secondary antibody (catalog number: SA00001-1) were purchased from Proteintech.
[0023] PBS (containing phenol red), PS, and 0.25% (v / v) trypsin were provided by the Institute of Medical Biology, Chinese Academy of Medical Sciences; DMEM (Catalog No.: C3113-0500) and fetal bovine serum (Catalog No.: C04001-050) were purchased from Shanghai Xiaopeng Biotechnology Co., Ltd. Crystal violet powder (Catalog No.: GC307002-25g) was purchased from Wuhan Saiweier Biotechnology Co., Ltd. Western primary antibody dilution buffer (Catalog No.: P0023A) was purchased from Shanghai Beyotime Biotechnology Co., Ltd. The body fluid viral DNA / RNA micro-preparation kit (Catalog No.: UE-MN-BF-VNA-250) was purchased from US Everbright, Inc. (USA). PCR Taq enzyme premix (Catalog No.: RR901A) was purchased from Baoriyi Biotechnology (Beijing) Co., Ltd. The TOPO enzyme-mediated universal T vector (Catalog No.: TSV-007VSm) was purchased from Beijing Qingke Biotechnology Co., Ltd. The BCA protein quantification kit (catalog number: ZJ101) and the two-color pre-stained protein marker (catalog number: WJ106) and the ECL chemiluminescence kit (catalog number: P0018FM) were purchased from Shanghai Beyotime Biotechnology Co., Ltd. The guinea pig IL-4 ELISA kit (catalog number: orb561589) was purchased from Biobyt. The guinea pig IL-10 ELISA kit (catalog number: LS-F5696) was purchased from LifeSpan BioSciences. The ELISA stop solution (catalog number: C1058), ELISA coating solution (C1055), and TMB chromogenic solution (catalog number: PR1210) were purchased from Beijing Solarbio Science & Technology Co., Ltd. The mouse Th1 / Th2 uncoated kit (catalog number: 88-7711-44) was purchased from Thermo Fisher Scientific China Co., Ltd.
[0024] Example 1 Virus isolation and identification 1. Virus isolation and culture After obtaining informed consent from patient CYK, herpes simplex secretions from the patient's right buttock were diluted 6-fold with DMEM complete medium containing 2% FBS (v / v) and 2% (v / v) PS and inoculated into a monolayer of Vero cells in 96-well plates. The cells were then cultured at 37°C in a 5% CO2 (v / v) incubator, and cytopathic effects were observed daily. Upon observation of significant cytopathic effects, cells were collected, subjected to a freeze-thaw cycle, and centrifuged at 1000×g for 2 min at 4°C to remove the cell pellet. The supernatant was collected, aliquoted, and stored at -80°C as a seed virus, named HSV-2 / KM-1.
[0025] Virus amplification: Prepare a bottle (75cm) 2After discarding the culture supernatant, the remaining culture medium was washed away with PBS, and 10 μL of seed virus was added to the Vero cells. DMEM was then added to bring the volume to 5 mL, and the cells were incubated at 37°C with 5% CO2 (v / v) for 1 hour. Subsequently, the supernatant was discarded, and 10 mL of DMEM containing 2% FBS (v / v) and 1% (v / v) PS was added. The cells were then incubated at 37°C with 5% CO2 (v / v) until the cytopathic effect rate reached 80%. The culture flask was then freeze-thawed three times at -80°C and room temperature. Finally, the virus-cell debris mixture was collected, centrifuged at 6000 rpm for 10 minutes, and the supernatant was used as the virus solution in subsequent examples, stored at -80°C.
[0026] 2. Virus titer determination Viruses stored at -80℃ were used to prepare 10 saturated plasmas using serum-free DMEM. -1 -10 -10 Virus dilutions were administered at 100 μL / well for each dilution, with a total of 8 wells seeded into Vero cells cultured in DMEM complete medium containing 4% FBS (v / v) for 24 hours prior. Cell confluence in each well of the 96-well plate was above 90%, indicating good cell condition (total volume after virus addition: 200 μL / well). Cells were observed for 7 days, and cytopathic effects were recorded in each well. Viral titers were calculated using the TCID50 method.
[0027] 3. Virus sequencing and identification Total DNA was extracted from 200 μL of viral suspension using a micro-preparation kit for viral DNA / RNA in bodily fluids. Using HSV-2-UL30P1: 5'-atggtgaacatcgacatgtacgg-3' (SEQ ID NO.1) and HSV-2-UL30 P2: 5'-cctccttgtcgaggccccgaaac-3' (SEQ ID NO.2) as primers, a partial fragment of the HSV-2 UL30 gene was amplified using PCR Taq enzyme premix. The amplified target fragment was ligated into a T-vector (using the TSV-007SpClone007 Simple Vector kit from Qingke Biotechnology) and then sequenced for identification.
[0028] PCR reaction system: 20 μL Taq enzyme premix, 2 μL HSV-2-UL30 P1 (10 μM / μL), 2 μL HSV-2-UL30 P2 (10 μM / μL), 4 μL DNA (400 ng / μL), and 12 μL enzyme-free sterile water.
[0029] PCR reaction conditions: pre-denaturation 94℃ for 5 min; denaturation 94℃ for 30 sec, annealing 60℃ for 30 sec, extension 72℃ for 45 sec, 33 cycles; extension 72℃ for 5 min, store at 4℃.
[0030] Ligation system: pClone007 Simple Vector 1μL, 10×Topo Mix 1μL, target fragment 20ng, enzyme-free sterile water to make up to 10μL.
[0031] Connection conditions: Let stand at room temperature for 20 minutes.
[0032] 4. Morphological identification using HSV-2 / KM-1 transmission electron microscopy 120 mL of HSV-2 / KM-1 virus solution was concentrated to 8 mL using an ultrafiltration tube with a pore size of 100 K (the virus solution was obtained by the method in step 1 of this example). 20 μL of the concentrated virus solution was sent to the Institute of Medical Biology, Chinese Academy of Medical Sciences, and observed using a transmission electron microscope (H-7650, Hitachi, Japan).
[0033] 5. HSV-2 / KM-1 whole genome third-generation sequencing and evolutionary analysis Total DNA was extracted from 200 μL of viral suspension using a micro-preparation kit for viral DNA / RNA in bodily fluids (the viral suspension was obtained using the method in step 1 of Example 1). The total DNA was sent to Chipsys for whole-genome sequencing. The returned results were compared with the GenBank database. The genomes of 100 HSV-2 viruses most similar to HSV-2 / KM-1 were selected. Phylogenetic trees were constructed using MEGA12 software and HSV-2 / KM-1. The phylogenetic trees were then beautified using the ChiPlot website, and the evolutionary relationships of each strain were analyzed.
[0034] 6. Amino acid substitution analysis The study selected 2015-27216 and 136 strains most evolutionarily similar to KM-1, as well as HJ12, the only HSV-2 virus strain from China in GenBank besides KM-1. The analysis used SnapGene software and the muscle method to align the protein sequences encoded by each gene. Subsequently, proteins with three or more amino acid substitutions were listed according to their function, as shown in Tables 1 (Immediate Early Protein Amino Acid Substitution Analysis), 2 (DNA Replication and Nucleic Acid Metabolism Related Protein Amino Acid Substitution Analysis), and 3 (Structural Protein Amino Acid Substitution Analysis).
[0035] 7. Isolation and identification results of type II herpes simplex virus strain HSV-2 / KM-1 CYK vesicle fluid samples from patients were infected with Vero cells. Significant cytopathic effects were observed on day 2. Cells were collected, and viral seeds were obtained. The viral seeds were then amplified extensively using Vero cells, and the viral load was measured to be 2.4 × 10⁻⁶. 5 PFUs / mL virus.
[0036] PCR successfully amplified a 391 bp gene fragment. Sequencing analysis confirmed that the amplified fragment was a conserved sequence of the HSV-2 UL30 gene, and the gene sequence matched 100% with isolate 121 (PP099985.1) from the University of Washington, confirming that this isolate is indeed an HSV-2 viral strain. A partial nucleotide sequence of the UL30 gene is shown in SEQ ID NO.3.
[0037] The conserved nucleotide sequence of the UL30 gene is as follows: atggtgaacatcgacatgtacggcatcatcaccgacaaggtcaaactctccagctacaagctgaacgccgtcgccgaggccgtcttgaaggacaagaa gaaggatctgagctaccgcgacatccccgcctactacgcctccgggcccgcgcagcgcggggtgatcggcgagtattgtgtgcaggactcgctgctggt cgggcagctgttcttcaagtttctgccgcacctggagctttccgccgtcgcgcgcctggcgggcatcaacatcacccgcaccatctacgacggccagca gatccgcgtcttcacgtgcctcctgcgccttgcgggccagaagggcttcatcctgccggacaccccaggggcggtttcggggcctcgacaaggagg (seq ID NO:3) Under a transmission electron microscope (e.g.) Figure 1 As shown in the figure, the virus particles are spherical with a diameter of 100nm-125nm and have an envelope on the surface, with visible spike-like envelope proteins distributed on the virus surface.
[0038] Evolutionary tree (e.g.) Figure 2 As shown in the figure, although HSV-2 / KM-1 is geographically distant from US strains (such as strain 136 and strain 2015-27216), it is genetically and developmentally more closely related to HSV-2 strains in China. This may be related to the limited number of clinical isolates of HSV-2 in China or the exchanges between people from different countries in the context of globalization.
[0039] Amino acid substitution analysis showed (as shown in Tables 1, 2, and 3, "-" indicates the deletion of amino acids at that site) that the protein sequence differences between HSV-2 / KM-1 and HJ12 strains were much greater than those between strains 136 and 2015-27216 from the United States.
[0040] Table 1. Immediate Early Protein Amino Acid Substitution Analysis
[0041] Table 2. Analysis of amino acid substitutions in proteins related to DNA replication and nucleic acid metabolism.
[0042] Table 3. Structural protein amino acid substitution analysis
[0043] The type II herpes simplex virus strain HSV-2 / KM-1 has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:V202550, located at Wuhan University, on July 25, 2025.
[0044] Example 2: HSV-2 / KM-1 cell tropism and one-step growth curve plotting 1. HSV-2 / KM-1 cell tropism analysis Immunoblotting to detect viral protein expression: HFF-1, A549 and Beas-2B cells were infected with HSV-2 / KM-1 at a multiplicity of infection (MOI) of 0.01. Cytopathic images and intracellular proteins were collected at time points of 0, 12, 24 and 36 hours of infection duration (hpi).
[0045] After determining the protein concentration using the BCA protein quantification kit, the protein concentration in different cell groups was adjusted to be consistent. The protein was mixed with 5×SDS-Loading and incubated in a 100°C metal bath for 10 min to obtain a loadable protein sample. The protein sample and marker were added to the SDS-PAGE lanes, and electrophoresis was performed at 120V for 1 hour. The protein on the gel was then transferred to a PVDF membrane. The membrane was blocked for 2 hours with 5% (w / v) skim milk prepared by TBST. Subsequently, the primary antibody was diluted with Western spectral primary antibody dilution buffer at a certain ratio and then incubated with PVDF membranes to facilitate the binding of the primary antibody to the protein (the volume dilution ratio of gG in Western spectral primary antibody dilution buffer was 1:1000; the volume dilution ratio of β-actin in Western spectral primary antibody dilution buffer was 1:5000; the volume dilution ratio of ICP5 in Western spectral primary antibody dilution buffer was 1:1000; and the volume dilution ratio of ICP27 in Western spectral primary antibody dilution buffer was 1:1000). The membranes were incubated overnight at 4°C. On the second day, the membrane was washed 4 times with TBST for 10 minutes each time. Then, the secondary antibody was diluted with 5% (w / v) skim milk and incubated on a shaker at room temperature for 1 hour (the dilution ratio of mouse secondary antibody to skim milk was 1:5000). The membrane was washed 4 more times with TBST. The protein bands were then observed using an ECL chemiluminescence kit on a multi-functional imaging system (ChemiDoc MP BIO-RAD, USA).
[0046] 2. Plotting the one-step growth curve of HSV-2 / KM-1 Vero cells were seeded in 12-well plates and grown in DMEM complete medium containing 8% FBS (v / v) and 1% (v / v) PS at 37°C in an incubator with 5% CO2 (v / v). When the Vero cells reached confluence, they were washed once with PBS. HSV-2 / KM-1 virus was then seeded into Vero cells at MOIs of 0.1, 0.01, and 0.001, for a total of three biological replicates. After incubation for 1 hour, the supernatant was discarded (incubation continued at 37°C in an incubator with 5% CO2 (v / v), and 1 mL of DMEM complete medium containing 2% FBS (v / v) was added to each well for further culture. The culture supernatant was collected at time points of infection duration (hpi): 0, 12, 24, 36, 48, 60, 72, 84, and 96 hours. The viral titer in the culture supernatant was determined by the TCID50 method for each combination of MOI and infection duration, and a one-step growth curve was plotted.
[0047] 3. Results Cell tropism analysis revealed that, for example Figure 3 As shown, Figure 3 This document describes the replication of the isolate from Example 2 of this invention in three cell lines: A549, Beas-2B, and HFF-1 cells, specifically using cytopathic images and Western blot analysis. HSV-2 / KM-1 proliferation and protein modification differed across cell lines. In terms of cytopathic effect rate, HFF-1 and Beas-2B cells showed cytopathic effects earlier than A549. Regarding protein expression timing, viral protein expression was earliest in HFF-1 cells, followed by Beas-2B cells. Among these three cell lines, HFF-1 is undoubtedly unique, which aligns perfectly with the cellular infectivity tropism of HSV-2 as a genital herpes virus.
[0048] like Figure 4 As shown in Figure A, when inoculated with an MOI of 0.1, the viral titer released into the supernatant reached its peak at 48 hours after infection, approximately 5.1 lgTCID50 / mL. Thereafter, the viral titer slightly decreased with prolonged infection time, possibly because the virus remained at a temperature conducive to its activity without cell supply for an extended period. When inoculated with an MOI of 0.01, peak viral release was reached at 60 hours after infection, with a titer of 6.5 lgTCID50 / mL. When inoculated with an MOI of 0.001, peak viral release was reached at 72 hours after infection, with a titer of approximately 7.0 lgTCID50 / mL. In summary, lower MOIs and longer infection times are more favorable for obtaining high titers of HSV-2 / KM-1. Furthermore, HSV- / KM-1 is temperature-sensitive; prolonged exposure to 37°C leads to a decrease in titer.
[0049] This example illustrates that HSV-2 / KM-1 is more likely to infect genital cells and epithelial cells. Regarding viral replication, lower MOI inoculation conditions are more likely to yield high titers of HSV-2 / KM-1 virus.
[0050] Example 3: Instrumental Test for Neutralization of HSV-2 / KM-1 1. Mouse immunization In this embodiment, BALB / c mice were immunized three times by intramuscular injection with 15 μg of the gC2-gD2-gE2 fusion expression protein (vaccine group) (see ZL202610277038.6 A novel HSV-2 triantigen recombinant protein vaccine composition and its application) and PBS (negative control). The mice were immunized once every two weeks. The serum of the mice was collected on the 14th day after the last immunization as the test sample for the neutralization test.
[0051] 2. Neutralization test The test serum was inactivated at 56°C for 30 minutes to remove nonspecific inhibitors. In 96-well plates, the test serum was serially diluted two-fold from an initial dilution of 1:20 to 1:2560, with 50 μL of diluted test serum in each well. The diluted test serum was mixed 1:1 with 100 TCID50 HSV-2 / KM-1 virus (50 μL) and incubated at 37°C for 1 hour. Subsequently, approximately 40,000 Vero cells were seeded in each well. After seven days of incubation, the neutralizing antibody titer was determined based on the presence of cytopathic effect (CPE). The 50% serum neutralization endpoint was defined as the highest serum dilution that protected 50% of cells from damage. Results were calculated using the Reed-Muench method.
[0052] 3. Results like Figure 4 As shown in Figure B, the serum neutralizing antibody titer in the vaccine group was significantly higher than that in the negative control, with a mean serum neutralizing antibody titer of 289 in the vaccine group. This demonstrates the feasibility of using HSV-2 / KM-1 for neutralizing antibody detection in vaccine immunogenicity evaluation. It suggests that HSV-2 / KM-1 has the potential to serve as a vaccine evaluation tool.
[0053] Example 4: Establishment of a guinea pig genital herpes model based on HSV-2 / KM-1 1. LD50 determination Fifty female Hartley guinea pigs aged 6-8 weeks were randomly divided into 5 groups of ten each. They were challenged vaginally with a 5-fold gradient of HSV-2 / KM-1 virus, i.e., the challenge dose from highest to lowest was 1.2 × 10⁻⁶. 6 PFU / each, 2.4×10 5 PFU / each, 4.8×10 4 PFU / each, 9.8×10 3 PFU / each, 1.92×10 3 PFU / guinea pig. The survival rate of guinea pigs was observed for 14 consecutive days, with a 25% weight loss as the humanitarian endpoint. LD50 was calculated based on the final survival rate of each group, using the following formula: lgLD50=XK-d(ΣP-0.5), where: XK is the logarithmic dose for the group with a 100% mortality rate, d is the logarithmic interval, and ΣP is the sum of mortality rates across all groups.
[0054] 2. Pathogenicity characteristics analysis of HSV-2 / KM-1 in guinea pig models.
[0055] Forty 6-8 week old Hartley guinea pigs were randomly divided into four groups: a negative control group (no challenge), a high-dose group (1.2 × 10⁻⁶), and a high-dose group (1.2 × 10⁻⁶). 6 PFU / animal), medium dose group (1.2×10 5PFU / animal), low-dose group (1.2×10 4 (PFU / guinea). Vaginal swabs were collected daily after vaginal challenge, and weight and lesion status were recorded. Blood samples were collected from guinea pigs on the third and seventh days. All guinea pigs were euthanized on the seventh day after challenge, and viral load was measured from the vagina, bladder, dorsal root ganglion, and brain. Table 4 shows the lesion scoring criteria.
[0056] Table 4
[0057] 3. Viral load measurement Nucleic acid was extracted from vaginal swabs, whole blood, and tissue homogenates (200 μL each) using a NeoBio nucleic acid extraction kit. Viral load was then quantified using a probe-based quantitative PCR system (AceQ Universal U+ Probe Master Mix V2 kit). The components of the probe-based quantitative PCR system are shown in Table 5. Primer sequences: F: 5'-aacacatccccctgttctgg-3' (SEQ ID NO.4); R: 5'-cgaccagacaaacgaacgc-3' (SEQ ID NO.5); Probe: 5'-FAM-agcaccaccatccacacggc-BHQ1-3' (SEQ ID NO.6).
[0058] Table 5
[0059] 4. Serum IgG detection ELISA plate wells were coated with UL39 protein and incubated overnight at 4°C. The next day, the plates were washed 5 times with PBST, and then blocked with 200 μL / well of 2% (w / v) BSA at 37°C for 2 hours. After washing 3 times with PBST, the serum to be tested was diluted 2-fold from 1:20 to 1:2560. Eight dilutions of serum from 1:20 to 1:2560 were seeded into each well of a 96-well plate, one well per dilution, and incubated at 37°C for 1 hour. After washing 5 times with PBST, antibody detection was performed by diluting HRP-labeled goat anti-guinea pig IgG at a ratio of 1:10000, 100 μL / well, and incubating at 37°C for 1 hour. After washing 5 times with PBST, the plates were blotted dry, and 100 μL / well of TMB chromogenic solution was added. The plates were incubated in the dark for 4-5 minutes, and then 50 μL / well of ELISA stop solution was added. The OD value was measured at 450 nm using a microplate reader. The OD value of the positive well is greater than twice that of the negative well.
[0060] 5. Detection of Th2 cytokine secretion levels After euthanizing guinea pigs, spleen cells were collected, milled into single cells, and resuspended in RPMI 1640 medium. Subsequently, erythrocytes in the spleen cell suspension were lysed with 1 mL of erythrocyte lysis buffer. After 4 minutes, lysis was terminated by adding RPMI 1640 medium containing 10% FBS (v / v). The cells were centrifuged at 500×g for 10 minutes, the supernatant was discarded, and the cell pellet was resuspended in 1 mL of RPMI 1640 medium containing 10% FBS (v / v) to obtain spleen lymphocytes. 1×10n cells were collected from each guinea pig. 7 One spleen lymphocyte was stimulated with 2 μg UL39 protein at 37°C and 5% CO2 (v / v) for 48 hours. The supernatant of the spleen lymphocytes was then collected as the cytokine test sample.
[0061] Following the instructions of the guinea pig cytokine assay kit (IL-4 and IL-10 assay kit catalog numbers and manufacturers are listed in the main reagents section of the implementation method), the standard stock solution (IL-4 stock solution concentration: 500 pg / mL; IL-10 stock solution concentration: 200 pg / mL) was diluted 2-fold to 64-fold (i.e., IL-4 stock solution concentration: 7.812 pg / mL; IL-10 stock solution concentration: 3.125 pg / mL). Then, 100 μL of the standard stock solution, the serially diluted standards, and the test sample were added to the wells of the plate, respectively. The plate was sealed and incubated at 37°C for 90 minutes. After washing the plate twice, 100 μL of the biotin-labeled antibody working solution from the kit was added to each well. The plate was sealed and incubated at 37°C for 60 minutes. The plate was washed 3 times, with each wash lasting 1 minute. 100 μL of SABC working solution was added to each well, the plate was sealed, and incubated at 37°C for 30 minutes. Wash the plate five times, soaking for 1 minute each time. Add 90 μL of TMB substrate solution, seal the plate, and incubate at 37°C for 10–20 minutes. Finally, add 50 μL of ELISA stop solution. Read and calculate immediately at 450 nm.
[0062] 6. Results like Figure 5 As shown, Figure 5 China A Figure 5 B represents the guinea pig's weight gain rate and lesion score during the seven-day acute infection period, respectively. Figure 5 The line graph in C represents the survival of each group at LD50 (14 days); Figure 5 D, Figure 5 Chinese E, Figure 5 China F, Figure 5The images show the vaginal viral shedding over seven days of infection, viral load in various tissues on day seven, serum binding antibody titers, and the results of Th2 cytokine detection stimulated by spleen cells. In the Hartley guinea pig genital herpes model, the body weight of the high, medium, and low-dose challenge groups showed a significant decreasing trend compared to the negative control (it needs clarification which three groups are being referred to). The high-dose and medium-dose groups showed similar trends in body weight changes and lesion scores. The lesions in all groups worsened with the duration of infection. The median lethal dose (LD50) of HSV-2 / KM-1, calculated using the Karber method, was 4.1 × 10⁻⁶. 4 PFU / animal. During the infection period, viral shedding in the vagina peaked on days 2 and 5. Among different tissues, the viral load in the dorsal root ganglion (DRG) was significantly higher than that in the vagina, bladder, and brain. No viral nucleic acid was detected in the uterus, indicating that in the guinea pig model, HSV-2 / KM-1 tends to infect the nervous system, suggesting the potential of HSV-2 / KM-1 in studies of HSV-2 infection of the nervous system. Stimulation of spleen cells on day 7 of infection and subsequent detection of cytokines in the supernatant revealed that short-term viral infection could induce Th2 cytokines, with the medium-dose infection group showing the best induction effect. A 7-day infection period induced serum binding antibodies, with the medium-dose group showing the most significant antibody induction effect.
[0063] This embodiment provides a strong reference for HSV-2 / KM-1 as a vaccine evaluation tool, and successfully established an acute phase model of genital herpes in guinea pigs. The successful determination of LD50 lays the foundation for subsequent guinea pig challenge in vaccine research.
[0064] Example 5: Establishment of a genital herpes model in BALB / c mice based on HSV-2 / KM-1
[0065] 1. LD50 determination Fifty 6-8 week old female BALB / c mice were randomly divided into 5 groups of 10 each. They were challenged vaginally with a 5-fold gradient of HSV-2 / KM-1 type II herpes simplex virus, i.e., the challenge doses from highest to lowest were 1×10⁻⁶. 4 PFU / each, 2×10 3 PFU / each, 4×10 2 PFU / mouse, 80 PFU / mouse, and 16 PFU / mouse. Mice were observed for survival for 14 days. The LD50 was calculated based on the final survival rate of each group using the following formula: lgLD50=XK-d(ΣP-0.5), where: XK is the logarithmic dose for the group with a mortality rate of 100%, d is the logarithmic interval, and ΣP is the sum of the mortality rates of each group.
[0066] 2. Pathogenicity characteristics analysis of HSV-2 / KM-1 in guinea pig models.
[0067] Forty 6-8 week old female BALB / c mice were randomly divided into four groups: a negative control group (no challenge), a high-dose group (7.8 × 10⁻⁶), and a high-dose group (7.8 × 10⁻⁶). 4 PFU / animal), medium dose group (7.8×10 3 PFU / animal, low-dose group (7.8×10) 2 PFU / mouse). Vaginal swabs were collected daily after vaginal challenge, and weight and lesion status were recorded. All mice were sacrificed on the seventh day after challenge, and viral load was measured from the vagina, bladder, dorsal root ganglion, brain, and uterus. Table 6 shows the lesion scoring criteria.
[0068] Table 6
[0069] 3. Viral load measurement Nucleic acid was extracted from vaginal swabs, whole blood, and 200 μL of tissue homogenate using a NeoBaiji nucleic acid extraction kit, followed by absolute quantification of viral load using a probe method. (The probe-based real-time PCR system is the same as in Example 4.) 4. Serum IgG detection ELISA plate wells were coated with UL39 protein and incubated overnight at 4°C. The next day, the plates were washed 5 times with PBST, and then blocked with 200 μL / well of 2% (w / v) BSA at 37°C for 2 hours. After washing 3 times with PBST, the serum to be tested was diluted 2-fold from 1:20 to 1:2560. Eight dilutions of serum from 1:20 to 1:2560 were seeded into each well of a 96-well plate, one well per dilution, and incubated at 37°C for 1 hour. After washing 5 times with PBST, antibody detection was performed: HRP-labeled goat anti-mouse IgG was diluted 1:100000, 100 μL / well, and incubated at 37°C for 1 hour. After washing 5 times with PBST, the plates were patted dry, 100 μL / well of TMB chromogenic solution was added, and the plates were incubated in the dark for 4-5 minutes. Finally, 50 μL / well of ELISA stop solution was added, and the OD value was measured at 450 nm using a microplate reader. The OD value of the positive well is greater than twice that of the negative well.
[0070] 5. Detection of Th1 / Th2 cytokine secretion levels After euthanasia of BALB / c mice, spleen cells were collected, milled into single cells, and resuspended in RPMI 1640 medium. Subsequently, erythrocytes in the spleen cell suspension were lysed with 1 mL of erythrocyte lysis buffer. After 4 minutes, lysis was terminated by adding RPMI 1640 medium containing 10% FBS (v / v). The cells were centrifuged at 500×g for 10 minutes, the supernatant was discarded, and the cell pellet was resuspended in 1 mL of RPMI 1640 medium containing 10% FBS (v / v) to obtain spleen lymphocytes. 1×10n cells were collected from each BALB / c mouse. 7One spleen lymphocyte was stimulated with 2 μg UL39 protein at 37°C and 5% CO2 (v / v) for 48 hours. The supernatant of the spleen lymphocytes was then collected as the cytokine test sample.
[0071] Following the instructions of Thermo Fisher Scientific's Mouse Th1 / Th2 Cytokine Uncoated Kit, 100 μL of the corresponding cytokine capture antibody was coated onto each well of an ELISA plate at 4°C overnight. 200 μL of washing buffer was added to each well and discarded; this constituted one wash. After washing three times, the plates were blocked with 200 μL of ELISA diluent per well at room temperature for 1 hour. The standard stock solutions (IFN-γ stock solution concentration: 2000 pg / mL; IL-2 stock solution concentration: 200 pg / mL; IL-4 stock solution concentration: 500 pg / mL; IL-10 stock solution concentration: 4000 pg / mL) were diluted 2-fold to 64-fold (a total of 6 dilutions). Subsequently, 100 μL of the standard stock solution, the serially diluted standards, and the test sample were added to each well, 100 μL per well, and incubated at room temperature for 2 hours. After washing the plate four times with washing buffer, add 100 μL of detection antibody to each well, seal the plate, and incubate at room temperature for 1 hour. Wash the plate three times, soaking for 1 minute each time. Add 100 μL of streptavidin solution from the kit to each well, seal the plate, and incubate at room temperature for 30 minutes. Wash the plate five times, soaking for 1 minute each time. Add 100 μL of TMB substrate solution, seal the plate, and incubate at room temperature for 15 minutes. Finally, add 100 μL of stop solution. Read and calculate immediately at 450 nm.
[0072] 6. Results like Figure 6 As shown, Figure 6 China A Figure 6 In the middle section, B represents the mouse's weight gain rate and lesion score during the seven-day acute infection period, respectively. Figure 6 The line graph in C represents the survival of each group at LD50 (14 days); Figure 6 D, Figure 6 Chinese E, Figure 6 China F, Figure 6 China G, Figure 6 The images show the vaginal virus shedding over seven days of infection, viral load in various tissues on day seven, results of Th1 / Th2 cytokine detection by spleen cell stimulation, viremia on day seven, and serum binding antibody detection. In the BALB / c genital herpes model, there were clear and significant differences in weight gain and genital lesion scores among the high, medium, and low dose groups. With continued infection, mice with higher infection doses showed greater weight loss and increased lesion characteristics. Vaginal virus shedding peaked on day 2 during the seven days of continuous infection. The median lethal dose (LD50) of HSV-2 / KM-1 was 4.7 × 10⁻⁶. 2PFU / mouse, no virus was detected in mouse brain tissue. The viral copy number per milligram was higher in the dorsal root ganglia and vagina than in the bladder and uterus, and the viral load in each tissue showed a trend of increasing viral load with higher challenge doses. This indicates that HSV-2 / KM-1 can replicate not only in the reproductive system but also exhibit remarkable replication capabilities in the nervous system. The IL-2 cytokine levels in mice infected with high and medium doses of the virus showed a slightly lower trend than in the negative control, possibly because the high- and medium-dose groups reached the immunosuppressive stage on day 7 after infection. The increasing levels of IL-10 and IFN-γ in the high-, medium-, and low-dose groups can explain this: the high-dose group experienced immunosuppression, resulting in low cytokine levels, while the medium- and low-dose groups showed lower levels of immunosuppression due to the reduced challenge dose; the low-dose group even showed evidence of cytokine production. qPCR detection of whole blood nucleic acid on day 7 showed viremia in the infected mice, with a highly significant difference in blood viral load between the high-dose group and the negative control. A 7-day infection period can induce significant HSV-2 / KM-1 binding antibodies in mice, which is different from the results in guinea pigs.
[0073] This embodiment successfully established an acute phase model of genital herpes in BALB / c mice. The pathogenicity of HSV-2 / KM-1 differed between guinea pig and mouse models, demonstrating its versatility for research. Guinea pig models are widely recognized as the most effective model for studying the recurrent phase of herpesviruses, while mouse models, as the results of this embodiment show, exhibit more sensitive immune responses, are smaller, and are more economical to raise. The inclusion of herpes models in both guinea pigs and mice in this invention further demonstrates its comprehensiveness.
[0074] The above describes in detail the etiological characteristics of HSV-2 / KM-1 and its acute-phase animal infection model. However, the present invention is not limited thereto. Extending from the embodiments of the present invention are the uses of the HSV-2 / KM-1 strain in vaccine evaluation, including immunogenicity and protective evaluation of vaccines, as well as research on the discovery of new mechanisms of HSV-2 virus infection involving this strain, all of which fall within the scope of protection of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claims. The scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A type II herpes simplex virus strain HSV-2 / KM-1, characterized in that, The aforementioned type II herpes simplex virus strain HSV-2 / KM-1 was deposited at the China Center for Type Culture Collection on July 25, 2025, with accession number CCTCC NO: V202550.
2. The application of the type II herpes simplex virus strain HSV-2 / KM-1 as described in claim 1 in establishing a genital herpes model.
3. The application of the type II herpes simplex virus strain HSV-2 / KM-1 according to claim 2 in establishing a genital herpes model, characterized in that, The model is either the Hartley guinea pig genital herpes model or the BALB / c mouse genital herpes model.
4. The application of the type II herpes simplex virus strain HSV-2 / KM-1 as described in claim 1 in vaccine evaluation.