Double-stranded ribonucleic acid for inhibiting CIDEB gene expression, and modifier, conjugate and application thereof

By developing double-stranded ribonucleic acid and its modifications, the expression of the CIDEB gene is specifically inhibited, solving the problem of the lack of CIDEB inhibitors in existing technologies and achieving highly efficient treatment of CIDEB-related diseases.

CN122012496APending Publication Date: 2026-05-12BEIJING WINSUNNY PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING WINSUNNY PHARMA CO LTD
Filing Date
2025-11-10
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Current technologies lack effective CIDEB gene inhibitors, making it impossible to effectively treat CIDEB-related diseases such as liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, and hepatic steatosis.

Method used

Develop double-stranded RNA, double-stranded RNA modifiers, double-stranded RNA conjugates, and prodrugs to specifically inhibit the expression of the CIDEB gene by cleaving its transcript through RNA-induced silencing complex (RISC)-mediated cleavage.

Benefits of technology

It effectively and specifically inhibits CIDEB gene expression, treating CIDEB-related diseases, including liver fibrosis, hepatitis B, and hepatitis C, reducing disease risk and improving treatment efficacy and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_5
    Figure SMS_5
  • Figure SMS_24
    Figure SMS_24
  • Figure SMS_25
    Figure SMS_25
Patent Text Reader

Abstract

The present disclosure relates to a double-stranded ribonucleic acid for inhibiting CIDEB gene expression, and modifiers, conjugates and uses thereof. Specifically, the present disclosure relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and use for inhibiting CIDEB gene expression, and a method for inhibiting intracellular CIDEB gene expression. The double-stranded ribonucleic acid provided by the invention can be combined in cells to form an RNA induced silence complex (RISC), cut mRNA transcribed by the CIDEB gene and efficiently and specifically inhibit the expression of the CIDEB gene, is used for treating CIDEB gene mediated diseases, and has an important application prospect in clinical disease treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure pertains to the field of biomedicine. Specifically, this disclosure relates to a double-stranded ribonucleic acid (BRNA) for inhibiting CIDEB gene expression, a BRNA modification, a BRNA conjugate, a prodrug, a pharmaceutical composition, and its use, as well as a method for inhibiting intracellular CIDEB gene expression. Background Technology

[0002] Cell death-inducing DFFA (DNA Fragmentation Factor A, α subunit)-like effector b (CIDEB) is a member of the CIDE protein family, primarily expressed in the liver and small intestine. It is a protein associated with the endoplasmic reticulum (ER) and lipid droplets (LD). CIDEB protein expression induces cell death, and its physiological functions are related to various lipid metabolism processes, particularly promoting the lipidation and maturation of very low-density lipoprotein (VLDL) particles, playing a crucial role in maintaining hepatic lipid homeostasis. CIDEB protein promotes lipid absorption and storage in the liver and intestine; its overexpression can cause hepatocyte damage and lipid metabolism imbalance, a process that can easily lead to hepatic steatosis.

[0003] In summary, inhibiting the expression of the CIDEB gene in patients can prevent and treat metabolic disorders such as liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, and metabolic disorders. Currently, there are no drugs on the market that specifically target the expression of this gene; therefore, developing drugs that target CIDEB is of significant value. Summary of the Invention

[0004] The problem the invention aims to solve This disclosure aims to provide double-stranded ribonucleic acid (BRNA), BRNA modifiers, BRNA conjugates, prodrugs, and pharmaceutical compositions that are effectively applied to RNA-induced silencing complex (RISC)-mediated cleavage of the CIDEB gene RNA transcript, thereby selectively and effectively inhibiting CIDEB gene expression and achieving the goal of disease treatment.

[0005] Given the problems existing in the prior art, such as the need to develop more CIDEB inhibitors for the treatment of CIDEB-related diseases including liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, metabolic disorders, and other unidentified related conditions, pathologies, or syndromes, this disclosure aims to provide a series of double-stranded ribonucleic acid (DRNA), DRNA modifications, DRNA conjugates, prodrugs, and pharmaceutical compositions for inhibiting CIDEB gene expression, which have significant application prospects in clinical disease treatment.

[0006] Solution for solving the problem [1]. A double-stranded ribonucleic acid that inhibits the expression of the CIDEB gene, the double-stranded ribonucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are anticomplementary and / or substantially anticomplementary to form a double-stranded region of the double-stranded ribonucleic acid; The sense strand comprises a sequence A that differs from the target sequence by no more than 3 nucleotides in at least 15 consecutive nucleotides, and the antisense strand comprises a sequence B that differs from the target sequence by no more than 3 nucleotides in its reverse complementary sequence of at least 15 consecutive nucleotides. The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NO: 1 to 9 and the sequence consisting of at least 15 consecutive nucleotides contained in any one of SEQ ID NO: 1 to 9.

[0007] [2]. According to the double-stranded ribonucleic acid of [1], wherein the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO: 1, 4, 6-15, the sense strand comprises sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NO: 1, 4, 6-15, and the antisense strand comprises sequence B consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NO: 1, 4, 6-15 that is anticomplementary to and / or substantially anticomplementary to the sequence.

[0008] [3]. According to the double-stranded ribonucleic acid described in [1] or [2], wherein the positive strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21 or 23 nucleotides.

[0009] [4]. According to the double-stranded ribonucleic acid described in [3], wherein the nucleotide sequence of the positive strand is a sequence A that differs by no more than 1 nucleotide from the sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NO: 1, 4, 6-15, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and even more preferably 19, 21 or 23 nucleotides.

[0010] [5]. The double-stranded ribonucleic acid according to any one of [1]-[4], wherein the antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21 or 23 nucleotides.

[0011] [6]. According to the double-stranded ribonucleic acid of [5], wherein the nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides in any one of the nucleotide sequences shown in SEQ ID NO: 1, 4, 6-15, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and even more preferably 19, 21 or 23 nucleotides.

[0012] [7]. The double-stranded ribonucleic acid according to any one of [1]-[6], wherein the length of the double-stranded region is 15-25 nucleotides, preferably 19-23 nucleotides, more preferably 19, 21 or 23 nucleotides.

[0013] [8]. According to any one of [1]-[7], the double-stranded ribonucleic acid, wherein, The sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, while the 3' end of the sense strand has a blunt end; or, The positive chain and the negative chain complement each other to form the double-chain region, and both the positive chain and the negative chain have flat ends at their 3' ends.

[0014] [9]. The double-stranded ribonucleic acid according to any one of [1]-[8], wherein the sense strand and the antisense strand are selected from the following combinations: The sense strand includes the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 of this document, and the antisense strand includes the antisense strand of the corresponding siRNA. Preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand includes the sense strand of any one of the siRNAs listed in Tables 1 and 1-1 of this document: siRNA 64, siRNA 224, siRNA 282, and siRNA 299. The antisense strand includes the antisense strand of the corresponding siRNA.

[0015]

[10] . A double-stranded ribonucleic acid according to any one of [1]-[9], wherein each nucleotide in the sense strand is independently a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0016]

[11] . The double-stranded ribonucleic acid according to any one of [1]-

[10] , wherein any two nucleotides in the sense strand are linked by a phosphodiester bond or a thiophosphate diester bond, and / or any two nucleotides in the antisense strand are linked by a phosphodiester bond or a thiophosphate diester bond.

[0017]

[12] . The double-stranded ribonucleic acid according to any one of [1]-

[11] , wherein the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group, or the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0018]

[13] . The double-stranded ribonucleic acid according to any one of [1]-

[12] , wherein neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 3' end nucleotide and / or the 5' end nucleotide of the positive strand is connected to a reverse debased deoxyribose residue.

[0019]

[14] . The double-stranded ribonucleic acid according to any one of [1]-

[13] , wherein the double-stranded ribonucleic acid is siRNA for inhibiting the expression of the CIDEB gene.

[0020]

[15] . A double-stranded ribonucleic acid (BRNA) modifier, which is a BRNA modifier as described in any one of [1]-

[14] , said BRNA modifier comprising at least one of the following chemical modifications: (1) Modification of at least one nucleotide in the positive strand, (2) Modification of the phosphodiester bond at at least one position in the positive chain. (3) Modification of at least one nucleotide in the antisense strand, (4) Modification of the phosphodiester bond at at least one position in the antisense chain; Optionally, the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modification includes sequence B and sequence E, wherein the 3' end of sequence B in the antisense strand is connected to sequence E, which consists of 1-2 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; Optionally, the sense and antisense strands of the double-stranded ribonucleic acid modification are selected from the following sequence combinations: The nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E.

[0021]

[16] . According to the double-stranded ribonucleic acid modified product of

[15] , wherein the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification or any combination of two or more thereof; Preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification, or any combination of two or more thereof.

[0022]

[17] . According to the double-stranded ribonucleic acid modification of

[16] , wherein the nucleotide derivative in the nucleotide derivative modification is selected from isonucleotides, LNA, ENA, cET, UNA or GNA.

[0023]

[18] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[17] , wherein, Along the direction from the 3' end to the 5' end, the ribonucleotides at positions 9, 10, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 15 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 5, 7, 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 7, 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 17 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 9, 11, 13, and 17 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 6, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11 and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0024]

[19] . A double-stranded ribonucleic acid modification according to any one of

[15] -

[18] , wherein neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 3' end nucleotide and / or the 5' end nucleotide of the positive strand is connected to a reverse debased deoxyribose residue.

[0025]

[20] . According to any one of

[15] -

[19] , the double-stranded ribonucleic acid modification wherein, when neither the 3' terminal nucleotide nor the 5' terminal nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, the positive strand contains a phosphothioester bond located at the following positions along the 5' end toward the 3' end: Between the first and second nucleotides starting at the 5' end of the positive strand; and Between the second and third nucleotides starting at the 5' end of the positive strand; When only the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, the positive strand contains a phosphothioester bond located at the following positions along the 5'-to-3' direction: Between the first and second nucleotides starting at the 5' end of the positive strand; Between the second and third nucleotides starting at the 5' end of the positive strand; and Between the reverse debased deoxyribose residue starting at the 3' end of the positive strand and the first nucleotide; When the 5' and 3' nucleotides of the positive strand are respectively linked to reverse debased deoxyribose residues, the positive strand contains phosphothioester bonds located at the positions shown below along the 5' to 3' direction: Between the reverse debased deoxyribose residue starting at the 5' end of the positive strand and the first nucleotide; Between the first and second nucleotides starting at the 5' end of the positive strand; and The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

[0026]

[21] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[20] , wherein, Along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotides at positions 5 and 12 of the antisense strand are 2'-deoxy modified nucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0027]

[22] . A double-stranded ribonucleic acid modification according to any one of

[15] -

[21] , wherein, along the 5' end to the 3' end direction, the nucleotide at the 5' end of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group, or the nucleotide at the 5' end of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group.

[0028]

[23] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[22] , wherein the antisense strand comprises a phosphothioester bond located at the position shown below: Between the first and second nucleotides starting at the 5' end of the antisense strand; Between the second and third nucleotides starting at the 5' end of the antisense strand; Between the first and second nucleotides starting at the 3' end of the antisense strand; Between the second and third nucleotides starting at the 3' end of the antisense strand.

[0029]

[24] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[23] , wherein the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any of the double-stranded ribonucleic acid modifications shown in Table 2 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA modification. Preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand comprises the sense strand of any one of the siRNA modifiers shown in Table 2 of this document: siRNA 107-siRNA 126, siRNA 155-siRNA 170, siRNA 246-siRNA 259, siRNA 275-siRNA 276, siRNA 284-siRNA 285, and siRNA 288. The antisense strand comprises the antisense strand of the corresponding siRNA modifier.

[0030]

[25] . A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises a double-stranded ribonucleic acid as described in any one of [1]-

[14] , or a double-stranded ribonucleic acid modifier as described in any one of

[15] -

[24] ; and a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modifier.

[0031]

[26] . The double-stranded ribonucleic acid conjugate according to

[25] , wherein the conjugating group has any of the following structures: (Formula I); (Formula III); (Form IV); (Formula V); (Formula VI); (Equation VII); (Formula VIII); (Formula IX).

[0032]

[27] . The double-stranded ribonucleic acid conjugate according to

[25] or

[26] , wherein the conjugation group is attached to the 3' end of the positive strand.

[0033]

[28] . According to the double-stranded ribonucleic acid conjugate of

[27] , wherein the conjugating group is conjugated to the 3' end of the positive strand via a phosphodiester bond or a thiophosphate diester bond.

[0034]

[29] . The double-stranded ribonucleic acid conjugate according to any one of

[25] -

[28] , wherein the double-stranded ribonucleic acid conjugate has the following structure: (Formula II), The double helix structure is a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modified product.

[0035]

[30] . A double-stranded ribonucleic acid conjugate according to any one of

[25] -

[29] , wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting CIDEB gene expression.

[0036]

[31] . The double-stranded ribonucleic acid conjugate according to any one of

[25] -

[30] , wherein the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 of this document with a conjugation group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifiers shown in Table 2 of this document with a conjugation group; Preferably, in the double-stranded ribonucleic acid conjugate, the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any of the siRNA conjugates shown in Table 3 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate. More preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand comprises the sense strands of siRNA 181-siRNA 196, siRNA 226-siRNA 239, siRNA 260-siRNA 273, siRNA 277-siRNA 278, siRNA 291-siRNA 292, and siRNA 295 shown in Table 3 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate.

[0037]

[32] . Prodrugs of any of the double-stranded ribonucleic acid (BRNA) described in any of the [1]-

[14] , the double-stranded BRNA modified products described in any of the

[15] -

[24] , or the double-stranded BRNA conjugates described in any of the

[25] -

[31] .

[0038]

[33] . A pharmaceutical composition comprising at least one of the following: a double-stranded ribonucleic acid as described in any one of [1]-

[14] , a double-stranded ribonucleic acid modifier as described in any one of

[15] -

[24] , a double-stranded ribonucleic acid conjugate as described in any one of

[25] -

[31] , or a prodrug as described in

[32] .

[0039]

[34] . The pharmaceutical composition according to

[33] further comprises one or more pharmaceutically acceptable carriers, and optionally one or more additional therapeutic agents.

[0040]

[35] . Use of the double-stranded ribonucleic acid according to any one of [1]-

[14] , the double-stranded ribonucleic acid modified according to any one of

[15] -

[24] , the double-stranded ribonucleic acid conjugate according to any one of

[25] -

[31] , the prodrug according to

[32] , or the pharmaceutical composition according to

[33] or

[34] in at least one of the following: (1) Inhibit CIDEB gene expression in vivo or in vitro, or prepare a drug for inhibiting CIDEB gene expression; (2) To prevent or treat diseases associated with abnormal expression of the CIDEB gene, or to prepare drugs for the prevention or treatment of diseases associated with abnormal expression of the CIDEB gene; (3) To treat subjects with diseases that would benefit from reduced CIDEB gene expression, or to prepare a medicine for treating subjects with diseases that would benefit from reduced CIDEB gene expression.

[0041]

[36] . According to the use described in

[35] , wherein the diseases associated with abnormal expression of the CIDEB gene are selected from the group consisting of: Liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, and metabolic disorders.

[0042]

[37] . A method for inhibiting intracellular CIDEB gene expression in vivo or in vitro, wherein the method comprises contacting the cells with a double-stranded ribonucleic acid according to any one of [1]-

[14] , a double-stranded ribonucleic acid modifier according to any one of

[15] -

[24] , a double-stranded ribonucleic acid conjugate according to any one of

[25] -

[31] , a prodrug according to

[32] , or a pharmaceutical composition according to

[33] or

[34] .

[0043]

[38] . The method according to

[37] , wherein the cell is an in vivo cell or an in vitro cell.

[0044]

[39] . The method according to

[37] or

[38] , wherein the cells are in the body of the subject; Preferably, the subject is a mammal, more preferably a human; Preferably, the subject has at least one of the following characteristics: Abnormal expression of the CIDEB gene in vivo, more specifically, abnormally high expression of the CIDEB gene; Suffering from a disease associated with abnormal expression of the CIDEB gene; Suffering from a disease that would benefit from reduced CIDEB gene expression.

[0045]

[40] . A double-stranded ribonucleic acid as described in any one of [1]-

[14] , a double-stranded ribonucleic acid modified as described in any one of

[15] -

[24] , a double-stranded ribonucleic acid conjugate as described in any one of

[25] -

[31] , a prodrug as described in

[32] , or a pharmaceutical composition as described in

[33] or

[34] , which is used as a medicine or for treatment.

[0046] The effects of the invention In some embodiments, the double-stranded ribonucleic acid provided in this disclosure can bind intracellularly to form an RNA-induced silencing complex (RISC), cleaving the mRNA transcribed from the CIDEB gene, and efficiently and specifically inhibiting the expression of the CIDEB gene. This can be used to treat CIDEB-related diseases, including liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, metabolic disorders, and other unidentified related conditions, pathologies, or syndromes.

[0047] Furthermore, the double-stranded ribonucleic acid in this disclosure is siRNA. The siRNA targets and binds to and degrades the transcription product mRNA of the CIDEB gene, exerting the effect of RNA interference and inhibiting the protein expression of the CIDEB gene. It is a CIDEB inhibitor with high inhibition rate and good specificity.

[0048] In some embodiments, this disclosure modifies double-stranded ribonucleic acid to obtain double-stranded ribonucleic acid modified products. The double-stranded ribonucleic acid modified products have high stability and are suitable for use in in vivo disease treatment.

[0049] Furthermore, the double-stranded ribonucleic acid modification is an siRNA modification, which has high stability and good inhibitory activity.

[0050] In some embodiments, this disclosure involves attaching conjugation groups to double-stranded ribonucleic acid (BRNA) or BRNA modifiers to obtain BRNA or BRNA conjugates, which can be used for highly efficient targeted delivery to tissues and cells, reducing the impact of BRNA or BRNA modifiers on non-targeted normal tissues and cells, and improving their safety in clinical disease treatment.

[0051] Furthermore, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, which, while maintaining the inhibitory activity and stability of siRNA, also has organ or tissue targeting properties. This can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the goals of reducing toxicity and lowering costs.

[0052] Furthermore, the conjugating group in this disclosure is a group with the structure shown in Formula I (GalNAc). GalNAc can be used for targeted delivery into liver cells and tissues to efficiently inhibit the expression of the CIDEB gene in the liver. In addition, the siRNA conjugate of this disclosure has low toxicity and an excellent drug safety window. Detailed Implementation

[0053] definition Unless otherwise stated, the terms used in this disclosure have the following meanings.

[0054] In the claims and / or specification of this disclosure, the words “a”, “an”, or “the” may mean “one”, but may also mean “one or more”, “at least one”, and “one or more”.

[0055] As used in the claims and specification, the words “comprising,” “having,” “including,” or “containing” mean included or open-ended and do not exclude additional, uncited elements or method steps.

[0056] Throughout this application, the term "about" means that a value includes the standard deviation of the error of the apparatus or method used to determine that value. The numerical ranges and parameters used to define this disclosure are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains a standard deviation due to the aforementioned test methods or apparatus. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified by the term "about." Here, "about" generally means an actual value within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.

[0057] As used in the context of this disclosure, the term "CIDEB" refers to a well-known gene and polypeptide. The CIDEB gene and CIDEB mRNA sequence are readily available, for example, from sources such as GenBank, UniProt, and the Online Mendelian Inheritance Database (OMIM).

[0058] The term "CIDEB gene" can refer to the wild-type CIDEB gene or a CIDEB gene mutant with sequence variations. Many sequence variations in the CIDEB gene have been identified and can be found in, for example, NCBIdbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0059] The terms "peptide" and "protein" are used interchangeably to refer to a string of at least two amino acid residues linked together by covalent bonds (e.g., peptide bonds), and can be recombinant, natural, or synthetic peptides. Peptides can be linear or branched, can contain modified amino acids, and can be separated by non-amino acid segments. The term also includes amino acid polymers that have been modified (e.g., through disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeled component).

[0060] As used in the context of this disclosure, the term "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a target gene, including mRNA as a product of RNA processing of the primary transcription product.

[0061] In some embodiments, the target sequence is a nucleotide sequence consisting of no fewer than 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 80, 100, or 150 consecutive linked nucleosides. In some alternative embodiments, the target sequence may include another shorter target sequence. In some embodiments, the target sequence may include one or more shorter target sequences. It should be assumed that two or more shorter target sequences included in the same target sequence segment have the same characteristics. For example, target sequence II includes target sequences II-1 to II-2.

[0062] In some implementations, the target gene is the CIDEB gene. In some implementations, the target portion of the gene sequence (i.e., the portion corresponding to the target sequence in the mRNA sequence) will be at least long enough to act as a substrate for iRNA-guided cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during transcription of the CIDEB gene.

[0063] In this technical field, "G", "C", "A", "T", and "U" typically represent the bases of guanine, cytosine, adenine, thymine, and uracil, respectively. However, it is also generally known in the art that each of "G", "C", "A", "T", and "U" typically also represents a nucleotide containing guanine, cytosine, adenine, thymine, and uracil as a base, respectively. This is a common practice in representing deoxyribonucleic acid (DNA) sequences and / or ribonucleic acid (RNA) sequences. Therefore, in the context of this disclosure, the meanings of "G", "C", "A", "T", and "U" include all the above-mentioned possible scenarios. However, it should be understood that the terms "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide (as further detailed below) or a substituted portion. In this application, "nucleotide", "ribonucleotide", and "ribonucleic acid" are used interchangeably, and "deoxyribonucleic acid" and "2'-deoxyribonucleic acid" are used interchangeably. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with other moieties without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide having such a substitution moiety). For example, without limitation, a nucleotide including inosine as its base can base-pair with a nucleotide including adenine, cytosine, or uracil. Therefore, a nucleotide containing uracil, guanine, or adenine can be substituted in the nucleotide sequence of the dsRNA characterized in this disclosure with a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in an oligonucleotide can be substituted with guanine and uracil, respectively, to form a GU swing base pairing with the target mRNA. Sequences containing such substitution moieties are suitable for the compositions and methods characterized in this disclosure.

[0064] In this application, "5'-nucleotide" refers to a nucleotide in which the phosphate group is attached to the 5' carbon of a pentose sugar, and it is the main type of nucleotide that exists freely in organisms. "3'-nucleotide" refers to a nucleotide in which the phosphate group is attached to the 3' carbon of a pentose sugar, and may include, for example, adenosine-3'-phosphate, guanosine-3'-phosphate, cytidine-3'-phosphate, uridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methyladenosine-3'-thiophosphate, 2'-fluoroadenosine-3'-phosphate, 2'-fluoroadenosine-3'-thiophosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-O-methylguanosine-3'-phosphate. The terms glycoside-3'-thiophosphate, 2'-fluoroguanosine-3'-phosphate, 2'-fluoroguanosine-3'-thiophosphate, 2'-O-methylcytidine-3'-phosphate, 2'-O-methylcytidine-3'-thiophosphate, 2'-fluorocytidine-3'-phosphate, 2'-fluorocytidine-3'-thiophosphate, 2'-O-methyluridine-3'-phosphate, 2'-O-methyluridine-3'-thiophosphate, 2'-fluorouridine-3'-phosphate, 2'-fluorouridine-3'-thiophosphate, and 2'-deoxythymidine-3'-thiophosphate are used. This definition can be applied to modified or unmodified nucleoside phosphoramidamide monomers.

[0065] The terms “iRNA,” “RNAi reagent,” “iRNA agent,” and “RNA interference agent” as used in the context of this disclosure are used interchangeably and refer to terms defined herein that contain siRNA and mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates, for example, the expression of target genes in cells (such as the cells of a subject, such as a mammalian subject).

[0066] As used in the context of this disclosure, the terms "double-stranded ribonucleic acid," "double-stranded RNA (dsRNA) molecule," and "dsRNA" are used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure containing two antiparallel and substantially complementary nucleic acid strands, described as having "sense" and "antisense" orientation relative to a target gene, such as the CIDEB gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0067] Typically, the majority of nucleotides on each strand of a dsRNA molecule are double-stranded ribonucleotides; however, as detailed herein, each or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Additionally, as used herein, “double-stranded ribonucleic acid” can include chemically modified ribonucleotides, phosphate backbones, etc. These modifications can include all types of modifications disclosed herein or known in the art.

[0068] As used in the context of this disclosure, the term "isonucleotide" refers to a compound formed by altering the position of a base on the ribose ring, for example, a compound formed by attaching a base to the 2' or 3' position of the ribose ring instead of the 1' position.

[0069] In some embodiments, the double-stranded RNA disclosed herein is siRNA, which interacts with the mRNA sequence transcribed from the target gene (e.g., the mRNA sequence transcribed from the CIDEB gene) to guide the cleavage of the target RNA. Not wishing to be bound by theory, long double-stranded RNA introduced into cells is broken down into siRNA by a type III endonuclease called Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer (a ribonuclease III-like enzyme) processes dsRNA into short 19–23 base pairs of interfering RNA with a characteristic dibase 3' overhang (Bernstein et al., (2001) Nature 409:363). These siRNAs are then incorporated into the RNA-inducible silencing complex (RISC), where one or more helicases unwind the siRNA duplex, enabling complementary antisense strands to guide target recognition (Nykanen et al., (2001) Cell 107:309). Once bound to a suitable target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir et al., (2001) Genes Dev. 15:188).

[0070] In the context of this disclosure, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference at that position is considered to exist between the two nucleotide sequences. In some embodiments, replacing the nucleotide at the original position with a nucleotide analog can also be considered as a nucleotide difference at that position.

[0071] As used in the context of this disclosure, the terms "protruding nucleotide" and "protruding end" refer to one or more unpaired nucleotides that protrude from the double-stranded structure of a dsRNA when one 3' end of one strand of a double-stranded RNA extends beyond the 5' end of the other strand, or vice versa. "Flat-ended" or "blunt-terminated" means that there are no unpaired nucleotides at that end of the double-stranded RNA, i.e., no nucleotide protrusions. A "flat-terminated" double-stranded RNA is a dsRNA that is double-stranded throughout its entire length, i.e., without nucleotide protrusions at either end of the molecule. "Double-stranded region" refers to the complementary formation of the sense and antisense strands of the siRNA to form the double-stranded region of the siRNA.

[0072] The term "antisense strand" refers to a region of double-stranded RNA that is substantially complementary to a target sequence (e.g., from human CIDEB mRNA). Mismatches at the terminal regions are most tolerable when the complementary region is not perfectly complementary to the target sequence, and if mismatches do occur, they are typically within one or more terminal regions, such as 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends.

[0073] The term "sense chain" refers to a double-stranded RNA containing a nucleic acid chain that is substantially complementary to the antisense chain region.

[0074] The terms “complementary” or “reverse complementary” are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired in a complementary manner with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, “mismatch” in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired in a complementary manner.

[0075] The terms "substantially complementary" and "substantially complementary" refer to the presence of no more than three base mismatches between the two nucleotide sequences involved, i.e., one, two, or three base mismatches between the two nucleotide sequences involved; "completely complementary" refers to the presence of no base mismatches between the two nucleotide sequences.

[0076] The terms “complementary,” “fully complementary,” and “substantially complementary” can be used relative to base pairing between the sense and antisense strands of dsRNA, or between the antisense strand of dsRNA and the target sequence, as will be understood from the context in which they are used.

[0077] In the foregoing and hereinafter, particularly in the description of methods for preparing double-stranded ribonucleic acid, modified double-stranded ribonucleic acid, or conjugates thereof or pharmaceutical compositions of the present disclosure, unless otherwise specified, a nucleoside monomer refers to a modified or unmodified nucleoside phosphorus amide monomer used in phosphorus amide solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphorus amide solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this disclosure are commercially available.

[0078] The term “inhibition” can be used interchangeably with “reduction,” “silence,” “downregulation,” “suppression,” and other similar terms, and includes any level of inhibition.

[0079] The term "suppressing CIDEB gene expression" includes suppressing the expression of any CIDEB gene (such as, for example, the mouse CIDEB gene, rat CIDEB gene, monkey CIDEB gene, or human CIDEB gene) and variants (e.g., naturally occurring variants) or mutants of the CIDEB gene. Therefore, the CIDEB gene can be a wild-type CIDEB gene, a mutant CIDEB gene, or a transgenic CIDEB gene in the case of genetically manipulated cells, cell groups, or organisms.

[0080] "Inhibition of CIDEB gene expression" includes inhibition of the CIDEB gene at any level, such as at least partial inhibition of CIDEB gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0081] The term "independently" means that at least two groups (or ring systems) in a structure with the same or similar value ranges can have the same or different meanings under specific circumstances. For example, if substituent X and substituent Y are independently hydrogen, hydroxyl, alkyl, or aryl, then when substituent X is hydrogen, substituent Y can be hydrogen, hydroxyl, alkyl, or aryl; similarly, when substituent Y is hydrogen, substituent X can be hydrogen, hydroxyl, alkyl, or aryl.

[0082] The term "alkyl" includes straight-chain, branched, or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and similar groups. For example, "C 1-6 The "C" in "alkyl" 1-6 "" refers to a group consisting of 1, 2, 3, 4, 5 or 6 carbon atoms arranged in a straight chain, branched chain or cyclic form.

[0083] The term "alkoxy" herein refers to an alkyl group that is attached to the remainder of a molecule by an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, etc.

[0084] The term "treatment" refers to the process of exposing a subject to (e.g., administering medication) double-stranded RNA, double-stranded RNA modifications, double-stranded RNA conjugates, prodrugs, or pharmaceutical compositions after the onset of a disease, thereby reducing the symptoms of the disease compared to when the subject is not exposed. It does not imply the complete suppression of disease symptoms. Having a disease means that the body exhibits symptoms of a disease.

[0085] The term "prevention" means that, prior to the onset of a disease, by exposing (e.g., administering medication) a subject to the double-stranded RNA, double-stranded RNA modifier, double-stranded RNA conjugate, prodrug, or pharmaceutical composition disclosed herein, the symptoms of the disease are reduced compared to when the subject is not exposed, and does not imply the necessity of completely suppressing the disease.

[0086] The term "effective amount" refers to the quantity or dose of the double-stranded RNA, double-stranded RNA modification, double-stranded RNA conjugate, prodrug, or pharmaceutical composition of this disclosure, which, when administered to a patient in a single or multiple dose, produces the intended effect in a patient requiring treatment or prevention. The effective amount can be readily determined by an attending physician skilled in the art by considering a variety of factors, such as: the species of the mammal; its size, age, and general health; the specific disease involved; the degree or severity of the disease; the individual patient's response; the specific antibody administered; the administration method; the bioavailability characteristics of the administered formulation; the chosen dosing regimen; and the use of any concomitant therapies. The term "therapeutic effective amount" refers to the quantity or dose of the double-stranded RNA, double-stranded RNA modification, conjugate, prodrug, or pharmaceutical composition of this disclosure, which, when administered to a patient in a single or multiple dose, produces the intended therapeutic effect in a patient requiring treatment or prevention.

[0087] The term "disease associated with CIDEB gene aberration" is a disease or disorder associated with the involvement of CIDEB. The term "disease associated with CIDEB gene aberration" includes diseases, disorders, or conditions that would benefit from reduced CIDEB expression (i.e., "CIDEB-related diseases"). In some embodiments, diseases associated with CIDEB gene aberration are selected from the group consisting of: liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, and metabolic disorders. Exemplarily, but not limited to, the following scientific literature is referenced: Wu X, Lee EM, Hammack C, Robotham JM, Basu M, Lang J, Brinton MA, Tang H. Cell death-inducing DFFA-like effector b is required for hepatitis C virus entry into hepatocytes. J Virol . 2014 Aug; 88(15): 8433-8444; Gong J, Sun Z, and Li P. CIDEproteinsandmetabolicdisorders. Current opinion in lipidology . 2009, 20:121-126; Li JZ, Lei Y, Wang Y, et al. Control of cholesterol biosynthesis, uptake and storage in hepatocytes byCideb. Biochimica et Biophysica Acta, 2010, 1801(5): 577-586;Sans, Arnaud, etal. The Differential Expression of Cide Family Members is Associated withNafld Progression from Steatosis to Steatohepatitis. Scientific Reports . 9.1(2019):7501;J., Z., Li, J., Ye,&B., et al. Cideb regulates diet-inducedobesity, liver steatosis, and insulin sensitivity by controlling lipogenesisand fatty acid oxidation. Diabetes, 2007, 56 (10), 2523;Angela M. Hall, ElizabethM. Brunt, Samuel Klein and Brian N. Finck. Hepatic Expression of Cell Death-inducing DFFA -like Effector C in Obese Subjects Is Reduced by Marked WeightLoss. Obesity (2010)18,417–419;Li, C., Liu, Y., Dong, Z., Xu, M.,&Liu, S. Tcddpromotes liver fibrosis through disordering systemic and hepatic ironhomeostasis. Journal of Hazardous Materials, 395(2020), 122588;Chao, S.,Yuanlin, Z., Xing, G., Yuan, Y., Chao, W.,&Yingmei, W., et al. (2017). Cidebdeficiency aggravates dextran sulfate sodium-induced ulcerative colitis inmice by exacerbating the oxidative burden in colonic mucosa. Inflammatory Bowel Diseases , 2017, 23(8), 1338; Yu, M., Wang, H., Zhao, J., Yuan, Y., & ChaoWang, et al. Expression of cide proteins in clear cell renal cell carcinoma and their prognostic significance. Molecular&Cellular Biochemistry, 2013, 378(1-2), 145-151; Yasumoto, Jun, et al. Hepatitis B virus prevents excessiveviral production via reduction of cell death-inducing DFF45-likeeffectors. Journal of General Virology , 2017,98:1762-1773.

[0088] The terms "pharmaceuticalally acceptable excipient" or "pharmaceuticalally acceptable carrier" refer to excipient materials widely used in the pharmaceutical manufacturing industry. The primary purpose of using excipients is to provide a pharmaceutical composition that is safe to use, stable in nature, and / or has specific functionalities, and also to provide a method for the active ingredient to dissolve at a desired rate or to promote the effective absorption of the active ingredient in the body of the administered subject after administration of the drug. Pharmaceutically acceptable excipients can be inert fillers or functional ingredients that provide a function to the pharmaceutical composition (e.g., stabilizing the overall pH of the composition or preventing degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesion agents, flow aids, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc.

[0089] The term "pharmaceutical composition" refers to a mixture of one or more of the double-stranded RNA, double-stranded RNA modifications, prodrugs, or conjugates thereof disclosed herein with a pharmaceutically acceptable excipient / carrier. The purpose of a pharmaceutical composition is to facilitate the administration of the double-stranded RNA, double-stranded RNA modifications, or conjugates thereof disclosed herein to an organism.

[0090] The pharmaceutical compositions disclosed herein can be prepared using any method known to those skilled in the art. For example, conventional mixing, dissolving, granulation, emulsification, grinding, encapsulation, embedding, and / or lyophilization processes.

[0091] In this disclosure, the application method can be varied or modified in any applicable manner to meet the needs of the properties of the drug, the convenience of patients and medical personnel, and other relevant factors.

[0092] As used in the context of this disclosure, the terms “individual,” “patient,” or “subject” include mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., human and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0093] As used in the context of this disclosure, the term "corresponding siRNA" refers to the same siRNA mentioned above. For example, when referring to "the positive strand comprising the positive strand of any of the siRNAs shown in Tables 1 and 1-1 herein, and the antisense strand comprising the antisense strand of the corresponding siRNA," it means that the included positive and antisense strands are from the same siRNA shown in Tables 1 and 1-1 herein. For example, when the positive strand comprises 5'-CCAGCACAGGAGAGAACCA-3' (SEQ ID NO: 16), the antisense strand comprises 5'-UGGUUCUCUCCUGUGCUGG-3' (SEQ ID NO: 17). Similarly, the term "corresponding siRNA modifier" refers to the same siRNA modifier mentioned above. For example, when referring to "the positive strand comprising the positive strand of any of the siRNA modifiers shown in Table 2 herein, and the antisense strand comprising the antisense strand of the corresponding siRNA modifier," it means that the included positive and antisense strands are from the same siRNA modifier shown in Table 2 herein. Similarly, the term "corresponding siRNA conjugate" refers to the same siRNA conjugate mentioned above. For example, when it is stated that "the sense strand comprises the sense strand of any of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate," it means that the included sense and antisense strands are from the same siRNA conjugate shown in Table 3 herein. Furthermore, in these contexts, "comprising" includes cases where the sequences consist of these sequences.

[0094] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0095] Double-stranded RNA The first aspect of this disclosure provides a double-stranded RNA (dsRNA) for inhibiting the expression of the CIDEB gene. One strand of the dsRNA is an antisense strand, which is complementary to the mRNA sequence formed during the expression of the target gene (i.e., the CIDEB gene) to guide the cleavage of the target mRNA (i.e., the transcript of the CIDEB gene). The other strand of the dsRNA includes a double-stranded region that is partially or completely complementary to the antisense strand to form the double-stranded RNA.

[0096] In some implementations, double-stranded RNA is used as a substrate for the endonuclease Dicer, and is cleaved into small fragments of dsRNA, i.e., siRNA. In some implementations, the double-stranded RNA is siRNA. The siRNA assembles to form an RNA-induced silencing complex (RISC), which cleaves the target mRNA, thereby inhibiting the expression of the CIDEB gene.

[0097] Based on the target sequence derived from human CIDEB mRNA (NM_001393334.1), siRNAs that bind to the target mRNA are designed. In some embodiments, the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO: 1-9. In some more specific embodiments, the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO: 1-9.

[0098] In some specific embodiments, the nucleotide sequence shown in SEQ ID NO: 2 comprises the nucleotide sequences shown in SEQ ID NO: 10 and 11.

[0099] In some specific implementations, the nucleotide sequence shown in SEQ ID NO: 3 includes the nucleotide sequences shown in SEQ ID NO: 12-14.

[0100] In some specific implementations, the nucleotide sequence shown in SEQ ID NO: 5 includes the nucleotide sequence shown in SEQ ID NO: 15.

[0101] In some implementations, the antisense strand comprises a sequence B whose inverse complementary sequence to at least 15 consecutive nucleotides in the target sequence differs by no more than 3 nucleotides. Specifically, a start nucleotide is selected in the target sequence along the 5' end to the 3' end, and at least 15 nucleotides extending in the 3' direction, including the start nucleotide, serve as the binding region of the siRNA. The antisense strand comprises the inverse complementary sequence of the nucleotide sequence corresponding to the binding region. It should be noted that the start nucleotide can be a nucleotide at any position in the target sequence, as long as extending in the 3' direction from the start nucleotide yields at least 15 consecutive nucleotides (including the nucleotide at the start position).

[0102] In this disclosure, the nucleotide sequence of the antisense strand can be completely complementary or substantially complementary to the target sequence. When the nucleotide sequence of the antisense strand is substantially complementary to the target sequence, there are no more than three mismatched bases in the nucleotide sequence of the antisense strand that are in the target sequence. For example, there may be one, two, or three mismatched bases. When the nucleotide sequence of the antisense strand is completely complementary to the target sequence, there are no mismatched bases in the nucleotide sequence of the antisense strand and the target sequence.

[0103] Furthermore, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.

[0104] Preferably, the antisense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 21 or 23 nucleotides.

[0105] In some alternative implementations, the antisense strand contains sequence B, which is the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0106] In some specific implementations, the antisense strand contains sequence B, which is the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21, or 23 consecutive nucleotides.

[0107] In some alternative implementations, the sequence B contained in the antisense strand differs by one nucleotide from the reverse complementary sequence of the target sequence, which consists of at least 15 consecutive nucleotides.

[0108] In some specific implementations, the sequence B contained in the antisense strand differs from the reverse complementary sequence of the 15-28 nucleotides of the target sequence by one nucleotide. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21, or 23 consecutive nucleotides.

[0109] In some specific embodiments, the differing nucleotide is located at the 3' end of sequence B. In other specific embodiments, the differing nucleotide is located at the 5' end of sequence B.

[0110] In some embodiments, the sense strand comprises sequence A, which differs from at least 15 consecutive nucleotides in the target sequence by no more than 3 nucleotides. The sense strand includes regions complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the antisense strand binding region on the target sequence. Therefore, the nucleotide sequence of the sense strand is at least 15 consecutive nucleotides in the target sequence that bind the antisense strand; or, the nucleotide sequence of the sense strand differs from at least 15 consecutive nucleotides in the target sequence that bind the antisense strand by 1, 2, or 3 bases.

[0111] Furthermore, the sense strand consists of at least 15 nucleotides. In some embodiments, the sense strand consists of 15-28 nucleotides. For example, the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides.

[0112] Preferably, the positive chain consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 21 or 23 nucleotides.

[0113] In some alternative implementations, the positive strand contains sequence A which is identical to the sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0114] In some specific implementations, the sequence A of the positive strand is identical to the sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21, or 23 consecutive nucleotides.

[0115] In some alternative implementations, the sequence A contained in the positive strand differs from the target sequence by one nucleotide by at least 15 consecutive nucleotides.

[0116] In some specific implementations, the sequence A contained in the positive strand differs from the target sequence consisting of 15-28 consecutive nucleotides by one nucleotide. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21, or 23 consecutive nucleotides.

[0117] In some specific embodiments, the differing nucleotide is located at the 3' end of sequence A. In other specific embodiments, the differing nucleotide is located at the 5' end of sequence A.

[0118] In this disclosure, the length of the justice chain and the length of the antisense chain may be the same or different.

[0119] In some implementations, the lengths of the justice chain and the antisense chain are the same. Specifically, the length ratio of the justice chain to the antisense chain is 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, or 28 / 28. Preferably, the length ratio of the justice chain to the antisense chain is 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, or 25 / 25; more preferably, it is 19 / 19, 20 / 20, 21 / 21, 22 / 22, or 23 / 23; and most preferably, it is 19 / 19, 21 / 21, or 23 / 23.

[0120] In some implementations, the lengths of the justice chain and the antisense chain are different. For example, the justice chain / antisense chain length ratio is 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 19, 21 / 20, 21 / 22, 21 / 23, 21 / 24, 21 / 25. 21 / 26, 22 / 19, 22 / 20, 22 / 21, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 24, 23 / 25, or 23 / 26, etc.; in some preferred embodiments, the length ratio of the justice chain to the antisense chain is 19 / 21, 20 / 22, or 21 / 23.

[0121] In this disclosure, the sense strand and the antisense strand can be fully complementary or substantially complementary. When they are substantially complementary, there are no more than 3 mismatched bases in the double-stranded region formed by the sense strand and the antisense strand.

[0122] In some embodiments, after the sense and antisense strands complement each other to form a double-stranded region, the sense strand, antisense strand, or combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides can be one or more, for example, one or two. Furthermore, the one or two protruding nucleotides can be located at the 5' end, 3' end, or both ends of any antisense or sense strand, and each protruding nucleotide can be of any type.

[0123] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, while the 3' end of the sense strand has a blunt end.

[0124] In some implementations, the sense chain and the antisense chain complement each other to form the double-stranded region, and both the sense chain and the antisense chain have flat ends at their 3' ends.

[0125] In some implementations, the sense strand comprises the sense strand of any of the siRNAs shown in Tables 1 and 1-1 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0126] In some implementations, the sense strand comprises the sense strand of any one of the siRNAs shown in Tables 1 and 1-1, namely siRNA 64, siRNA 224, siRNA 282, and siRNA 299, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0127] In some specific implementations, the siRNA disclosed herein has an inhibition rate of at least about 5% against the CIDEB gene, and may be at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between any two of these values.

[0128] The siRNA disclosed herein has high specificity in binding to the target mRNA (CIDEB mRNA) and good silencing activity of the target mRNA. It can significantly inhibit CIDEB gene expression and can be used to treat CIDEB-related diseases, including liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, and metabolic disorders.

[0129] In some embodiments, this disclosure provides an siRNA composition comprising any one or more of the siRNAs shown in Table 1 and Table 1-1.

[0130] In some embodiments, each nucleotide of the sense strand is independently a modified or unmodified nucleotide. In some embodiments, each nucleotide of the antisense strand is independently a modified or unmodified nucleotide.

[0131] In some embodiments, any two nucleotides linked in the sense strand are connected by a phosphodiester bond or a phosphothiodiester bond. In some embodiments, any two nucleotides linked in the antisense strand are connected by a phosphodiester bond or a phosphothiodiester bond.

[0132] In some embodiments, the 5' terminal nucleotide of the antisense strand is either not linked to a 5' phosphate group or a 5' phosphate derivative group, or is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0133] In this paper, when the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group, a 5' phosphate-derived group, or (invAb) (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group), the structure of the 5' terminal nucleotide is as shown in Formula X: (Formula X) Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0134] When the 5' terminal nucleotide of the antisense strand is attached to a 5' phosphate group or a 5' phosphate derivative, the following structure is formed: Equation (1), Equation (2), Formula (3); wherein, Formula (1) shows the structure formed by connecting a 5' nucleotide to a 5' phosphate group, Formula (2) shows the structure formed by connecting a 5' nucleotide to an EVP, and Formula (3) shows the structure formed by connecting a 5' nucleotide to a 5' methylene phosphate group, Base represents a base, such as A, U, G, C or T; R' is a hydroxyl group or is substituted by various groups known to those skilled in the art, such as 2'-fluoro(2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, and 2'-deoxyribonucleotides.

[0135] In some embodiments, the positive strand may contain one or more capping residues or portions, sometimes referred to in the art as a “cap,” “terminal cap,” or “capping residue.” As used herein, a “capping residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the siRNA disclosed herein. In some cases, capping residues may provide certain beneficial properties to the siRNA, such as protection against exonuclease degradation. In some embodiments, an inverse debased deoxyribose residue (invAb) is added as a capping residue. In some embodiments, the capping residue appears at the 5' end, the 3' end, or both the 5' and 3' ends of the positive strand.

[0136] In some embodiments, one or more inverted debased deoxyribose residues (invAb) are added to the 3' end of the positive strand. In some embodiments, one or more inverted debased deoxyribose residues (invAb) are added to the 5' end of the positive strand. In some embodiments, one or more inverted debased deoxyribose residues (invAb) are added to both the 5' end and the 3' end of the positive strand. The inverted debased deoxyribose residues may be linked via phosphodiester bonds, phosphothiodiester bonds, or other nucleoside internucleotide bonds. When describing modification sites in modification methods, (invAb) is not counted as the first site of the sequence. In some embodiments, inverted debased deoxyribose residues (invAb) (also referred to in the art as "inverted debasing sites") may be added. The chemical structure of the inverted debased deoxyribose residue is shown below: Formula B is used when (invAb) is located at the 3' end of the siRNA; Formula C is used when (invAb) is located at the 5' end of the siRNA. (Formula B) (Formula C).

[0137] Double-stranded RNA modified products A second aspect of this disclosure provides a double-stranded ribonucleic acid (SSRNA) modifier. Further, the SSRNA modifier is a siRNA modifier. The siRNA modifier maintains high CIDEB mRNA inhibitory activity while improving the stability of the siRNA.

[0138] In some embodiments, the double-stranded ribonucleic acid (SSRNA) modifier comprises a modification of at least one nucleotide. The nucleotide modification is selected from at least one of ribose group modification and base modification. In some embodiments, "nucleotide modification" refers to a nucleotide or nucleotide derivative formed by replacing the 2' hydroxyl group of the ribose group with another group, or a nucleotide in which the base is a modified base. The nucleotide modification does not result in a significant weakening or loss of the siRNA's ability to suppress gene expression. For example, modified nucleotides disclosed in JKWatts, G.G. Deleavey, and MJDamha, Chemically Modified siRNA: Tools and Applications. Drug Discov Today, 2008, 13(19-20): 842-55 can be selected. Nucleotide modification can improve the stability of siRNA and maintain its high repressive efficiency against the CIDEB gene.

[0139] For example, the modified nucleotide has the following structure: Wherein, Base represents a base, such as A, U, G, C, or T. The hydroxyl group at the 2' position of the ribosyl group is replaced by R. These hydroxyl groups at the 2' position of the ribosyl group can be replaced by various groups known to those skilled in the art, such as 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, and 2'-deoxyribonucleotides.

[0140] In some implementations, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH3) modified nucleotide, etc.

[0141] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a nucleotide modified with 2'-methoxyethoxy (2'-O-CH2-CH2-O-CH3), a nucleotide modified with 2'-O-CH2-CH=CH2, etc.

[0142] In some embodiments, the 2'-substituted alkyl-modified nucleotide is a nucleotide modified with 2'-CH2-CH2-CH=CH2, etc.

[0143] In some embodiments, the modification of the nucleotide is a modification of the bases. Base modifications can be of various types known to those skilled in the art. For example, base modifications include, but are not limited to, m... 6 A、Ψ、m 1 A、m 5 A, ms2 i 6 A、i 6 A、m 3 C, m 5 C、ac 4 C, m 7 G, m 2,2 G, m 2 G, m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um, D, mcm 5 s 2 U, Inosine (I), hm 5 C, s 4 U、s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.

[0144] In some embodiments, a nucleotide derivative refers to a compound that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, the nucleotide derivative can be an isonucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide. A BNA refers to a restricted or inaccessible nucleotide. A BNA can contain a bridging structure with a "fixed" C3'-endoglucan condensation, such as a five-membered, six-membered, or seven-membered ring. This bridge is typically incorporated into the 2',4' position of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET, etc.

[0145] LNA is shown in equation (4), ENA is shown in equation (5), and cET is shown in equation (6): Equation (4), Equation (5), Equation (6); Where Base represents a base.

[0146] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide, such as unopened nucleic acids (UNA) or glycerol nucleic acids (GNA). UNA is shown in formula (7), and GNA is shown in formula (8). Equation (7), Equation (8).

[0147] In the above formulas (7) and (8), Base represents a base, and R is selected from H, OH or alkoxy (O-alkyl).

[0148] In some implementations, nucleotide derivative modification refers to the replacement of nucleotides in nucleic acids with nucleotide derivatives. Exemplary examples include isonucleotides, LNA, ENA, cET, UNA, or GNA.

[0149] In some embodiments, the nucleotides in the nucleic acid are replaced with isonucleotides, also referred to as isonucleotide modification in the context of this disclosure. In some embodiments, isonucleotide modification includes incorporating an isonucleotide at one or more sites on the sense and / or antisense strands of the siRNA to be modified, in place of the native nucleoside for coupling at the corresponding position.

[0150] In some embodiments, the isonucleoside modification is D-isonucleoside modification. In other embodiments, the isonucleoside modification is L-isonucleoside modification. In still other embodiments, the isonucleoside modification is a combination of D-isonucleoside and L-isonucleoside modification.

[0151] In some embodiments, the double-stranded ribonucleic acid (siRNA) modifier includes modification of a phosphodiester bond at at least one position. In some embodiments, the modification of the phosphodiester bond refers to the substitution of an oxygen atom in the phosphodiester bond by a sulfur atom to form a phosphothiodiester bond. The phosphothiodiester bond can stabilize the double-stranded structure of siRNA and maintain the specificity of base pairing. An exemplary phosphothiodiester bond structure is shown below: .

[0152] In some embodiments, the double-stranded ribonucleic acid modifier comprises at least one of the following chemical modifications: (1) Modification of at least one nucleotide in the positive strand, (2) Modification of the phosphodiester bond at at least one position in the positive chain. (3) Modification of at least one nucleotide in the antisense strand, (4) Modification of phosphodiester bonds at at least one position in the antisense chain.

[0153] Furthermore, the double-stranded RNA modifier is an siRNA modifier containing at least one of the chemical modifications in (1)-(4).

[0154] In this disclosure, the 3' end of the sense strand of the double-stranded ribonucleic acid modification has a blunt end, and the 3' end of the antisense strand has one or two protruding nucleotides extending out of the double-stranded region.

[0155] For example, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. After the sequence A in the sense strand and the sequence B in the antisense strand are complementary to form a double-stranded region, the 3' end of sequence B has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence A has a blunt end.

[0156] For example, after sequence A in the sense strand of the double-stranded ribonucleic acid (BRNA) and sequence B in the antisense strand complement each other to form a double-stranded region, if neither sequence A nor sequence B has a protruding nucleotide at its 3' end, 1-2 nucleotides are added to the 3' end of the antisense strand as protruding nucleotides. These 1-2 nucleotides linked to the 3' end of the antisense strand form sequence E. Accordingly, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked to sequence E.

[0157] For example, two deoxyribonucleotides (TT) are added to the 3' end of the antisense sequence B to form sequence E.

[0158] In some embodiments, the ribonucleotides at positions 9, 10, 11, and 13 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0159] In some embodiments, the ribonucleotides at positions 11, 12, 13, and 15 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0160] In some embodiments, the ribonucleotides at positions 9, 11, and 13 of the positive strand along the 3' end toward the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0161] In some embodiments, the ribonucleotides at positions 5, 7, 9, 11, and 13 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0162] In some embodiments, the ribonucleotides at positions 7, 9, 11, and 13 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0163] In some embodiments, the ribonucleotides at positions 11, 12, 13, and 17 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0164] In some embodiments, the ribonucleotides at positions 9, 11, 13, and 17 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0165] In some embodiments, the ribonucleotides at positions 6, 11, and 13 of the positive strand along the 3' end toward the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0166] In some embodiments, the ribonucleotides at positions 11 and 13 of the positive strand along the 3' end toward the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0167] In this paper, the 5' terminal nucleotide of the positive strand is not connected to a 5' phosphate group, a 5' phosphate-derived group, or a reverse debased deoxyribose residue (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group), and its structure is as shown in Formula X above.

[0168] In some embodiments, neither the 5' end nor the 3' end of the positive strand is connected to an inverse debased deoxyribose residue, or the 3' terminal nucleotide and / or the 5' terminal nucleotide of the positive strand is connected to an inverse debased deoxyribose residue (invAb).

[0169] In some embodiments, when neither the 3' nor 5' terminal nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, the positive strand contains a phosphothioester bond located at the following positions along the 5'-to-3' direction: Between the first and second nucleotides starting at the 5' end of the positive strand; and Between the second and third nucleotides starting at the 5' end of the positive strand.

[0170] In some embodiments, when only the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, the positive strand contains a phosphothioester bond located at the following positions along the 5'-to-3' direction: Between the first and second nucleotides starting at the 5' end of the positive strand; Between the second and third nucleotides starting at the 5' end of the positive strand; and The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

[0171] In some embodiments, when the 5' and 3' nucleotides of the positive strand are respectively linked to reverse debased deoxyribose residues, the positive strand contains phosphothioester bonds located at the following positions along the 5' to 3' direction: Between the reverse debased deoxyribose residue starting at the 5' end of the positive strand and the first nucleotide; Between the first and second nucleotides starting at the 5' end of the positive strand; and The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

[0172] In some embodiments, the antisense strand of the double-stranded ribonucleic acid modifier includes the following modification along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0173] In some embodiments, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0174] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0175] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0176] In some embodiments, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand along the 5' end to the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0177] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0178] In some embodiments, the ribonucleotides at positions 2, 7, 10, and 14 of the antisense strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0179] In some embodiments, the ribonucleotides at positions 2, 5, 7, and 14 of the antisense strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0180] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0181] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotides at positions 5 and 12 of the antisense strand are 2'-deoxy modified nucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0182] In some embodiments, the ribonucleotides at positions 2, 7, 12, and 14 of the antisense strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0183] In some embodiments, the ribonucleotides at positions 2, 6, 12, and 14 of the antisense strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0184] In some embodiments, the antisense strand of the double-stranded ribonucleic acid modification includes phosphothioester bonds at the following positions along the 5' end to the 3' end: between the first and second nucleotides starting at the 5' end, between the second and third nucleotides starting at the 5' end, between the first and second nucleotides starting at the 3' end, and between the second and third nucleotides starting at the 3' end.

[0185] In some embodiments, along the 5' end toward the 3' end, the nucleotide at the 5' end of the antisense strand is either not linked to a 5' phosphate group or a 5' phosphate derivative group, or is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0186] In this paper, when describing the modification methods of the sense or antisense strand of siRNA, when the base is "T", those skilled in the art generally understand that the base "T" represents deoxyribonucleotide, and there is no modification of the base "T" by 2'-F, 2'-O-CH3, nucleotide derivatives, etc.

[0187] As used in this specification, "2'-deoxy-modified nucleotide" or "2'-deoxy modification" refers to the process of replacing ribonucleotides A, U, C, and G with the corresponding deoxyribonucleotides dA, dT, dC, and dG during the modification process. In this document, "2'-deoxy-modified nucleotide" or "2'-deoxy modification" is also referred to as "nucleotide replacement with deoxyribonucleotide".

[0188] In this paper, when the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group, a 5' phosphate-derived group, or (invAb), the structure of the 5' terminal nucleotide is as shown in Formula X above.

[0189] In some alternative implementations, the justice chain and the antisense chain are selected from combinations of the following: The sense strand comprises the sense strand of any of the double-stranded ribonucleic acid modifications shown in Table 2 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA modification. Preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand comprises the sense strand of any one of the siRNA modifiers shown in Table 2 of this document: siRNA 107-siRNA 126, siRNA 155-siRNA 170, siRNA 246-siRNA 259, siRNA 275-siRNA 276, siRNA 284-siRNA 285, and siRNA 288. The antisense strand comprises the antisense strand of the corresponding siRNA modifier.

[0190] In some specific embodiments, the siRNA modifier of this disclosure has an inhibition rate of at least about 5% against the CIDEB gene, and may be at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between these values. In some embodiments, the IC50 of the siRNA modifier of this disclosure against the CIDEB gene... 50 Less than about 1.2 nM, and can be less than about 1.1, about 1.0, about 0.9, about 0.8, about 0.7, about 0.6, about 0.5, about 0.4, about 0.3, about 0.2, about 0.1, about 0.09, about 0.08, about 0.07, about 0.06, about 0.05, about 0.04, about 0.03, about 0.02, about 0.01 nM.

[0191] Double-stranded ribonucleic acid conjugates The third aspect of this disclosure provides a double-stranded ribonucleic acid conjugate, which is obtained by conjugating and linking the double-stranded ribonucleic acid provided in the first aspect or the double-stranded ribonucleic acid modified by the second aspect of this disclosure with a conjugating group.

[0192] In this disclosure, the 3' end of the sense strand of the double-stranded ribonucleic acid conjugate has a blunt end, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region. The conjugating group is conjugated to the 3' end of the sense strand with a blunt end to form a double-stranded ribonucleic acid conjugate; or, both the 3' ends of the sense strand and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate have blunt ends, and the conjugating group is conjugated to the 3' end of the sense strand with a blunt end to form a double-stranded ribonucleic acid conjugate.

[0193] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) modifier is the sequence shown in Sequence A, and the antisense strand is the sequence shown in Sequence B. After Sequence A in the sense strand and Sequence B in the antisense strand are complementary to form a double-stranded region, the 3' end of Sequence B has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of Sequence A has a blunt end. The 3' end of the sense strand of the BRNA modifier is connected to a conjugate group to form a double-stranded ribonucleic acid conjugate.

[0194] For example, after sequence A in the sense strand of the double-stranded ribonucleic acid (BRNA) modifier is complementary to sequence B in the antisense strand to form a double-stranded region, and there are no protruding nucleotides at the 3' ends of either sequence A or sequence B, 1-2 nucleotides are added to the 3' end of the antisense strand as protruding nucleotides. The 1-2 nucleotides attached to the 3' end of the antisense strand form sequence E. Accordingly, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence E connected to sequence B. A conjugation group is attached to the 3' end of the sense strand of the BRNA modifier to form a double-stranded ribonucleic acid conjugate.

[0195] For example, two deoxyribonucleotides (TT) are added to the 3' end of the antisense sequence B to form sequence E.

[0196] Furthermore, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, wherein the siRNA molecule linked to the conjugation group in the siRNA conjugate can be unmodified siRNA or a modified siRNA. The siRNA molecule modified with the conjugation group maintains high inhibitory activity and stability while also exhibiting good tissue and organ targeting and the ability to promote endocytosis, thus reducing the impact on other tissues or organs and decreasing the amount of siRNA molecule used, thereby achieving the goals of reducing toxicity and lowering costs. Optionally, any siRNA molecule shown in Table 1, Table 1-1, or Table 2 can be linked to the conjugation group to obtain a double-stranded ribonucleic acid conjugate.

[0197] The conjugation site of siRNA and the conjugating group can be at the 3' or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the conjugation site of siRNA and the conjugating group is at the 3' end of the siRNA's sense strand.

[0198] In some embodiments, the conjugate group may be attached to a phosphate group, a 2'-hydroxyl group, or a base of a nucleotide. In some embodiments, the conjugate group may also be attached to a 3'-hydroxyl group, in which case the nucleotides are linked by a 2',5'-phosphodiester bond. When the conjugate group is attached to the end of the siRNA chain, it is usually attached to a phosphate group of the nucleotide; when the conjugate group is attached to the inner sequence of the siRNA, it is usually attached to a ribose ring or a base. Various connection methods can be found in the reference: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo inhepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.

[0199] In this disclosure, the conjugation group can be a ligand conventionally used in the field of siRNA drug delivery. In some embodiments, the conjugation group can be selected from one or more ligands formed from the following target molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g., vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as transmembrane peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid; receptor ligands expressed by hepatocytes, such as desialyl glycoprotein, desialyl sugar residues, lipoproteins (e.g., high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth factors, transferrin, etc.

[0200] In some specific embodiments, the conjugation group has a structure as shown in any of the above formulas I, III, IV, V, VI, VII, VIII, and IX.

[0201] The conjugation group shown in Formula I is GalNAc. GalNAc has liver targeting properties and can deliver siRNA molecules to liver tissue with high specificity, specifically inhibiting the high expression of the CIDEB gene in the liver.

[0202] In some specific implementations, GalNAc is conjugated to the 3' end of the sense strand via a phosphodiester bond, resulting in siRNA conjugates with the structure shown below: (Formula II), The double helix structure is either unmodified siRNA or siRNA modified.

[0203] In some implementations, the double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in Table 3.

[0204] In some specific embodiments, the siRNA conjugate of this disclosure has an inhibition rate of at least about 10% against the CIDEB gene, and may be at least about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between these values.

[0205] prodrug A fourth aspect of this disclosure provides a prodrug. The double-stranded ribonucleic acid (BRNA) described in the first aspect, the BRNA modified by the second aspect, and the BRNA conjugate described in the third aspect of this disclosure can also exist in the form of a prodrug. The prodrug can be converted into the BRNA, BRNA modified by the second aspect, or BRNA conjugate of this disclosure in vivo or in vitro.

[0206] As used in this specification, "prodrug" refers to a compound that exerts its pharmacological effect only after being transformed in vivo. For example, the siRNA modifier or conjugate with M6 pattern modification in this application is a prodrug of the siRNA modifier or conjugate with M2 pattern modification, because the difference between M2 and M6 pattern modification is whether there is a P1 at the 5' end of the antisense strand. Similarly, the relationship between M7 and M3 pattern modification is the same. Therefore, double-stranded ribonucleic acid in this document includes its corresponding prodrug.

[0207] Pharmaceutical Composition The fifth aspect of this disclosure provides a pharmaceutical composition comprising one or more of the double-stranded ribonucleic acid (BRNA) described in the first aspect, the BRNA modification described in the second aspect, the BRNA conjugate described in the third aspect, and the prodrug described in the fourth aspect.

[0208] In some embodiments, the pharmaceutical composition contains siRNA or prodrug as described above as the active ingredient and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition also contains one or more additional therapeutic agents, such as those beneficial for the prevention or treatment of diseases, conditions, or symptoms at least partially mediated by CIDEB gene expression. In this disclosure, the purpose of using the pharmaceutical composition is to facilitate administration to an organism, to facilitate the absorption of the active ingredient, and thereby to exert its biological activity. The pharmaceutical compositions of this disclosure can be administered in any form, including by injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid dosage form, oral liquid dosage form), rectal, inhalation, implantation, topical (e.g., ocular) administration, etc. Non-limiting examples of oral solid dosage forms include, but are not limited to, powders, capsules, lozenges, granules, tablets, etc. Non-limiting examples of oral or mucosal liquid dosage forms include, but are not limited to, suspensions, tinctures, elixirs, solutions, etc. Non-limiting examples of topical dosage forms include, but are not limited to, emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops, or serum preparations. Non-limiting examples of parenteral administration formulations include, but are not limited to, solutions for injection, dry powders for injection, suspensions for injection, and emulsions for injection. The pharmaceutical compositions disclosed herein can also be formulated into controlled-release or delayed-release dosage forms (e.g., liposomes or microspheres).

[0209] In this disclosure, the application method can be varied or modified in any applicable manner to meet the needs of the properties of the drug, the convenience of patients and medical personnel, and other relevant factors.

[0210] Medical Use The sixth aspect of this disclosure provides at least one use of double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, prodrugs, and pharmaceutical compositions as follows: (1) Inhibit CIDEB gene expression, or prepare drugs for inhibiting CIDEB gene expression; (2) To prevent or treat diseases associated with abnormal expression of the CIDEB gene, or to prepare drugs for the prevention or treatment of diseases associated with abnormal expression of the CIDEB gene; (3) To treat subjects with diseases that would benefit from reduced CIDEB gene expression, or to prepare a medicine for treating subjects with diseases that would benefit from reduced CIDEB gene expression.

[0211] This disclosure further provides the use of siRNA molecules (including unmodified siRNA, siRNA modifiers, siRNA conjugates) or their prodrugs or pharmaceutical compositions in at least one of (1)-(3) above.

[0212] In this disclosure, abnormal expression of the CIDEB gene can lead to one or more diseases associated with abnormal CIDEB gene expression, including liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, and metabolic disorders.

[0213] The siRNA molecule causes the expression of the CIDEB gene to be suppressed by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, thereby achieving the treatment of diseases related to abnormal expression of the CIDEB gene.

[0214] In some embodiments, this disclosure provides a method for inhibiting intracellular CIDEB gene expression, comprising contacting a cell with double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, a prodrug, or a pharmaceutical composition.

[0215] Furthermore, a method to inhibit intracellular CIDEB gene expression is to introduce siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or drug compositions into the cells.

[0216] In some embodiments, the cells are in vivo or in vitro cells. In some specific embodiments, the cells are in the body of the subject.

[0217] In some embodiments, this disclosure provides methods for preventing or treating diseases, including administering double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, prodrugs, or pharmaceutical compositions to a subject or patient.

[0218] Furthermore, methods for preventing or treating diseases include administering siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions to subjects or patients.

[0219] In this disclosure, "subject" includes either a human or a non-human animal, preferably a vertebrate, and more preferably a mammal. The subject may include a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics: (1) Abnormal expression of CIDEB gene in vivo, more specifically, abnormally high expression of CIDEB gene; (2) Suffering from a disease associated with abnormal expression of the CIDEB gene; (3) People with diseases that would benefit from reduced CIDEB gene expression. Such as people who have or are predisposed to diseases associated with abnormal CIDEB gene expression.

[0220] The dosage of the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions disclosed herein can be determined based on the patient's weight, age, sex, and disease severity. Based on the amount of double-stranded ribonucleic acid contained therein, the dosage of the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions disclosed herein is approximately 1-300 mg / kg body weight.

[0221] The dosing frequency can be daily, weekly, every two weeks, every three weeks, every one month, every two months, every three months, every four months, every five months, every six months, every seven months, every eight months, every nine months, every ten months, every eleven months, or annually, once or more.

[0222] The total number of times the siRNA molecule (including unmodified siRNA, siRNA modified compounds, and siRNA conjugates), prodrug, or pharmaceutical composition of this disclosure is applied can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 times. For example, the siRNA molecule (including unmodified siRNA, siRNA modified compounds, and siRNA conjugates), prodrug, or pharmaceutical composition of this disclosure can be applied about 1, 2, 3, or 4 times.

[0223] In some embodiments, the siRNA molecules of this disclosure (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, pharmaceutical compositions, and optionally other therapeutic agents may be packaged in a kit, wherein the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, pharmaceutically acceptable carriers, and optionally other therapeutic agents may be provided in liquid or dry form. In some embodiments, the kit includes instructions on how to mix the siRNA molecules or prodrugs with pharmaceutically acceptable carriers or other components.

[0224] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifiers, siRNA conjugates), prodrugs, and pharmaceutical compositions disclosed herein are used to prepare agents for inhibiting CIDEB gene expression.

[0225] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifiers, siRNA conjugates), prodrugs, and pharmaceutical compositions disclosed herein are used to prepare medicaments for the prevention and / or treatment of diseases associated with CIDEB gene overexpression.

[0226] In some implementation schemes, the diseases mentioned include liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, metabolic disorders, etc.

[0227] Table 1 siRNA sequence information

[0228] Table 1-1

[0229] Table 2 siRNA Modifiers

[0230] In the table above, the uppercase letters “G”, “C”, “A”, “T”, and “U” typically represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively; mA, mU, mC, and mG indicate nucleotides modified with 2-methoxy groups; Af, Gf, Cf, and Uf indicate nucleotides modified with 2'-fluorine groups; the lowercase letter 's' indicates that the two nucleotides adjacent to it are linked by a phosphothioester bond; 'd' indicates that the nucleotide adjacent to the right of 'd' is a 2'-deoxyribonucleotide; (invAb) indicates a reverse debased deoxyribose residue; P1 indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP indicates that the nucleotide adjacent to its right is a 5'-trans-vinylphosphonate nucleotide (i.e., a 5'-trans-vinylphosphonate group); [GNA] indicates that the ribonucleotide adjacent to its right is a ribonucleotide modified with GNA.

[0231] Table 3 siRNA conjugates

[0232] In the table above, L96 is the conjugate group GalNAc shown in Formula I.

[0233] In Tables 1, 1-1, 2, and 3, if the left side of the 5' terminal nucleotide of the positive strand, the modified positive strand, and the modified positive strand with a conjugated group is not marked with P1, EVP, or (invAb), it means that the 5' terminal nucleotide is not connected to a 5' phosphate group, a 5' phosphate-derived group, or (invAb), and its structure is shown in Formula X: (Formula X); Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0234] In Tables 1, 1-1, 2 and 3, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with P1 or EVP, it means that the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group, and its structure is as shown in Formula X.

[0235] In Tables 1, 1-1, and 2, the 3' end nucleotide of the sense strand and the modified sense strand has a hydroxyl group at the 3' position (for cases where the end is not (invAb)). In Tables 1, 1-1, 2, and 3, the 3' end nucleotide of the antisense strand and the modified antisense strand has a hydroxyl group at the 3' position.

[0236] Example Other objects, features, and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of this disclosure) are given for illustrative purposes only, as various changes and modifications that can be made within the spirit and scope of this disclosure will become apparent to those skilled in the art upon reading this detailed description.

[0237] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0238] The siRNA, siRNA modifiers, and siRNA conjugates involved in the following examples were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd.

[0239] Example 1: Synthesis of siRNA 1.1 siRNA sequence design Based on the human CIDEB gene mRNA sequence, multiple pairs of CIDEB siRNAs were designed at different sites. All individual siRNAs designed can target all transcripts of the target gene (as shown in Table 4). These multiple pairs of siRNAs showed the lowest homology with all other non-target gene sequences after sequence similarity comparison with sequence similarity software.

[0240] Table 4

[0241] The target sequences used to design siRNA are shown below. These target sequences are derived from the CIDEB gene mRNA sequence (see NM_001393334.1). For ease of comparison, the target sequences below are represented using the corresponding DNA sequences of the mRNA. In the synthesis process of this embodiment, when ribonucleotides are added, the T position corresponds to uracil ribonucleotide U or a modified U.

[0242] Target sequence I: CCAGCACAGGAGAGAACCACCCAGCCCAGAAGTTCCA (SEQ ID NO: 1) Target sequence II: GTTTGGACGGAGGGTCTGGACCTCAGCTCCACCACCCCAGCGACCTTTCCGTGTCTGT (SEQ ID NO: 2) Target sequence II-1: GTTTGGACGGAGGGTCTGG (SEQ ID NO: 10) Target sequence II-2: CACCACCCCAGCGACCTTTCCGTGCTGT (SEQ ID NO: 11) Target sequence III: GAATGGAGTGCTAACCCTGGTGCTAGAGGAGGATGGAACTGCAGTGGACAGTGAGGACTTCTTCCAGCTGCTGGAGGATGACACGTGCCTGATGGTGTTGCAGTCTGGTCAGAGCTGG (SEQ ID NO: 3) Target sequence III-1: GAATGGAGTGCTAACCCTGGTGCTAGAGGAGGATGGAACTGCAGTGGAC (SEQ ID NO: 12) Target sequence III-2: CTTCCAGCTGCTGGAGGATGACACGTGCCTGATGGTGTTGCAGTCTGGTCAGAGCTGG (SEQ ID NO: 13) Target sequence III-3: CTAGAGGAGGATGGAACTGCA (SEQ ID NO: 14) Target sequence IV: GAGAGGCCCAAGCACAGCA (SEQ ID NO: 4) Target sequence V: GAAAGTACTCAGGGAGCTCCTTCGTTGGACCTCCACACTGCTGCAAGGCCTGGGCCATATGTTGCTGGGAATTTCCTCC (SEQ ID NO: 5) Target sequence V-1: GCCATATGTTGCTGGGAATTTCC (SEQ ID NO: 15) Target sequence VI: AGGGCCGCCTCCATTCCTACTAAG (SEQ ID NO: 6) Target sequence VII: GGCCTCCCACTTGCCCTGAAA (SEQ ID NO: 7) Target sequence VIII: CTCCTGTCCCTAAACTCCC (SEQ ID NO: 8) Target sequence IX: TCAGGTCAGTATCTAATATAA (SEQ ID NO: 9) 1.2 Description of the synthesis method: Nucleoside monomers are linked sequentially from 3' to 5' along the nucleotide arrangement using a solid-phase phosphorous amide method. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, oxidation or sulfidation, and capping. When two nucleotides are linked by a phosphodiester bond, the linkage of the next nucleoside monomer involves these four steps. When two nucleotides are linked by a phosphothiodiester bond, the linkage of the next nucleoside monomer involves these four steps. This disclosure selects nucleotide monomers based on the target sequence. The selected nucleotide monomers are those commonly used by those skilled in the art; for example, the nucleotide monomer for synthesizing A can be, but is not limited to, adenosine-3-phosphate. It should be understood that these monomers, when present in oligonucleotides, are linked to each other via 5'-3' phosphodiester bonds or 5'-3' phosphothiodiester bonds. When, for example, the last nucleotide in the 5' to 3' direction has a hydroxyl group at the 3' position, this is achieved using conventional methods in the art.

[0243] 1.3 The synthesis conditions are given as follows: The nucleoside monomer was provided in a 0.1 M acetonitrile solution. The deprotection reaction conditions were the same for each step: 25°C, 70 seconds, and the deprotection reagent was a dichloromethane solution of dichloroacetic acid (3% v / v). The molar ratio of dichloroacetic acid to the 4,4'-dimethoxytriphenylmethyl protecting group on the solid support was 5:1.

[0244] The coupling reaction conditions were identical for each step, including a temperature of 25°C, a molar ratio of nucleic acid sequence to nucleoside monomer linked on the solid-phase support of 1:10, a molar ratio of nucleic acid sequence to coupling reagent linked on the solid-phase support of 1:65, a reaction time of 600 seconds, and a 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole.

[0245] Each oxidation step was performed under identical conditions, including a temperature of 25°C, a reaction time of 15 seconds, and 0.05 M iodine solution as the oxidizing agent. The molar ratio of iodine to the nucleic acid sequence linked on the solid-phase support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

[0246] The conditions for each sulfidation reaction were identical, including a temperature of 25°C, a reaction time of 300 seconds, and the use of hydroflavin as the sulfidation reagent. The molar ratio of the sulfidation reagent to the nucleic acid sequence linked on the solid-phase support in the coupling step was 120:1. The reaction was carried out in a mixed solvent of acetonitrile and pyridine in a ratio of 1:1.

[0247] Each capping step was performed under identical conditions, including a temperature of 25°C and a reaction time of 15 seconds. The capping reagent solution was a 1:1 molar mixture of CapA and CapB, and the molar ratio of the capping reagent to the nucleic acid sequence linked on the solid-phase support was acetic anhydride:N-methylimidazole:nucleic acid sequence linked on the solid-phase support = 1:1:1.

[0248] After the last nucleoside monomer is ligated, the nucleic acid sequence ligated on the solid-phase support is subjected to ammonolysis, purification, and desalting, followed by freeze-drying to obtain the sense and antisense strands; finally, the two strands are heated and annealed to obtain the product, which is then freeze-dried to obtain freeze-dried powder.

[0249] The synthesized siRNAs are shown in Table 1 and Table 1-1, and the synthesized siRNA modifiers are shown in Table 2.

[0250] Example 2: Synthesis of siRNA conjugate (GalNAc-siRNA) Taking the synthesis of L96 as an example: 2.1 The siRNA conjugate has the structure shown in Formula II:

[0251] 2.2 Synthesis process of siRNA conjugates The first step involves reacting DMTr-L96 with succinic anhydride to obtain compound L96-A:

[0252] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine, and diisopropylethylamine were added to dichloromethane and stirred at 25°C for 24 hours. The reaction solution was then washed with 0.5 M triethylamine phosphate, and the aqueous phase was washed three times with dichloromethane. The combined organic phases were evaporated to dryness under reduced pressure to obtain the crude product. Then, column chromatography was used to purify the product to obtain pure L96-A.

[0253] The second step involves reacting L96-A with NH2-SPS to obtain L96-B:

[0254] Preparation process: L96-A, O-benzotriazole-tetramethylurea hexafluorophosphate (HBTU), and diisopropylethylamine (DIPEA) were mixed and dissolved in acetonitrile. The mixture was stirred at room temperature for 5 minutes to obtain a homogeneous solution. Aminomethyl resin (NH2-SPS, 100-200 mesh) was added to the reaction solution, and the reaction was initiated at 25°C on a shaker. After 18 hours of reaction, the mixture was filtered. The filter cake was washed successively with dichloromethane and acetonitrile to obtain the filter cake. The obtained filter cake was subjected to a capping reaction with a CapA / CapB mixed solution to obtain L96-B, which is the solid-phase support containing the conjugated molecules.

[0255] The third step is the synthesis of siRNA conjugates: Using L96-B as a solid-phase support, the sense strand of the siRNA conjugate was synthesized according to the siRNA synthesis method described above. The antisense strand of the siRNA conjugate was then synthesized using the same method. Annealing was performed to generate the disclosed siRNA conjugate.

[0256] The synthesized siRNA conjugates are shown in Table 3.

[0257] Example 3: siRNA, siRNA modifiers, and siRNA conjugates inhibit CIDEB gene expression 3.1 Experimental Materials: HepG2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences, catalog number SCSP-510. RNA extraction kit, RNeasy® 96 Kit, purchased from QIAGEN, catalog number 74182; Lipo® RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150; MEM medium, purchased from Gibco, catalog number 41090036; HiScript Reverse Transcription Kit ® III. 1st Strand cDNA Synthesis Kit (+gDNAwiper), purchased from Vazyme, catalog number R312-02; TaqMan™ gene expression premix, purchased from Applied Biosystems, catalog number 4369016; Opti-MEM: serum-reduced culture medium, purchased from Gibco, catalog number 31985070; Target CIDEB primer and probe set, purchased from Thermo, Hs00205339_m1; TaqMan Gene Expression Assay (GAPDH), purchased from Thermo, ID- Hs99999905_m1.

[0258] 3.2 Experimental Methods: 3.2.1 HepG2 cells were seeded in fresh MEM medium in 96-well plates and cultured for 48 hours. The cultured cells were then resuspended in PS-free (penicillin-streptomycin mixture) MEM medium to a density of 1.11 × 10⁻⁶ cells / well. 5 A cell suspension of 10,000 cells / mL was spread into a 96-well plate, with 90 μL of cell suspension added to each well, resulting in 10,000 cells / well.

[0259] 3.2.2 The dry powders of the siRNA to be tested, siRNA modifiers, and siRNA conjugates (collectively referred to as siRNA in the experimental procedure description of this embodiment for ease of description) were centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0260] 3.2.3 Prepare 200 nM siRNA dilution solution Z and 2 nM siRNA dilution solution W (1) 10 μM siRNA stock solution Q and 0.1 μM siRNA stock solution E: a. Take 2 μL of the 100 μM siRNA stock solution obtained in step 3.2.2 above, add 18 μL of ultrapure distilled water to obtain siRNA stock solution Q with a final concentration of 10 μM. b. Take 2 μL of the 10 μM siRNA stock solution Q obtained in step a, add 18 μL of ultrapure distilled water to obtain siRNA stock solution Y with a final concentration of 1 μM. c. Take 2 μL of the 1 μM siRNA stock solution Y prepared in step b, add 18 μL of ultrapure distilled water to obtain siRNA stock solution E with a final concentration of 0.1 μM. (2) Take 2 μL of the above-prepared siRNA stock solution E and add 98 μL of Opti-MEM to obtain 2 nM siRNA dilution W; take 2 μL of the above-prepared siRNA stock solution Q and add 98 μL of Opti-MEM to obtain 200 nM siRNA dilution Z.

[0261] 3.2.4 Transfection of HepG2 cells (1) Take 3 μL of Lipo® RNAiMAX transfection reagent and add 97 μL of Opti-MEM to obtain Lipo® RNAiMAX transfection reagent dilution; mix the Lipo® RNAiMAX transfection reagent dilution with the 2 nM siRNA dilution W prepared in step 3.2.3 at a volume ratio of 1:1, let stand for 5 minutes, and add 10 μL of the transfection mixture to a 96-well plate to transfect the HepG2 cells cultured in step 3.2.1 (final volume 100 μL, the concentration of siRNA in this system is 0.1 nM).

[0262] (2) Take 3 μL of Lipo® RNAiMAX transfection reagent and add 97 μL of Opti-MEM to obtain Lipo® RNAiMAX transfection reagent dilution; mix the Lipo® RNAiMAX transfection reagent dilution with the 200 nM siRNA dilution Z prepared in step 3.2.3 at a volume ratio of 1:1 to prepare a transfection mixture, let stand for 5 minutes, take 5 μL of the transfection mixture and add it to a 96-well plate to transfect the HepG2 cells cultured in step 3.2.1 (final volume 100 μL, the concentration of siRNA in this system is 5 nM).

[0263] The cells were cultured for 48 hours after transfection; two replicates were set up for each concentration (5 nM and 0.1 nM).

[0264] 3.2.5 Extract total RNA from HepG2 cells obtained in step 3.2.4 according to the RNA extraction kit instructions.

[0265] 3.2.6 The total RNA obtained in step 3.2.5 was reverse transcribed into cDNA using a reverse transcription kit, following these steps: a) Remove gDNA using gDNAase according to the table below; Table 5

[0266] 42°C, 2 min; 4°C, stand. b) Perform the reverse transcription procedure as follows: Table 6

[0267] 50°C, 15 min; 85°C, 5 s.

[0268] c) Store the reverse transcription product obtained in step b) at 4°C for real-time PCR analysis.

[0269] 3.2.7 Perform real-time PCR analysis a) Prepare the qPCR reaction mixture as shown in the table below. Keep all reagents on ice throughout the entire process. Table 7

[0270] b) Perform the qPCR procedure as described below. 50°C, 2 minutes; 95°C, 10 minutes; 95°C, 15 seconds, 60°C, 1 minute (this operation is repeated 40 times).

[0271] 3.2.8 Results Analysis a) Use Quant Studio 6 Flex software with default settings to automatically calculate the Ct value; b) Calculate the relative expression level of the gene using the following formula: ΔCt = Ct (CIDEB gene) –Ct (GAPDH) ΔCt = ΔCt (sample group) - ΔCt (mock group) mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0272] Mock group: Compared to the test sample group, the group without siRNA was not added. Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100% 3.3 Results of the Silence Experiment The concentrations of 0.1 nM and 5 nM were selected for testing, and the results are shown in Tables 8, 9 and 10.

[0273] Table 8

[0274] As shown in Table 8, in the HepG2 cell experiment, the siRNA disclosed in this paper has high inhibitory activity against the CIDEB gene. The concentration of 5 nM generally showed a higher inhibition rate against the CIDEB gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0275] Table 9

[0276] "--" indicates that the result is not shown.

[0277] As shown in Table 9, in HepG2 cell experiments, the siRNA modifier disclosed herein exhibits high inhibitory activity against the CIDEB gene. The concentration of 5 nM generally showed a higher inhibition rate against the CIDEB gene than the concentration of 0.1 nM, demonstrating a dose-dependent effect.

[0278] Table 10

[0279] As shown in Table 10, in HepG2 cell experiments, the siRNA conjugate disclosed herein exhibits high inhibitory activity against the CIDEB gene. The concentration of 5 nM generally showed a higher inhibition rate against the CIDEB gene than the concentration of 0.1 nM, demonstrating a dose-dependent effect.

[0280] 3.4 IC 50 Measurement results The following concentration ranges (nM) for the siRNA assay were set as follows: 20, 5, 1.25, 0.3125, 0.0781, 0.0195, 0.0049, 0.0012. IC50 assays were then performed using a method similar to that in section 3.2. 50 Measurement.

[0281] Results analysis: a) Use Quant Studio 6 Flex software with default settings to automatically calculate the Ct value; b) Calculate the relative expression level of the gene using the following formula: ΔCt = Ct (CIDEB gene) –Ct (GAPDH) ΔCt = ΔCt (test sample group) – ΔCt (Mock group), where the Mock group represents the group without siRNA compared to the test sample group; mRNA expression relative to the Mock group = 2 -ΔΔCt Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100% Calculation process: Using the log value of siRNA concentration as the X-axis and the percentage inhibition rate as the Y-axis, the "log (inhibitor) vs. response-variable slope" function module of GraphPad Prism 8 was used to fit the dose-response curve, thereby obtaining the IC50 of each siRNA. 50 value.

[0282] The fitting formula is: Y = Bottom + (Top - Bottom) / (1 + 10^(logIC))50 -X)×HillSlope)) Where: Top represents the percentage inhibition rate at the top plateau, and the standard for the Top of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom plateau, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0283] The results are shown in Table 11 below.

[0284] Table 11

[0285] As can be seen from Table 11, in the HepG2 cell experiment, the siRNA and siRNA modifier disclosed herein have high inhibitory activity against the CIDEB gene.

[0286] Example 4: Determination of the inhibition rate of CIDEB gene expression by siRNA conjugates 4.1 Test materials: Human primary hepatocytes (PHH cells) were provided by Shanghai WuXi AppTec Co., Ltd. PHH culture medium: invitroGRO CP Medium, purchased from Bioreclamation, catalog number: S03316; Lipo® RNAiMAX transfection reagent, purchased from Invitrogen, catalog number: 13778-150; RNeasy® 96 Kit, purchased from Qiagen, item number 74182; FastQuant RT Kit (including gDNase), purchased from TianGen, item number: KR116-02; TaqMan® Fast Advanced Master Mix, purchased from Applied Biosystems, product number 4369016; HiScript III RT SuperMix for qPCR (+gDNA wiper), purchased from Vazyme, catalog number R323-01; Random hexamers, purchased from Thermo, item number N8080127; CIDEB probe, purchased from Thermo, part number Hs00205339_m1; GAPDH probe, purchased from Thermo, part number Hs99999905_m1.

[0287] 4.2 Test Methods siRNA conjugates (final concentrations of siRNA conjugates were 5 nM and 1 nM, in duplicate) were transfected into PHH cells, as described below: Frozen PHH cells were harvested, thawed, counted, and adjusted to a cell volume of 6 × 10⁶ cells / well. 5 Cells / mL were transfected with siRNA conjugates using Lipo® RNAiMax transfection reagent, and seeded at a density of 54,000 cells per well in 96-well plates. 100 μL of PHH culture medium was added to each well. Cells were incubated in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and cells were collected for total RNA extraction. Total RNA was extracted using the RNeasy® 96 Kit according to the kit instructions.

[0288] siRNA conjugates (final concentrations of siRNA conjugates were 50 nM and 10 nM, in duplicate) were introduced into PHH cells via free uptake, as described below: Frozen PHH cells were harvested, thawed, counted, and adjusted to a cell volume of 6 × 10⁶ cells / well. 5 Cells / mL, along with siRNA conjugate, were seeded into 96-well plates at a density of 54,000 cells per well, with 100 μL of PHH medium added to each well. Cells were incubated in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and cells were collected for total RNA extraction. Total RNA was extracted using the RNeasy® 96 Kit according to the kit's instructions.

[0289] Reverse transcription to cDNA was performed using a reverse transcription kit, following these steps: (1) Remove gDNA using gDNAase according to Table 12 below; Table 12

[0290] 42°C, 2 min; 4°C, stand.

[0291] (2) Prepare the reverse transcription reaction mixture as shown in the table below and mix thoroughly. Running procedure: 50°C for 15 minutes, 85°C for 5 seconds.

[0292] Table 13

[0293] (3) Detect the cDNA of the target gene by qPCR.

[0294] Table 14

[0295] Table 15

[0296] The qPCR procedure is performed as follows: 50°C, 2 minutes; 95°C, 10 minutes; 95°C, 15 seconds, 60°C, 1 minute (this operation is repeated 40 times).

[0297] Results analysis: a) Use Quant Studio 7 software with default settings to automatically calculate the Ct value; b) Calculate the relative expression level of the gene using the following formula: ΔCt = Ct (CIDEB gene) – Ct (GAPDH) ΔCt = ΔCt (test sample group) – ΔCt (Mock group), where the Mock group represents the group without siRNA conjugate compared to the test sample group; mRNA expression relative to the Mock group = 2 -ΔΔCt Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100% The experimental results are shown in Table 16.

[0298] Table 16 Inhibition rate (%) of siRNA conjugates on CIDEB gene expression

[0299] "--" indicates that the result was not detected.

[0300] As can be seen from Table 16, the siRNA conjugate disclosed herein exhibits good inhibitory activity against the CIDEB gene in PHH cell experiments.

[0301] Example 5: In vitro stability test of rat liver homogenate 5.1 Experimental reagents and consumables

[0302] 5.2 Experimental Procedure 5.2.1 Preparation of liver homogenate 5.2.1.1 Grinding fluid preparation

[0303] 5.2.1.2 Tissue homogenization Rat liver tissue (collected from SD rats, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) was mixed with homogenizing solution at a ratio of 100 mg: 5 mL to prepare liver homogenate (concentration of 20 mg / mL). After preparation, the homogenate was added to a homogenizer with the following homogenization parameters set.

[0304]

[0305] 5.2.2 Sample Preparation The siRNA conjugate sample was prepared into a 1 mg / mL solution using enzyme-free water and set aside for later use. The internal standard sample was prepared into a 0.2 mg / mL solution using enzyme-free water.

[0306] 5.2.3 Incubation of biological samples (1) Add 250 μL of the prepared liver homogenate to a 2 mL enzyme-free tube. (2) Add 50 μL of siRNA conjugate sample solution based on step (1); (3) The system is a 300 μL biological sample solution, vortexed, and allowed to stand for 5 min; (4) Divide into 2 tubes, each containing 100 μL; (5) The system was incubated at 37°C for 48 h.

[0307] 5.2.4 Biological Sample Processing Vortex each 100 μL biological sample system, mix well, add 300 μL of Clarity OTX lysis buffer (ClarityOTX Lysis-loading Buffer, purchased from Agilent-FinnoMed, catalog number AL0-8579), vortex, let stand for 30 min, add 100 μL of internal standard solution, vortex, centrifuge at low speed for 5 min at 1500 rpm, and set aside for use (total sample volume approximately 500 μL).

[0308] 5.2.5 Solid-phase extraction: (1) Preparation of solid phase extraction reagent Activator: Add 200 mL of methanol to the mobile phase bottle and label it as activator; Equilibrium buffer: Prepare a 1 M phosphate buffer solution [877 mL sodium dihydrogen phosphate (1.56 g / L) + 123 mL disodium hydrogen phosphate (3.58 g / L)], dilute it 100 times, adjust the pH to 5.5 with phosphate, and label it as equilibrium buffer; Rinse solution: Take 500 mL of equilibrium solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, mix well, and label as rinsing solution; Eluent: Weigh 7.9 g of ammonium bicarbonate into a 1 L mobile phase bottle, add 1 L of water, adjust the pH to 9.5 using sodium hydroxide, take 500 mL of ammonium bicarbonate solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, mix well, and label as eluent; (2) The extraction steps are as follows:

[0309] 5.2.6 Post-processing Take the eluent (600 μL in three portions, totaling 1800 μL) and place it in a 2 mL EP tube. Concentrate under vacuum (or dry under nitrogen at 40°C) for 10 hours at 1800 rpm. Reconstitute the concentrated sample with 100 μL of mobile phase (initial ratio), centrifuge at 15°C for 20 min at 12000 rpm, and inject 10 μL of the supernatant into a high-resolution mass spectrometer. The antisense strand percentage of the siRNA conjugate disclosed in this invention is semi-quantitatively determined using LC-MS / MS. The calculation formula is: AS strand remaining percentage % = AS... MS intensity The sum of / AS chains and all related degradation products MS intensity ×100%; where MS intensity is the mass spectrometry intensity signal value. The metabolic results after incubation in rat liver homogenate for 48 hours are shown in the table below.

[0310] Table 17. Remaining antisense strand percentage of siRNA conjugates

[0311] Where AS represents the antisense strand of the siRNA conjugate, a larger remaining AS indicates better drug stability and longer-lasting effect. Table 17 shows that the siRNA conjugate disclosed in this invention exhibits excellent in vitro stability in rat liver homogenate.

[0312] Example 6: Silent effect of siRNA conjugates on mice expressing the human CIDEB (hCIDEB) gene 6.1 Constructing a mouse model overexpressing the hCIDEB gene using AAV Six- to eight-week-old male C57BL / 6 mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) were introduced into the facility. After acclimatization for 3-5 days, a single tail vein injection of adeno-associated virus (AAV) containing the hCIDEB gene (pAAV[Exp]-CBh>SEAP(ns):T2A:{CIDEB CDS+part3'UTR}, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) was administered to induce target gene overexpression. The administration volume was 100 μL (5 × 10⁻⁶ mcg). 11 vg) / animal, followed by regular feed.

[0313] 6.2 In vivo efficacy study of siRNA silencing in hCIDEB mouse model Fourteen days after AAV virus injection, mice were divided into groups of five. Mice were subcutaneously administered a single 3 mg / kg dose of the disclosed siRNA conjugate at a volume of 5 μL / g in RNase-free sterile PBS. The control group received the same volume of RNase-free sterile PBS. Serum was collected from mice on days 7, 14, and 28 post-administration. The serum solutions were stored at -80°C for long-term preservation. Before testing, the solutions were thawed on ice, centrifuged, and the supernatant was collected for protein content analysis. SEAP protein expression (reflecting hCIDEB protein expression) was detected using the Phospha-Light™ SEAP reporter gene detection system (Invitrogen™, Thermo Fisher Scientific, catalog number T1017). The inhibition rate (%) of the siRNA conjugate in mice expressing the human CIDEB (hCIDEB) gene was calculated as (1 - mean protein expression in the treated group / mean protein expression in the control group) × 100%, as shown in Table 18.

[0314] Table 18

[0315] As can be seen from Table 18, the siRNA conjugate disclosed herein has high inhibitory activity against the hCIDEB gene in vivo.

[0316] In mouse in vivo experiments, N-ER-FY044120M46L96 still maintained an inhibition rate of over 85% on day 28, and N-ER-FY044146M46L96 still maintained an inhibition rate of over 70% on day 28, demonstrating long-lasting efficacy.

[0317] The embodiments described above are merely examples for clearly illustrating the present disclosure and are not intended to limit the implementation of the present disclosure. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively describe all possible implementations. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this disclosure should be included within the scope of protection of the claims of this disclosure.

Claims

1. A double-stranded ribonucleic acid (BRNA) for inhibiting CIDEB gene expression, wherein the BRNA comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are anticomplementary and / or substantially anticomplementary to form a double-stranded region of the BRNA; in, The sense strand comprises a sequence A that differs from the target sequence by no more than 3 nucleotides in at least 15 consecutive nucleotides, and the antisense strand comprises a sequence B that differs from the target sequence by no more than 3 nucleotides in its reverse complementary sequence of at least 15 consecutive nucleotides. The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NO: 1 to 9 and the sequence consisting of at least 15 consecutive nucleotides contained in any one of SEQ ID NO: 1 to 9.

2. The double-stranded ribonucleic acid according to claim 1, wherein, The target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO: 1, 4, 6-15, the sense strand comprises sequence A consisting of at least 15 consecutive nucleotides from the nucleotide sequences shown in any one of SEQ ID NO: 1, 4, 6-15, and the antisense strand comprises sequence B consisting of at least 15 consecutive nucleotides from the nucleotide sequences shown in any one of SEQ ID NO: 1, 4, 6-15 that is anticomplementary to and / or substantially anticomplementary to the sequence.

3. The double-stranded ribonucleic acid according to claim 1 or 2, wherein, The positive chain consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21, or 23 nucleotides; and / or The antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21 or 23 nucleotides.

4. The double-stranded ribonucleic acid according to claim 3, wherein, The nucleotide sequence of the positive strand is sequence A, which differs by no more than 1 nucleotide from the sequence consisting of 15-28 consecutive nucleotides shown in any one of SEQ ID NO: 1, 4, 6-15, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and even more preferably 19, 21, or 23 nucleotides; and / or The nucleotide sequence of the antisense strand is a sequence B that differs by no more than one nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides in any one of the nucleotide sequences shown in SEQ ID NO: 1, 4, 6-15, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and even more preferably 19, 21 or 23 nucleotides.

5. The double-stranded ribonucleic acid according to any one of claims 1-4, wherein, The length of the double-stranded region is 15-25 nucleotides, preferably 19-23 nucleotides, and more preferably 19, 21 or 23 nucleotides.

6. The double-stranded ribonucleic acid according to any one of claims 1-5, wherein, The sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, while the 3' end of the sense strand has a blunt end; or, The positive chain and the negative chain complement each other to form the double-chain region, and both the positive chain and the negative chain have flat ends at their 3' ends.

7. The double-stranded ribonucleic acid according to any one of claims 1-5, wherein, The justice chain and the antisense chain are selected from the following combinations: The sense strand includes the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 of this document, and the antisense strand includes the antisense strand of the corresponding siRNA. Preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand includes the sense strand of any one of the siRNAs listed in Tables 1 and 1-1 of this document: siRNA 64, siRNA 224, siRNA 282, and siRNA 299. The antisense strand includes the antisense strand of the corresponding siRNA.

8. The double-stranded ribonucleic acid according to any one of claims 1-7, wherein, Each nucleotide in the sense strand is independently a modified or unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified or unmodified nucleotide.

9. The double-stranded ribonucleic acid according to any one of claims 1-8, wherein, In the sense strand, any two nucleotides linked together are connected by a phosphodiester bond or a thiophosphate diester bond, and / or, in the antisense strand, any two nucleotides linked together are connected by a phosphodiester bond or a thiophosphate diester bond.

10. The double-stranded ribonucleic acid according to any one of claims 1-9, wherein, The 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group, or the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

11. The double-stranded ribonucleic acid according to any one of claims 1-10, wherein, Neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 3' terminal nucleotide and / or the 5' terminal nucleotide of the positive strand is connected to a reverse debased deoxyribose residue.

12. The double-stranded ribonucleic acid according to any one of claims 1-11, wherein, The double-stranded ribonucleic acid is siRNA used to inhibit CIDEB gene expression.

13. A double-stranded ribonucleic acid (BRNA) modifier, which is a BRNA modifier according to any one of claims 1-12, wherein the BRNA modifier comprises at least one of the following chemical modifications: (1) Modification of at least one nucleotide in the positive strand, (2) Modification of the phosphodiester bond at at least one position in the positive chain. (3) Modification of at least one nucleotide in the antisense strand, (4) Modification of the phosphodiester bond at at least one position in the antisense chain; Optionally, the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modification includes sequence B and sequence E, wherein the 3' end of sequence B in the antisense strand is connected to sequence E, which consists of 1-2 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; Optionally, the sense and antisense strands of the double-stranded ribonucleic acid modification are selected from the following sequence combinations: The nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E.

14. The double-stranded ribonucleic acid modified product according to claim 13, wherein, The modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification, or any combination of two or more thereof; Preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification, or any combination of two or more thereof; More preferably, the nucleotide derivative in the nucleotide derivative modification is selected from isonucleotides, LNA, ENA, cET, UNA, or GNA.

15. The double-stranded ribonucleic acid modified product according to claim 13 or 14, wherein, Along the direction from the 3' end to the 5' end, the ribonucleotides at positions 9, 10, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 15 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 5, 7, 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 7, 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 17 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 9, 11, 13, and 17 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 6, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11 and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

16. The double-stranded ribonucleic acid modifier according to any one of claims 13-15, wherein, When neither the 3' nor 5' terminal nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, the positive strand contains a phosphothioester bond located at the following positions along the 5'-to-3' direction: Between the first and second nucleotides starting at the 5' end of the positive strand; and Between the second and third nucleotides starting at the 5' end of the positive strand; When only the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, the positive strand contains a phosphothioester bond located at the following positions along the 5'-to-3' direction: Between the first and second nucleotides starting at the 5' end of the positive strand; Between the second and third nucleotides starting at the 5' end of the positive strand; and Between the reverse debased deoxyribose residue starting at the 3' end of the positive strand and the first nucleotide; When the 5' and 3' nucleotides of the positive strand are respectively linked to reverse debased deoxyribose residues, the positive strand contains phosphothioester bonds located at the positions shown below along the 5' to 3' direction: Between the reverse debased deoxyribose residue starting at the 5' end of the positive strand and the first nucleotide; Between the first and second nucleotides starting at the 5' end of the positive strand; and The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

17. The double-stranded ribonucleic acid modified product according to any one of claims 13-16, wherein, Along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotides at positions 5 and 12 of the antisense strand are 2'-deoxy modified nucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides. Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 12, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

18. The double-stranded ribonucleic acid modified product according to any one of claims 13-17, wherein, The antisense chain contains a phosphothiophosphate diester bond located at the following positions: Between the first and second nucleotides starting at the 5' end of the antisense strand; Between the second and third nucleotides starting at the 5' end of the antisense strand; Between the first and second nucleotides starting at the 3' end of the antisense strand; Between the second and third nucleotides starting at the 3' end of the antisense strand.

19. The double-stranded ribonucleic acid modified product according to any one of claims 13-18, wherein, The justice chain and the antisense chain are selected from the following combinations: The sense strand comprises the sense strand of any of the double-stranded ribonucleic acid modifications shown in Table 2 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA modification. Preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand comprises the sense strand of any one of the siRNA modifiers shown in Table 2 of this document: siRNA 107-siRNA 126, siRNA 155-siRNA 170, siRNA 246-siRNA 259, siRNA 275-siRNA 276, siRNA 284-siRNA 285, and siRNA 288. The antisense strand comprises the antisense strand of the corresponding siRNA modifier.

20. A double-stranded ribonucleic acid conjugate, wherein, The double-stranded ribonucleic acid conjugate comprises the double-stranded ribonucleic acid as described in any one of claims 1-12, or the double-stranded ribonucleic acid modifier as described in any one of claims 13-19; and a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modifier.

21. The double-stranded ribonucleic acid conjugate according to claim 20, wherein, The conjugating group has any of the following structures: (Equation I); (Formula III); (Form IV); (Formula V); (Form VI); (Equation VII); (Formula VIII); (Formula IX).

22. The double-stranded ribonucleic acid conjugate according to claim 20 or 21, wherein, The conjugation group is attached to the 3' end of the positive chain; Preferably, the conjugating group is conjugated to the 3' end of the positive chain via a phosphate diester bond or a thiophosphate diester bond.

23. The double-stranded ribonucleic acid conjugate according to any one of claims 20-22, wherein, The double-stranded ribonucleic acid conjugate has the following structure: (Equation II) The double helix structure is a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modified product.

24. The double-stranded ribonucleic acid conjugate according to any one of claims 20-23, wherein, The double-stranded ribonucleic acid conjugate is an siRNA conjugate used to inhibit CIDEB gene expression.

25. The double-stranded ribonucleic acid conjugate according to any one of claims 20-24, wherein, The double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 to a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifiers shown in Table 2 to a conjugate group. Preferably, in the double-stranded ribonucleic acid conjugate, the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any of the siRNA conjugates shown in Table 3 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate. More preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand includes the sense strands of siRNA 181-siRNA 196, siRNA 226-siRNA 239, siRNA 260-siRNA 273, siRNA 277-siRNA 278, siRNA 291-siRNA 292, and siRNA 295 shown in Table 3 of this document, and the antisense strand includes the antisense strand of the corresponding siRNA conjugate.

26. The prodrug of the double-stranded ribonucleic acid according to any one of claims 1-12, the double-stranded ribonucleic acid modified product according to any one of claims 13-19, or the double-stranded ribonucleic acid conjugate according to any one of claims 20-25.

27. A pharmaceutical composition, wherein, The pharmaceutical composition comprises at least one of the following: double-stranded ribonucleic acid as claimed in any one of claims 1-12, double-stranded ribonucleic acid modified as claimed in any one of claims 13-19, double-stranded ribonucleic acid conjugate as claimed in any one of claims 20-25, and prodrug as claimed in claim 26; Preferably, the pharmaceutical composition further includes one or more pharmaceutically acceptable carriers, and optionally includes one or more additional therapeutic agents.

28. Use of the double-stranded ribonucleic acid according to any one of claims 1-12, the double-stranded ribonucleic acid modified product according to any one of claims 13-19, the double-stranded ribonucleic acid conjugate according to any one of claims 20-25, the prodrug according to claim 26, or the pharmaceutical composition according to claim 27, in at least one of the following: (1) Inhibit CIDEB gene expression in vivo or in vitro, or prepare a drug for inhibiting CIDEB gene expression; (2) To prevent or treat diseases associated with abnormal expression of the CIDEB gene, or to prepare drugs for the prevention or treatment of diseases associated with abnormal expression of the CIDEB gene; (3) To treat subjects with diseases that would benefit from reduced CIDEB gene expression, or to prepare a medicine for treating subjects with diseases that would benefit from reduced CIDEB gene expression.

29. The use according to claim 28, wherein, The diseases associated with abnormal CIDEB gene expression are selected from the group consisting of the following diseases: Liver fibrosis, hepatitis B, hepatitis C, non-alcoholic steatohepatitis, atherosclerosis, cardiovascular disease, ulcerative colitis, clear cell renal cell carcinoma, obesity, diabetes, hepatic steatosis, and metabolic disorders.

30. A method for inhibiting intracellular CIDEB gene expression in vivo or in vitro, wherein, The method comprises contacting the cells with a double-stranded ribonucleic acid according to any one of claims 1-12, a double-stranded ribonucleic acid modifier according to any one of claims 13-19, a double-stranded ribonucleic acid conjugate according to any one of claims 20-25, a prodrug according to claim 26, or a pharmaceutical composition according to claim 27.