Beta-glucosidase mutant and application of beta-glucosidase mutant in catalysis of flavonoid glycoside hydrolysis

By mutating specific amino acid sites of β-glucosidase, the catalytic activity and stability of the enzyme were improved, solving the problem of low yield and conversion rate in the hydrolysis of naringin to naringenin, and achieving more efficient naringenin production.

CN122012468APending Publication Date: 2026-05-12ZHEJIANG UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG UNIV OF TECH
Filing Date
2026-02-09
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In the existing technology, during the hydrolysis of naringin into naringenin, the enzyme activity is not coordinated and the stability is insufficient, resulting in low yield and conversion rate of naringenin, making it difficult to apply in industry.

Method used

By performing single-point or multi-point combined mutations on amino acids 49, 282, 306, and 445 of β-glucosidase, mutants such as D49E-I282V-Y306H-L445K were obtained, which improved the enzyme's catalytic activity and tolerance to high concentrations of substrates.

Benefits of technology

The mutant exhibits significantly enhanced enzyme activity and demonstrates excellent catalytic performance at lower temperatures for high concentrations of naringin, with naringin production increasing by 40% compared to the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012468A_ABST
    Figure CN122012468A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of enzyme catalysis, and discloses a beta-glucosidase mutant and application of the beta-glucosidase mutant in catalysis of flavone glycoside hydrolysis. In order to solve the problem of low catalytic activity of the existing beta-glucosidase, the mutant is obtained by carrying out single-point or multi-point combined substitution on 49th, 282nd, 306th and / or 445th amino acids of the beta-glucosidase from Pyrococcus furiosus, the mutant comprises single mutants V46A, D49E, I282V, Y306H and L445K and a double-site combined mutant V46A-L445K, and the single mutants V46A, D49E, I282V, Y306H and L445K are combined with the double-site combined mutant V46A, D49E, I282V, Y306H and L445K. The invention relates to a mutant strain, which is characterized in that the mutant strain comprises three site mutants, i.e., V46A-Y306H-L445K, V46A-D49E-L445K, D49E-Y306H-L445K, D49E-I282V-Y306H and I282V-Y306H-L445K, and four site mutants, i.e., D49E-I282V-Y306H, V46A-D49E-I282V-Y306H and V46A-D49E-Y306H-L445K. The mutant strain can be used for preparing a mutant strain. Experiments prove that the enzyme activity of the mutant is greatly improved compared with the catalytic activity of a wild type on a substrate naringin, and the mutant shows good tolerance on a high-concentration substrate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme catalysis technology, and in particular to a β-glucosidase mutant and its application in the catalytic hydrolysis of flavonoid glycosides. Background Technology

[0002] Citrus flavonoids possess antioxidant properties, strengthen capillary resilience, improve vascular permeability, and regulate cholesterol. They are a class of natural active substances widely found in citrus fruits. Natural citrus flavonoids generally exist in the form of glycosides, requiring degradation into aglycones by intestinal microorganisms before they can be absorbed and utilized by the body. However, due to the weak hydrolytic activity of intestinal microorganisms, the body has difficulty effectively utilizing natural citrus flavonoids, limiting their application and efficacy.

[0003] Currently, the main methods for converting citrus flavonoid glycosides into aglycones are acid hydrolysis and enzymatic hydrolysis. Acid hydrolysis has a high degree of hydrolysis and is fast, but it requires long-term high-temperature treatment, resulting in high energy consumption and costs, and is cumbersome. Furthermore, the acidic organic waste generated during the reaction pollutes the environment. Enzymatic hydrolysis, on the other hand, utilizes the specific catalytic action of enzymes, operates under milder conditions, better protects the acid-sensitive aglycone structure, and catalyzes the hydrolysis of sugar groups. It has unique advantages and is a green and environmentally friendly process.

[0004] β-D-Glucosidase (Bgl, EC 3.2.1.21) is a class of glycosidic hydrolases that release β-D-glucose and the corresponding ligand by hydrolyzing the non-reducing β-D-glucosidic bond at the end of the substrate. As an important biocatalyst, β-glucosidase is widely recognized for its application in the production of flavonoid glycosylation products. For example, Shin et al. used β-glucosidase from Pyrococcus furiosus to hydrolyze hesperidin from orange peel extract, completely converting 18.2 g / L hesperidin to 9.0 g / L hesperidin within 9 hours, with a yield of 1.00 g L⁻¹ h⁻¹. Lu et al. achieved a 70% conversion rate of 60 mM naringin after 24 hours using an enzymatic cascade reaction between α-rhamnosidase and β-glucosidase.

[0005] However, while enzymatic hydrolysis of flavonoid glycosides shows promise for production, it still faces several challenges. Currently, the main enzymes used for naringin hydrolysis include naringinase, α-rhamnosidase, and β-glucosidase. However, the incoordination and insufficient stability of naringinase hinder the hydrolysis of naringin to naringenin. α-rhamnosidase and β-glucosidase are generally used in cascade for naringin hydrolysis, which increases enzyme costs and makes it difficult to unify and coordinate the optimal reaction conditions such as temperature, pH, and substrate concentration for both enzymes. The main challenge in naringin hydrolysis is the still low yield and conversion rate of naringenin, making its industrial application difficult. Summary of the Invention

[0006] To address the current technical problems of yield and conversion rate of naringin to naringenin, and more specifically, to solve the technical problem of low activity of β-glucosidase in catalyzing the conversion of naringin, this invention provides a β-glucosidase mutant and its application in catalyzing the hydrolysis of flavonoid glycosides.

[0007] The specific technical solution of this invention is as follows:

[0008] This invention provides

[0009] In a first aspect, a β-glucosidase mutant is provided, which is obtained by single-point mutation or multi-point combination mutation at the following sites in the amino acid sequence shown in SEQ ID NO.1:

[0010] (a) The valine (V) at position 46 is mutated to alanine (A);

[0011] (b) The 49th aspartic acid (D) is mutated to glutamic acid (E);

[0012] (c) The isoleucine (I) at position 282 is mutated to valine (V);

[0013] (d) Tyrosine (Y) at position 306 is mutated to histidine (H);

[0014] (e) The leucine (L) at position 445 is mutated to lysine (K).

[0015] To address the current problem of low catalytic activity and efficiency of β-glucosidase, this invention obtains a mutant by single-point or multi-point combined substitution of amino acids at positions 49, 282, 306, and / or 445 of the wild-type β-glucosidase shown in SEQ ID NO.1. The substitutions are: V46A, D49E, I282V, Y306H, and L445K. The particularly preferred mutants are: single mutants V46A, D49E, I282V, Y306H, and L445K; the two-site combination mutant V46A-L445K; the three-site combination mutants V46A-Y306H-L445K, V46A-D49E-L445K, D49E-Y306H-L445K, D49E-I282V-Y306H, and I282V-Y306H-L445K; and the four-site mutants D49E-I282V-Y306H-L445K, V46A-D49E-I282V-Y306H, and V46A-D49E-Y306H-L445K. These preferred mutants exhibit significantly enhanced enzyme activity relative to the wild type for the substrate naringin. The β-glucosidase mutant provided by this invention has a significantly higher relative enzyme activity than the wild type and exhibits better tolerance to high concentrations of substrate.

[0016] Among them, the wild-type β-glucosidase is derived from Pyrococcus furiosus, whose amino acid sequence is shown in SEQ ID NO.1 and whose encoding gene sequence is shown in SEQ ID NO.2.

[0017] Preferably, the β-glucosidase mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 as follows: aspartic acid (D) at position 49 is mutated to glutamic acid (E), isoleucine (I) at position 282 is mutated to valine (V), tyrosine (Y) at position 306 is mutated to histidine (H), and leucine (L) at position 445 is mutated to lysine (K). Verification showed that the four-site mutant D49E-I282V-Y306H-L445K exhibited optimal enzyme activity and excellent tolerance to high substrate concentrations; at a substrate concentration of 10 g / L naringin, its 24-hour naringin production was increased by 40% compared to the wild type.

[0018] Secondly, the provider offers a gene encoding the aforementioned β-glucosidase mutant. For example, the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 4. The amino acid sequence encoded by the encoding gene is shown in SEQ ID NO. 3.

[0019] Thirdly, a recombinant vector is provided, which contains the aforementioned coding gene. This invention relates to recombinant expression vectors containing the said coding gene. The vector can be a plasmid, bacteriophage, virus, or other conventional vectors in the art.

[0020] Preferably, the carrier is pET-28a.

[0021] Fourthly, a genetically engineered bacterium is provided, comprising the aforementioned coding gene or the aforementioned recombinant vector. The genetically engineered bacterium can be any conventional host microorganism in the art, primarily satisfying the requirement that the recombinant expression vector can stably self-replicate and that the β-glucosidase mutant gene of the present invention carried by it can be effectively expressed.

[0022] Preferably, the genetically engineered bacterium is Escherichia coli.

[0023] Fifthly, an application of a β-glucosidase mutant in the catalytic hydrolysis of flavonoid glycosides is provided.

[0024] Preferably, the flavonoid glycoside is naringin.

[0025] Preferably, the reaction includes the following steps: using naringin as a substrate and a β-glucosidase mutant as a catalyst, the catalytic reaction is carried out at a temperature not exceeding 75°C.

[0026] The β-glucosidase mutant can be used as a catalyst in whole-cell form, as a crude enzyme solution from cell lysis, or as a partially or completely purified enzyme protein. If necessary, the β-glucosidase mutant of this invention can also be used to prepare an immobilized enzyme or immobilized cell form using immobilization technology.

[0027] Preferably, the reaction is carried out in a citrate buffer solution with a pH of 4.5-6.5 at 45-65°C until the reaction is complete, and then naringenin is obtained.

[0028] In the reaction, when the catalyst is wet bacterial cells, the amount of wet bacterial cells added is OD 600 =15~25, cell to substrate volume ratio 1:1; when the catalyst is a pure enzyme, the amount of pure enzyme added is 0.01~1.0g / L; the final concentration of added naringin is 1-3g / L.

[0029] Compared with the prior art, the present invention has the following technical effects:

[0030] The present invention obtains the above-mentioned mutant by single-point or multi-point combined substitution of amino acids at positions 49, 282, 306 and / or 445 of the wild-type β-glucosidase shown in SEQ ID NO.1, wherein the substitutions are: V46A, D49E, I282V, Y306H, L445K. The particularly preferred mutants are: single mutants V46A, D49E, I282V, Y306H, and L445K; the two-site combination mutant V46A-L445K; the three-site combination mutants V46A-Y306H-L445K, V46A-D49E-L445K, D49E-Y306H-L445K, D49E-I282V-Y306H, and I282V-Y306H-L445K; and the four-site mutants D49E-I282V-Y306H-L445K, V46A-D49E-I282V-Y306H, and V46A-D49E-Y306H-L445K. These preferred mutants exhibit significantly enhanced enzyme activity relative to the wild type for the substrate naringin. The β-glucosidase mutant provided by this invention has a significantly higher relative enzyme activity than the wild type and exhibits better tolerance to high concentrations of substrate. Attached Figure Description

[0031] Figure 1 This is the result of the first round of screening for β-glucosidase mutations in this invention.

[0032] Figure 2 This is the result of the second round of screening for β-glucosidase mutations in this invention.

[0033] Figure 3 This is the result of the third round of screening for β-glucosidase mutations in this invention.

[0034] Figure 4 This is the result of the fourth round of screening for β-glucosidase mutations in this invention.

[0035] Figure 5 The results show the detection of naringin catalyzed by the mutant D49E-I282V-Y306H-L445K at 55℃.

[0036] Figure 6 The results show the detection of naringin catalyzed by the mutant D49E-I282V-Y306H-L445K at 65℃.

[0037] Figure 7 The results show the detection of naringin catalyzed by the mutant D49E-I282V-Y306H-L445K at 75℃.

[0038] Figure 8The results show the detection of naringin catalyzed by the mutant D49E-I282V-Y306H-L445K at 85℃.

[0039] Figure 9 The results show the detection of 10 g / L naringin catalyzed by the mutant D49E-I282V-Y306H-L445K. Detailed Implementation

[0040] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0041] Example 1: Construction of β-glucosidase genetically engineered bacteria

[0042] The amino acid sequence of β-glucosidase derived from *Pyrococcus furiosus* is shown in SEQ ID NO. 1, with NCBI accession number WP_011011185. This gene sequence was given to a gene synthesis company (Suzhou Genewise Biotechnology Co., Ltd.), where codon optimization was performed, the entire gene was synthesized, and cloned into the recombinant expression plasmid pET-28a(+), resulting in the recombinant plasmid pET28a(+)-Bgl. This recombinant plasmid pET28a(+)-Bgl was then transformed into *E. coli* BL21(DE3) competent cells to obtain the recombinant genetically engineered bacterium BL21(DE3) / pET28a(+)-Bgl. The codon-optimized β-glucosidase gene sequence is shown in SEQ ID NO. 2.

[0043] Example 2: Induced expression of β-glucosidase

[0044] The recombinant Escherichia coli BL21(DE3) / pET28a(+)-Bgl obtained in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 180 rpm for 12 h. Then, it was inoculated into fresh fermentation medium containing 50 μg / mL kanamycin resistance at a 1% (v / v) inoculation rate and cultured at 37°C and 180 rpm until the bacterial cell OD reached 100%. 600The concentration was increased to 0.7, and IPTG was added to a final concentration of 0.5 mM. After induction culture at 24℃ for 10 h, the mixture was centrifuged at 4℃ and 5500 rpm for 15 min. The supernatant was discarded, and the precipitate was collected to obtain recombinant E. coli BL21(DE3) / pET28a(+)-Bgl wet cells containing the recombinant expression plasmid. These wet cells can be used directly as a biocatalyst or for protein purification.

[0045] Example 3: Purification of β-glucosidase

[0046] The wet bacterial cells obtained in Example 2 were resuspended in deionized water and then sonicated (under ice bath conditions, 240W for 10 min, 2 s operation, 2 s pause), centrifuged at 5500 rpm for 30 min, and the supernatant was incubated with Ni affinity chromatography resin equilibrated with equilibration buffer. Then, the supernatant was washed with washing buffer (50 mM, pH 7.4 sodium phosphate buffer containing 300 mM NaCl and 50 mM imidazole) until there were basically no contaminating proteins. Subsequently, the eluent was eluted with elution buffer (50 mM, pH 7.4 sodium phosphate buffer containing 300 mM NaCl and 300 mM imidazole) and the eluent was collected to obtain the target protein. The target protein was dialyzed overnight with dialysis buffer (50 mM, pH 7.4 sodium phosphate buffer) to obtain the β-glucosidase enzyme solution.

[0047] Example 4: Construction of a β-glucosidase mutant library

[0048] In this embodiment, the E. coli BL21(DE3) / pET28a(+)-Bgl strain constructed in Example 1 was used as the starting strain, and the ancestral sequence reconstruction method was used to guide the modification.

[0049] Based on ancestral sequence alignment, site-directed mutagenesis was performed at sites 3, 9, 46, 49, 51, 189, 200, 240, 250, 257, 277, 282, 289, 294, 306, 338, 367, 376, 387, 400, 429, 434, 445, and 450.

[0050] Primer design is shown in Table 1. Using the primers designed in Table 1, and with E. coli BL21(DE3) / pET28a(+)-Bgl as a template, mutagenic PCR was performed to mutate the above-mentioned sites. The mutagenic PCR system (50 μL) consisted of: 25 μL of 2×Phanta UniFi Buffer, 1 μL of DNA Polymerase, 2 μL each of the upper and lower mutagenic primers, 1 μL of template (starting strain), and ddH2O added to a final volume of 50 μL. The PCR conditions were: 98℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 60℃ for 10 s, 72℃ for 2 min, and a final extension at 72℃ for 5 min. The PCR results were verified by DNA agarose gel electrophoresis. The PCR products were then digested with DpnI enzyme at 37℃ for 1 hour, followed by inactivation at 65℃ for 1 minute. The ligation system (10 μL) consisted of: 2 μL of digestion product, 5 μL of DNAAssembly Mix, and ddH2O added to a final volume of 10 μL. The reaction mixture was incubated at 50 °C for 15 min. 10 μL of the reaction solution was then added to 100 μL of competent cells, gently aspirated and mixed, and incubated on ice for 30 min. The cells were then heat-shocked at 42 °C for 60 s and incubated on ice for 5 min. 500 μL of ILB medium was added, and the cells were incubated at 37 °C with shaking for 60 min. The bacterial culture was then evenly spread onto a plate containing kanamycin and incubated upside down at 37 °C overnight.

[0051] Table 1. Primer design for site-directed mutagenesis of β-glucosidase Mutant Primer sequence F3W-F GGCAGCCATATGAAATGGCCGAAAAACTTTATGTTTGGCTATAGCTG F3W-R TTTCATATGGCTGCCGCGC F9W-F ATTTCCGAAAAACTTTATGTGGGGCTATAGCTGGAGCGGC F9W-R CATAAAGTTTTTCGGAAATTTCATATGGCTGC V46A-F ATTGCGAGCGGCCTGGCGAGCGGCGATCTGCCGG V46A-R CAGGCCGCTCGCAATGTTTTC D49E-F CCTGGTGAGCGGCGAACTGCCGGAAAACGGCCCGGC D49E-R GCCGCTCACCAGGCCGCTCG P51L-F GTGAGCGGCGATCTGTTTGAAAACGGCCCGGCGTATTG P51L-R CAGATCGCCGCTCACCAG A189E-F ATTTGTGAAATTTGCGGAATTTGTGGCGTATCATCTGGATGATCTG A189E-R CGCAAATTTCACAAATTCCACCACG D200K-F CATCTGGATGATCTGGTGAAAATGTGGAGCACCATGAACGAACC D200K-R CACCAGATCATCCAGATGATACGCC L240Q-F [[ID=4O]]AAAAAGCGAAATTTAACCAAATTCAAGCGCATATTGGCGCG L240Q-R GTTAAATTTCGCTTTTTCCGCCGC A250R-F TGGCGCGTATGATCGCATTAAAGAATATAGCGAAAAAAGCGTGGGC A250R-R ATCATACGCGCCAATATGCGC K257E-F CGATTAAAGAATATAGCGAAGAAAGCGTGGGCGTGATTTATGC K257E-R TTCGCTATATTCTTTAATCGCATCATACGC D277E-F GAAGAATATAAAGAAGAAGTGGAAGAAATTCGCAAAAAAGATTATG D277E-R TTTATATTCTTCCGCCAGCGGATCAT I282V-F GAAGTGGAAGAAGTGCGCAAAAAAGATTATGAATTTGTGACCATTCTG I282V-R TTCTTCCACTTCATCTTTATATTCTTCCGCC F289M-F CGCAAAAAAGATTATGAAATGGTGACCATTCTGCATAGCAAAGGC F289M-R TTCATAATCTTTTTTGCGAATTTCTTCCACTTC H294E-F GAATTTGTGACCATTCTGGAAAGCAAAGGCAAACTGGATTGGAT H294E-R CAGAATGGTCACAAATTCATAATCTTTTTTGCGA Y306H-F TGGATTGGCGTGAACCATTATAGCCGTTTAGTGTATGGCGCG Y306H-R GTTCACGCCAATCCAATCCAGT G338D-F GGCTTTGCGAAAAGCGATCGCCCGGCGAGC G338D-R GCTTTTCGCAAAGCCGCCG P367S-F CAACGCGTATGAACTGAGCATGATTATTACCGAAAACGGCATGGC P367S-R CAGTTCATACGCGTTGTTCAGATATTTCAG A376S-F ACCGAAAACGGCATGAGCGATGCGGCGGATCGCTATC A376S-R CATGCCGTTTTCGGTAATAATCATCGG L387I-F TCGCCCGCATTATATTGTGAGCCATCTGAAAGCGGTG L387I-R ATAATGCGGGCGATAGCGATC E400D-F GCGGTGTATAACGCGATGAAAGATGGCGCGGATGTGCG E400D-R TTTCATCGCGTTATACACCGCTTTC V429I-F GCGCTTTGGCCTGATTTATGTGGATTTTGAAACCAAAAAACGCT V429I-R CAGGCCAAAGCGCATGC E434Q-F CCTGGTGTATGTGGATTTTCAAACCAAAAAACGCTATCTGCGC E434Q-R AAAATCCACATACACCAGGCCAAAG L445K-F TGCGCCCGAGCGCGAAAGTGTTTCGCGAAATTGCGACGCA L445K-R CGCGCTCGGGCGCAGATA I450L-F TGGTGTTTCGCGAACTGGCGACGCAGAAAGAAATTCCG I450L-R TTCGCGAAACACCAGCGC .

[0052] Example 5: Screening of β-glucosidase gene mutant libraries

[0053] 1. First round of screening

[0054] Preparation of reaction solution (1000 μL): The final concentration of substrate naringin was 1 g / L, and the catalyst was pure enzyme with a final concentration of 0.1 g / L. Citrate buffer (pH 5.5) was used as the reaction medium. The reaction was carried out at 55℃ and 1200 rpm for 1 hour. After the reaction, 200 μL of sample was added to 800 μL of methanol for inactivation and diluted 5 times. High-performance liquid chromatography (HPLC) was used for detection. HPLC detection conditions for naringin and naringenin were as follows: 500 μL of the centrifuged reaction solution was added to the HPLC sample vial. The chromatographic column was ODS InertSustain C18 (5 μm). The mobile phase was: acetonitrile:water = 25:75 for 0-6 min, acetonitrile:water = 45:55 for 6-15 min, and acetonitrile:water = 25:75 for 15-26 min. The injection volume was 10 μL, the detection wavelength was 282 nm, and the flow rate was 0.8 mL / min. The detection results are as follows. Figure 1 As shown.

[0055] Depend on Figure 1 The screening results showed that mutant strains V46A, D49E, I282V, Y306H, and L445K had a relative enzyme activity that was more than 20% higher than that of WT strains. Therefore, these mutant strains were selected for further screening.

[0056] 2. Second round of screening

[0057] The strains and their mutation sites (V46A, D49E, I282V, Y306H, L445K) obtained in the first round of screening were re-screened, and a second round of screening was conducted by iterative pairwise screening of the mutation sites. The reaction solution (1000 μL) was prepared with a final concentration of 1 g / L of the substrate naringin and a final concentration of 0.1 g / L of pure enzyme as the catalyst, using citrate buffer at pH 5.5 as the reaction medium. The reaction was carried out in a reactor at 55℃ and 1200 rpm for 1 hour. After the reaction, 200 μL of the sample was added to 800 μL of methanol for inactivation and diluted 5 times. Detection was performed by high-performance liquid chromatography (HPLC), and the results are as follows: Figure 2 As shown.

[0058] Depend on Figure 2 Screening results showed that the mutant V46A-L445K had increased enzyme activity compared to L445K.

[0059] 3. Third round of screening

[0060] The strains and their mutation sites (V46A, D49E, I282V, Y306H, L445K) obtained in the first round of screening were subjected to a third round of screening, specifically through a three-by-three iterative combination of the aforementioned mutation sites. The reaction solution (1000 μL) was prepared with a final concentration of 1 g / L of the substrate naringin and a catalyst of 0.1 g / L pure enzyme, using citrate buffer at pH 5.5 as the reaction medium. The reaction was carried out at 55℃ and 1200 rpm for 1 hour. After the reaction, 200 μL of the sample was added to 800 μL of methanol for inactivation and diluted 5 times. Detection was performed using high-performance liquid chromatography (HPLC), and the results are as follows: Figure 3 As shown.

[0061] Depend on Figure 3 The screening results showed that the enzyme activities of mutants V46A-Y306H-L445K, V46A-D49E-L445K, D49E-Y306H-L445K, D49E-I282V-Y306H, and I282V-Y306H-L445K were higher than those of the two-site mutant V46A-L445K, with V46A-Y306H-L445K exhibiting the highest enzyme activity.

[0062] 4. Fourth round of screening

[0063] The strains and their mutation sites (V46A, D49E, I282V, Y306H, L445K) obtained in the first round of screening were subjected to a fourth round of screening, specifically through a four-by-four iterative combination of the aforementioned mutation sites. The reaction solution (1000 μL) was prepared with a final concentration of 1 g / L of the substrate naringin and a catalyst of 0.1 g / L pure enzyme, using citrate buffer at pH 5.5 as the reaction medium. The reaction was carried out at 55℃ and 1200 rpm for 1 hour. After the reaction, 200 μL of the sample was added to 800 μL of methanol for inactivation and diluted 5-fold. Detection was performed using high-performance liquid chromatography (HPLC), and the results are as follows: Figure 4 As shown.

[0064] Depend on Figure 4 The screening results showed that the enzyme activity of mutant D49E-I282V-Y306H-L445K was higher than that of triple mutant V46A-Y306H-L445K. In addition, the enzyme activities of V46A-D49E-I282V-Y306H and V46A-D49E-Y306H-L445K were also at a high level, at least 80% of those of triple mutant V46A-Y306H-L445K.

[0065] Example 6: The process of naringin production from β-glucosidase-expressing engineered bacterial mutant D49E-I282V-Y306H-L445K catalyzing the reaction of naringin at different temperatures.

[0066] The four-site mutant D49E-I282V-Y306H-L445K obtained in Example 5 was used to prepare wet bacterial cells of the β-glucosidase mutant D49E-I282V-Y306H-L445K according to the method in Example 2. A 20 mL reaction system was constructed using the wet bacterial cells of D49E-I282V-Y306H-L445K as a catalyst, naringin as a substrate, and citrate buffer at pH 5.5 as the reaction medium. The bacterial cell addition amount was 10 mL (OD). 600 =20), the amount of naringin added was 10 mL, the final concentration of naringin was 1 g / L, and 200 μL of the reaction solution was added to a 1.5 mL EP tube containing 800 μL of methanol to terminate the reaction. Centrifuge at 12000 rpm for 3 min, and take 500 μL of the supernatant into a liquid chromatography bottle for HPLC detection of naringin. Detection of naringin concentration: Column: ODS InertSustain C18 (5 μm), mobile phase: 0-6 min acetonitrile:water = 25:75, 6-15 min acetonitrile:water = 45:55, 15-26 min acetonitrile:water = 25:75, injection volume: 10 μL, detection wavelength: 282 nm, flow rate: 0.8 mL / min.

[0067] The above reaction system was catalyzed at 55℃, and the amount of naringenin produced was measured at different time points. The results of the catalytic reaction of naringin by the β-glucosidase mutant D49E-I282V-Y306H-L445K and the wild type were as follows: Figure 5 As shown. From Figure 5 As can be seen, the mutant D49E-I282V-Y306H-L445K catalyzes naringin at 55℃, and the conversion rate is increased by 22% compared with the wild type.

[0068] The above reaction system was catalyzed at 65℃, and the amount of naringenin produced was measured at different time points. The results of the catalytic reaction of naringin by the β-glucosidase mutant D49E-I282V-Y306H-L445K and the wild type were as follows. Figure 6 As shown. From Figure It can be seen that the mutant D49E-I282V-Y306H-L445K exhibits a higher catalytic rate for naringin at 65℃ compared to the wild type; combined with ​ It is evident that the mutant D49E-I282V-Y306H-L445K exhibits significantly enhanced catalytic activity at medium and low temperatures compared to the wild type.

[0069] The above reaction system was catalyzed at 75℃, and the amount of naringenin produced was measured at different time points. The results of the catalytic reaction of naringin by the β-glucosidase mutant D49E-I282V-Y306H-L445K and the wild type were as follows: ​ As shown. From ​ As can be seen, the catalytic rate of the mutant D49E-I282V-Y306H-L445K at 75℃ is also improved compared with that of the wild type.

[0070] The above reaction system was catalyzed at 85℃, and the amount of naringenin produced was measured at different time points. The results of the β-glucosidase mutant D49E-I282V-Y306H-L445K and the wild-type catalyzed reaction of naringin to produce naringenin are as follows. ​ As shown. From ​ As can be seen, at 85℃, the catalytic rate of the mutant D49E-I282V-Y306H-L445K is similar to that of the wild type.

[0071] This shows that the β-glucosidase mutant D49E-I282V-Y306H-L445K exhibits superior catalytic activity compared to the wild type at medium and low temperatures.

[0072] Example 7: Whole-cell catalytic reaction of naringin to naringenin by mutant D49E-I282V-Y306H-L445K at 65°C

[0073] The four-site mutant D49E-I282V-Y306H-L445K obtained in Example 5 was used to prepare wet cells of the β-glucosidase mutant D49E-I282V-Y306H-L445K according to the method in Example 2. A 20 mL reaction system was constructed using the wet cells of D49E-I282V-Y306H-L445K as a catalyst, naringin as a substrate, and citrate buffer at 65°C and pH 5.5 as the reaction medium. After centrifugation, the wet cells were resuspended in a 10 g / L naringin solution (OD600 = 50). 100 μL of the reaction solution was added to a 1.5 mL EP tube containing 900 μL of methanol to terminate the reaction. The mixture was centrifuged at 12000 rpm for 3 min, and 500 μL of the supernatant was transferred to a liquid chromatography bottle for HPLC detection of naringin. Detection of naringenin concentration: chromatographic column: ODS InnertSustain C18 (5 μm), mobile phase: 0-6 min acetonitrile:water = 25:75, 6-15 min acetonitrile:water = 45:55, 15-26 min acetonitrile:water = 25:75, injection volume: 10 μL, detection wavelength: 282 nm, flow rate: 0.8 mL / min.

[0074] The above-mentioned reaction system containing 10 g / L of naringin substrate was used for catalytic reaction. Samples were taken at different time points to detect the amount of naringin produced. The results of the β-glucosidase mutant D49E-I282V-Y306H-L445K and the wild-type catalyzing the reaction of naringin to produce naringin are as follows: ​ As shown. From ​ As can be seen, the mutant D49E-I282V-Y306H-L445K produced 40% more naringenin at 65℃ for 24 hours than the wild type.

[0075] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0076] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A β-glucosidase mutant, characterized in that: It is obtained by performing single-point or multi-point combination mutations at the following sites on the amino acid sequence shown in SEQ ID NO.1: (a) The valine at position 46 is mutated to alanine; (b) The aspartic acid at position 49 is mutated to glutamic acid; (c) The isoleucine at position 282 is mutated to valine; (d) Tyrosine at position 306 is mutated to histidine; (e) Leucine at position 445 is mutated to lysine.

2. The β-glucosidase mutant as described in claim 1, characterized in that: It is obtained by the following mutation of the amino acid sequence shown in SEQ ID NO.1: The 49th position of aspartic acid mutated to glutamic acid, while the 282nd position of isoleucine mutated to valine, the 306th position of tyrosine mutated to histidine, and the 445th position of leucine mutated to lysine.

3. The encoding gene of the β-glucosidase mutant as described in any one of claims 1 to 2.

4. A recombinant vector, characterized in that: It includes the coding gene as described in claim 3.

5. The recombinant vector as described in claim 4, characterized in that: The carrier is pET-28a.

6. A genetically engineered bacterium, characterized in that: It contains the coding gene as described in claim 3 or the recombinant vector as described in claim 4.

7. The genetically engineered bacteria as described in claim 6, characterized in that: The genetically engineered bacteria is Escherichia coli.

8. The application of the β-glucosidase mutant as described in claim 1 in the catalytic hydrolysis of flavonoid glycosides.

9. The application as described in claim 8, characterized in that: The flavonoid glycoside is naringin.

10. The application as described in claim 8, characterized in that: The reaction includes the following steps: using naringin as a substrate and a β-glucosidase mutant as a catalyst, the catalytic reaction is carried out at a temperature not exceeding 75°C.