Modified efficient compact RNA base editing system
By directing the evolution of mini-dPspCas13b and introducing an activity-enhancing mutation into its interaction loop region with crRNA, the eminiREPAIR system was constructed. This solved the problem of decreased editing efficiency after the miniaturization of RNA editing systems, and achieved efficient and compact RNA base editing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JILIN UNIV FIRST HOSPITAL
- Filing Date
- 2025-12-16
- Publication Date
- 2026-05-12
AI Technical Summary
Existing RNA editing systems suffer from reduced editing efficiency after miniaturization, making it difficult to achieve a balance between high efficiency and small size in gene therapy. In particular, optimizing the interaction interface between the Cas13 protein and RNA remains a challenge.
By directing the evolution of mini-dPspCas13b, multiple activity-enhancing mutations were introduced into the key loop region where it interacts with crRNA, and the emini-dPspCas13b-ADAR2DD fusion protein was constructed, which enhanced its binding affinity and stability with crRNA, thus forming the eminiREPAIR system.
It achieves a balance between high efficiency and small size in RNA editing systems, significantly improving editing efficiency, and is suitable for precise RNA editing in various cells and in vivo, solving the limitations of AAV delivery capacity.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology. Background Technology
[0002] RNA editing technology, with its unique advantages such as reversibility, spatiotemporal specific regulation, and precise editing window, has opened up new avenues for the treatment of genetic diseases. In 2017, Zhang Feng's team developed the REPAIR (RNA Editing for Programmable A to I Replacement) system. REPAIR is a programmable A-to-I RNA base editing system obtained by fusing an inactivated PspCas13b protein (dPspCas13b) with a highly active double-stranded RNA adenosine deaminase domain (ADAR2DD, 385 amino acids). However, the molecular weight of the core component dPspCas13b (1090 amino acids) is too large, exceeding the 4.7kb packaging capacity limit of the AAV vector (REPAIR: 1475 amino acids), which severely restricts its application in gene therapy.
[0003] In recent years, researchers have focused on developing more compact RNA editing systems, reporting novel REPAIR systems based on miniaturized Cas13 proteins such as Cas13X.1 and Cas13bt1. While these systems have successfully addressed the vector capacity issue for AAV delivery, they still suffer from significant shortcomings in editing efficiency. Therefore, developing novel REPAIR systems that combine high efficiency with small size has become a key technological bottleneck that urgently needs to be overcome in the field of RNA editing therapy. Solving this problem will significantly promote the clinical translation of RNA editing technology and provide safer and more precise treatment strategies for genetic diseases.
[0004] While rational design can reduce the size of RNA editors, domain deletion also comes with functional loss, leading to decreased editing efficiency. The developed miniREPAIR system (1051 amino acids) solved the size problem, but its editing efficiency was reduced. Therefore, significantly improving editing efficiency while achieving miniaturization is another key issue that must be addressed before this technology can be applied clinically. Directed protein evolution is a powerful means of enhancing protein function, but applying it to complex CRISPR systems, especially optimizing their interaction interfaces with RNA, faces significant challenges, including the selection of mutation sites and the combined effects of beneficial mutations. Summary of the Invention
[0005] The purpose of this invention is to enhance the binding affinity and stability of emini-dPspCas13 to crRNA, thereby creating a modified, highly efficient, and compact RNA base editing system with significantly improved editing efficiency compared to the original REPAIR system and the unoptimized miniREPAIR system.
[0006] The editing system of this invention is a fusion protein, which includes the mini-inactivated Cas13 protein emini-dPspCas13b and the adenosine deaminase domain ADAR2DD. emini-dPspCas13b is obtained by deletion and mutation of dPspCas13b. The amino acid sequence of emini-dPspCas13b is based on mini-dPspCas13, and contains 5 activity-enhancing mutations located in the loop region at its interaction interface with crRNA. The activity-enhancing mutations include E621R, A729R, E738R, D739R, and E875R. The amino acid sequence of eminiREPAIR is SEQ ID NO: 3.
[0007] The construction process of eminiREPAIR in this invention: S1. Mutant screening and vector construction: The key loop region in the dPspCas13b protein that interacts with crRNA was identified, site-directed mutagenesis was designed, and plasmids containing 74 single-point mutants were constructed. S2. Efficiency evaluation of single-point mutants: Each single-point mutant plasmid was co-transfected with the ADAR2DD expression cassette and the crRNA expression plasmid targeting the endogenous gene PPIB site into HEK293T cells. The crRNA sequence of PPIB is caaagatcacccggccCacatcttcatctccaattcgtaggtcaaaatac. Five key mutation sites were identified: E621R, A729R, E738R, D739R, and E875R. S3. The five highly efficient single-point mutations selected were introduced into the gene sequence of mini-dPspCas13b to construct the combinatorial mutant emini-dPspCas13b.
[0008] This invention fuses the combined mutant emini-dPspCas13b with a flexible linker and clones it into an expression vector, ultimately constructing the eminiREPAIR system.
[0009] The system of this invention combines high efficiency with small size, making it suitable for precise RNA editing in various cells and in vivo. Attached Figure Description
[0010] Figure 1 This is a schematic diagram illustrating the efficiency assessment of different amino acid mutations based on 13b-miniREPAIR. Figure 2 These are schematic diagrams illustrating the construction of different REPAIR carriers; Figure 3 The different REPAIR systems were evaluated in HEK293 cells; Figure 4 This is a schematic diagram of the structure of dPspCas13b; Figure 5 This is a schematic diagram of the miniREPAIR carrier construction; where RE represents the REPAIR system and REH represents the miniREPAIR system. Figure 6 This is an efficiency assessment of the miniREPAIR system; Figure 7 The method involves targeted evolution of protein loop regions (I indicator region) that are close to crRNA; where I indicator region represents the mutation region and II indicator region represents crRNA. Figure 8 This is an evaluation of the mutant efficiency of the miniREPAIR system; where REH represents the miniREPAIR system. Figure 9 This is an evaluation of the efficiency of combinatorial mutants in the miniREPAIR system; where RE represents the REPAIR system, REH represents the miniREPAIR system, and V5 represents the eminiREPAIR system. Figure 10 This is an evaluation of the efficiency of multiple endogenous sites in the miniREPAIR system combined mutants; where RE represents the REPAIR system, REH represents the miniREPAIR system, and V5 represents the eminiREPAIR system. Figure 11 This is a statistical analysis of the average editing efficiency of multiple endogenous sites in the miniREPAIR system combined mutants; where RE represents the REPAIR system, REH represents the miniREPAIR system, and V5 represents the eminiREPAIR system. Detailed Implementation
[0011] This invention discloses a highly efficient and compact RNA base editing system (eminiREPAIR). The system comprises a fusion protein of a protein-engineered, miniature inactivated Cas13 protein (emini-dPspCas13) and an adenosine deaminase domain (ADAR2DD). The emini-dPspCas13 is derived from the mini-dCas13 obtained by domain deletion of the original dCas13 protein, through directed evolutionary techniques to introduce multiple specific amino acid mutation sites into a specific loop region that interacts with crRNA. These mutations significantly enhance the binding affinity and stability of emini-dPspCas13 with crRNA, thereby significantly improving its editing efficiency compared to the original REPAIR system and the unoptimized miniREPAIR system. Furthermore, the system has a total size of 4.1 kb and can be packaged into a single somatic adeno-associated virus (AAV) vector. This eminiREPAIR system combines high efficiency with small size, making it suitable for precise RNA editing in various cells and in vivo.
[0012] The purpose of this invention is to provide a compact RNA base editing system (eminiREPAIR) with significantly improved editing efficiency. This highly efficient and compact RNA base editing system is a fusion protein comprising a miniature inactivating Cas13 protein (emini-dPspCas13b) and an adenosine deaminase domain (ADAR2DD). emini-dPspCas13b is obtained by deletion and mutation of dPspCas13b. The amino acid sequence of emini-dPspCas13b is based on mini-dPspCas13, containing five activity-enhancing mutations located in the loop region at its interaction interface with crRNA. These activity-enhancing mutations include E621R, A729R, E738R, D739R, and E875R (amino acid sequence based on the original dPspCas13b). Through protein engineering optimization of mini-dPspCas13, the resulting eminiREPAIR system significantly improves editing efficiency and has a size of less than 4.2 kb, overcoming the AAV delivery capacity limitation and solving the delivery bottleneck for in vivo applications. Design steps: Mutant screening and vector construction: Based on structural analysis, we identified the key loop regions in the dPspCas13b protein that interact with crRNA. For the amino acids in these regions, this invention designed site-directed mutagenesis and constructed plasmids containing 74 single-point mutants.
[0013] 2. Efficiency evaluation of single-point mutants: The plasmids of the above single-point mutants, along with the ADAR2DD expression cassette and the crRNA expression plasmid targeting the endogenous gene PPIB site, were co-transfected into HEK293T cells. The crRNA sequence of PPIB is caaagatcacccggccCacatcttcatctccaattcgtaggtcaaaatac. Forty-eight hours after transfection, cells were collected, total RNA was extracted and reverse transcribed into cDNA, and the target region was amplified by PCR. Sanger sequencing was used to identify the A-to-I editing efficiency.
[0014] The results showed that multiple single-amino acid mutations could improve editing efficiency. We successfully screened five superior mutants, all of which significantly improved editing efficiency compared to the unoptimized mutants, reaching more than 1.5 times the baseline efficiency. Figure 1 The five key mutation sites are: E621R, A729R, E738R, D739R, and E875R (amino acid position numbers are based on the original dPspCas13b protein sequence).
[0015] 3. Construction and efficiency verification of the combined mutant (eminiREPAIR) The five highly efficient single-point mutations (E621R, A729R, E738R, D739R, E875R) selected above were introduced into the gene sequence of mini-dPspCas13b to construct the combinatorial mutant emini-dPspCas13b. This combinatorial mutant gene was fused with the ADAR2DD gene via a flexible linker and cloned into an expression vector, ultimately constructing the eminiREPAIR system. Figure 2 ).
[0016] The constructed eminiREPAIR system expression plasmids were co-transfected into HEK293T cells with crRNA expression plasmids targeting different endogenous gene sites TUBB, TRDABP, and DNAH5. The following are the crRNA sequences targeting TUBB, TRDABP, and DNAH5 sites: TUBB: ccatggtcccaggttc C agatccaccaggatggcacgaggaacatatttg TADRBP: cacaccatcgtccatc C atcatatgtcgctgtgacattactTtcacttgt DNAH5: ctccatctgccgcatc Caacatgttaaaactcacctcctggtggatgttg Forty-eight hours after transfection, RNA extraction and Sanger sequencing analysis revealed that the eminiREPAIR system exhibited extremely high editing activity at all tested endogenous sites. Its efficiency was significantly higher than the original mini-REPAIR system, and compared to the original REPAIR system, the editing efficiency was also greatly improved. Figure 3 ).
[0017] In summary, this invention successfully provides a novel, highly efficient, and compact RNA base editing system called eminiREPAIR. Through rational protein engineering design, this system performs multi-site directed evolution on miniaturized dPspCas13b (mini-dPspCas13b), successfully obtaining the fusion protein emini-dPspCas13b-ADAR2DD containing five key activity-enhancing mutations: E621R, A729R, E738R, D739R, and E875R. Experimental data fully demonstrate that this eminiREPAIR system not only successfully compresses its size (the size of the eminiREPAIR system and its crRNA vector is 4.1kb), perfectly solving the AAV packaging capacity bottleneck (4.7kb) for in vivo delivery, but more importantly, its editing efficiency at endogenous gene sites significantly surpasses that of the original mini-REPAIR system and is far superior to the original REPAIR system.
[0018] 1. Construct minidCas13 Structural analysis revealed that the HEPN1 and HEPN2 domains interacted almost no with the crRNA structure; therefore, the HEPN1 and HEPN2 domains were deleted. Figure 4 ).
[0019] 2. Evaluate the editing efficiency of the miniREPAIR system A novel miniREPAIR system was constructed by using PCR and seamless cloning techniques to extract domains of the dPspCas13b protein, excluding the HEPN1 and HEPN2 domains. Figure 5 ).
[0020] Assessment of endogenous sites in HEK293 cells showed that the miniREPAIR system can achieve effective AI-based base editing. Figure 6 However, the editing efficiency of the miniREPAIR system has decreased to some extent. We further worked to improve the reduced editing efficiency of the miniREPAIR system.
[0021] 3. Improve the editing efficiency of the miniREPAIR system through directed protein evolution. By targeting loop regions in the protein structure that are close to crRNA, point mutations are performed on the amino acids in these regions to promote tighter binding with crRNA, thereby improving editing efficiency. Figure 7 ).
[0022] MiniREPAIR system mutants were constructed using point mutation methods. Evaluation at endogenous sites in HEK293 cells revealed the existence of miniREPAIR system mutants with enhanced efficiency. Figure 8 ).
[0023] By combining efficiency-enhancing mutants, we obtained the V5 system (eminiREPAIR system), which has improved efficiency compared to the REPAIR system. Figure 9 ).
[0024] Assessment of endogenous sites in HEK293 cells showed that the V5 system (eminiREPAIR system) successfully salvaged the editing efficiency downregulated by the miniREPAIR system at multiple endogenous sites in HEK293 cells. Figure 10 and 11 Therefore, we have obtained an efficient and compact RNA base editing system.
[0025] SEQ ID NO: 1 is the amino acid sequence of the REPAIR system; SEQ ID NO: 2 is the amino acid sequence of the miniREPAIR system; SEQ ID NO: 3 is the amino acid sequence of the eminiREPAIR system.
Claims
1. A modified, highly efficient, and compact RNA base editing system, characterized in that: The editing system is a fusion protein, which includes the mini-inactivated Cas13 protein emini-dPspCas13b and the adenosine deaminase domain ADAR2DD. emini-dPspCas13b is obtained by deletion and mutation of dPspCas13b. The amino acid sequence of emini-dPspCas13b is based on mini-dPspCas13, and contains 5 activity-enhancing mutations located in the loop region at its interaction interface with crRNA. The activity-enhancing mutations include E621R, A729R, E738R, D739R, and E875R. The amino acid sequence of eminiREPAIR is SEQ ID NO:
3.
2. The modified, highly efficient, and compact RNA base editing system according to claim 1, characterized in that: The construction process of eminiREPAIR: S1. Mutant screening and vector construction: The key loop region in the dPspCas13b protein that interacts with crRNA was identified, site-directed mutagenesis was designed, and plasmids containing 74 single-point mutants were constructed. S2. Efficiency evaluation of single-point mutants: Each single-point mutant plasmid was co-transfected with the ADAR2DD expression cassette and the crRNA expression plasmid targeting the endogenous gene PPIB site into HEK293T cells. The crRNA sequence of PPIB is caaagatcacccggccCacatcttcatctccaattcgtaggtcaaaatac. Five key mutation sites were identified: E621R, A729R, E738R, D739R, and E875R. S3. The five highly efficient single-point mutations selected were introduced into the gene sequence of mini-dPspCas13b to construct the combinatorial mutant emini-dPspCas13b.
3. The modified, highly efficient, and compact RNA base editing system according to claim 1 or 2, characterized in that: The combined mutant emini-dPspCas13b was fused via a flexible linker and cloned into an expression vector to construct the eminiREPAIR system.