Promoter library applicable to bifidobacterium breve and application

Abstract

The invention discloses a promoter library applicable to bifidobacterium breve and application, and belongs to the technical field of genetic engineering and microbial engineering. According to the invention, a promoter PC9 with bidirectional transcription characteristics and an inducible promoter responding to linoleic acid are obtained through screening. Wherein the promoter PC3-LA can obviously respond to the LA to improve the activity, and the PB5 has the strongest activity. The invention also constructs a promoter library with gradient intensity, can realize controllable expression of target protein in bifidobacterium microorganisms, provides an element for promoter engineering of bifidobacterium breve, and has wide application value.

Description

Technical Field

[0001] This invention relates to promoter libraries applicable to Bifidobacterium breve and their applications, belonging to the fields of genetic engineering and microbial engineering technology. Background Technology

[0002] Bifidobacterium breve is a probiotic that positively impacts the human body through various mechanisms, including but not limited to enhancing intestinal barrier function, inhibiting the growth of harmful pathogens, regulating the immune system, and promoting nutrient absorption and metabolic processes. Probiotic strains belonging to the Bifidobacterium genus, including Bifidobacterium breve, have been used in the food industry as preventative and therapeutic agents. As the elucidation of the probiotic mechanism of Bifidobacterium breve focuses on metabolic pathways, the genes of some key enzymes have been identified. For example, a key enzyme for CLA conversion has been identified in the high-CLA-producing Bifidobacterium breve CCFM683. bbi A key aromatic lactate dehydrogenase was identified in *Bifidobacterium breve* CCFM1025, a gene that alleviates depression in mice. Aldh Genes. The development and validation of key enzyme genes involved in the probiotic mechanism of Bifidobacterium breve has become a research hotspot, thus requiring more gene manipulation tools to promote gene expression within Bifidobacterium breve.

[0003] A promoter is a sequence that specifically binds to RNA polymerase, assisting in gene transcription within the host and subsequently exerting its function after translation. Therefore, promoters are widely used in gene editing, metabolic engineering, and synthetic biology. Promoters are classified into constitutive and inducible promoters. Constitutive promoters can stably initiate transcription regardless of environmental influences, while inducible promoters require an inducer to regulate transcription. Since gene manipulation requires not only stable gene expression but also regulated expression, both constitutive and inducible promoters play crucial roles. However, endogenous promoter resources for *Bifidobacterium breve* are very limited. Currently available promoters are mostly derived from other lactic acid bacteria, or require specific inducers to initiate gene transcription, or lack universality and cannot be used for most *Bifidobacterium breve* strains. Therefore, developing and establishing promoters and promoter libraries suitable for *Bifidobacterium breve* is essential for achieving controlled expression of target genes in genetically engineered *Bifidobacterium breve* bacteria. Summary of the Invention

[0004] [Technical Issues] The technical problem to be solved by this invention is to screen widely usable constitutive promoters and linoleic acid-regulated inducible promoters, so as to construct a promoter library suitable for Bifidobacterium breve and provide elements for promoter engineering of Bifidobacterium breve.

[0005] [Technical Solution] This invention provides a bidirectional promoter P C9 Its nucleotide sequence is shown in SEQ ID NO.9.

[0006] This invention also provides a promoter P that can increase the expression intensity of the target protein. C6 Its nucleotide sequence is shown in SEQ ID NO. 6.

[0007] This invention provides a promoter library comprising four constitutive promoters and three inducible promoters. The constitutive promoter strengths, from highest to lowest, are: P... C6 P C9 P C1 P C11 The nucleotide sequences are shown in SEQ ID NO. 6, SEQ ID NO. 9, SEQ ID NO. 1, and SEQ ID NO. 11, respectively; the inducible promoter is responsive to linoleic acid induction, and the expression intensity from high to low is as follows: P C2-LA P C4-LA P C3-LA Their nucleotide sequences are shown in SEQ ID NO.30, SEQ ID NO.32, and SEQ ID NO.31, respectively.

[0008] The present invention also provides a recombinant plasmid carrying the promoter.

[0009] In one embodiment, the plasmid includes, but is not limited to, pNZ123.

[0010] In one implementation, the promoter is linked to the target gene only downstream.

[0011] In one implementation, the upstream and downstream of the promoter are simultaneously connected to the target gene.

[0012] In one embodiment, the target gene includes, but is not limited to, endogenous or exogenous genes.

[0013] The present invention also provides a genetically engineered Bifidobacterium strain, using pNZ123 as a vector, and using a promoter with a nucleotide sequence as shown in any of SEQ ID NO. 1-36 to regulate the expression of the target protein.

[0014] In one embodiment, the Bifidobacterium includes, but is not limited to, Bifidobacterium breve, Bifidobacterium longum, Bifidobacterium bifidum, or Bifidobacterium animalis.

[0015] In one embodiment, the bifidobacteria are selected from: Bifidobacterium breve (Bifidobacterium breve) Bifidobacterium breve CCFM683, Bifidobacterium breve FJSWX38M7, Bifidobacterium breve CCFM1310, Bifidobacterium breve CCFM1400; Bifidobacterium longum subsp. infantis ( Bifidobacterium longum subsp. Infantis CCFM1427, Bifidobacterium longum subsp. ( Bifidobacterium longum subsp. LongumCCFM1375; Bifidobacterium adolescentis ( Bifidobacterium of a young man CCFM1322, Bifidobacterium animalis ( Bifidobacterium animalum (CCFM1148)

[0016] This invention also provides a promoter library after semi-rational modification of the aforementioned promoter. The modified promoter library includes five constitutive promoters, with their strengths in descending order as follows: P B5 P B6 P B2 P B7 P B12 Its nucleotide sequences are shown in SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.18, SEQ ID NO.23, and SEQ ID NO.28.

[0017] This invention also provides the application of promoters in the promoter library in regulating gene expression.

[0018] In one implementation, the application uses a constitutive promoter to regulate the sustained and stable expression of a gene.

[0019] In one implementation, the application uses an inducible promoter to respond to the increased expression of linoleic acid-regulated genes at a specific time point.

[0020] In one embodiment, the application involves culturing the genetically engineered Bifidobacterium in a culture medium containing linoleic acid.

[0021] In one embodiment, the culture medium is Luria-Bertani (LB) medium or a modified de ManRogosa Sharpe (mMRS) medium.

[0022] Beneficial effects: (1) This invention screens promoters P with gradient strengths from large to small that have application potential. C6 P C9 P C1 P C11 A constitutive promoter library was constructed, the nucleotide sequences of which are shown in SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.1, and SEQ ID NO.11, respectively. Among them, P... C9 It has bidirectional transcriptional properties, and can simultaneously transcribe two fluorescent proteins, mCherry and sfGFP, for expression.

[0023] (2) The present invention also performs semi-rational modification on the constitutive promoters obtained by screening, using promoter P 23Using the -10, -35, and spacer regions as templates, predict and modify P C6 P C9 P Idh P gap Within the core region, constitutive promoters with high expression intensity P were screened. B5 And the constitutive promoter P with application potential B6 P B2 P B7 P B12 The nucleotide sequences are shown in SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.18, SEQ ID NO.23, and SEQ ID NO.28, respectively.

[0024] (3) The present invention also demonstrates that the screened promoter can express the 158 kDa exogenous protein Cas9 in addition to transcribing fluorescent proteins, thus demonstrating the application potential of the constitutive promoter provided by the present invention in the emerging field of CRISPR.

[0025] (4) The present invention also provides a linoleic acid-inducible promoter P C2-LA P C3-LA P C4-LA Its nucleotide sequences are shown in SEQ ID NO.30, SEQ ID NO.31, and SEQ ID NO.32. The effect is that after induction with 0.2 g / L linoleic acid, the fluorescence intensity can be increased by 1.7, 3.5, and 2.2 times, respectively, demonstrating significant linoleic acid responsiveness.

[0026] This invention provides a solid theoretical basis for the screening of promoters for Bifidobacterium breve and other Bifidobacteria, and also provides an efficient promoter library for gene manipulation of Bifidobacterium breve. Attached Figure Description

[0027] Figure 1 The diagram shows a promoter library, in which: (a) a constitutive promoter library derived from Bifidobacterium breve, (b) an inducible promoter library, and (c) a semi-rational modified promoter library.

[0028] Figure 2 This is a promoter activity detection system.

[0029] Figure 3 Agarose gel electrophoresis results of plasmids introduced into the host Bifidobacterium breve CCFM683; where M represents marker, NC represents negative control without template, P and C at the beginning of the number indicate positive transformants of strains containing promoter plasmids, and mC represents control with empty plasmid without promoter.

[0030] Figure 4The effect of promoter regulation on mCherry expression; where (a) is the mCherry fluorescence intensity of the host corresponding to the constitutive promoter, and (b) is the mCherry fluorescence intensity of the host corresponding to the inducible promoter.

[0031] Figure 5 Flow cytometry analysis of the bidirectional transcriptional characteristics of constitutive promoters. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are not intended to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0033] The following examples involve Bifidobacterium breve (Bifidobacterium breve). Bifidobacterium breve CCFM683, CCFM1310, CCFM1400, Bifidobacterium longum subsp. infantis ( Bifidobacterium longum subsp. Infantis CCFM1427, Bifidobacterium longum subsp. ( Bifidobacterium longum subsp. Longum CCFM1375, Bifidobacterium adolescentis ( Bifidobacterium adolescentis CCFM1322, Bifidobacterium animalis ( Bifidobacterium animalum CCFM1148 has been deposited at the Guangdong Provincial Center for Microbial Culture Collection. Among its members, *Bifidobacterium breve* CCFM683 has the accession number CGMCC No. 11828; *Bifidobacterium breve* CCFM1310 has the accession number GDMCC No. 63536; *Bifidobacterium breve* CCFM1400 has the accession number GDMCC No. 64894; *Bifidobacterium longum* subsp. *infant* CCFM1427 has the accession number GDMCC No. 65153; *Bifidobacterium longum* subsp. *long* CCFM1375 has the accession number GDMCC No. 64269; and *Bifidobacterium adolescentis* CCFM1322 has the accession number GDMCC No. 63718; Bifidobacterium animalis CCFM1148, accession number GDMCCNo.61162; Bifidobacterium breve FJSWX38M7 is deposited in the strain bank of the Biotechnology Center of Jiangnan University and disclosed in patent application publication number CN113005049A; the Bifidobacterium breve involved in the following examples ( Bifidobacterium breve UCC2003, Escherichia coli ( Escherichia coliEco101 and plasmid backbone pNZ123 were provided by University College Cork, Ireland. Among them, Bifidobacterium breve UCC2003 is disclosed in patent application publication number US2020317738A1; Escherichia coli Eco101 and plasmid backbone pNZ123 are disclosed in the paper with DOI number 10.3389 / fmicb.2021.636822.

[0034] The bacterial genome extraction kit and plasmid miniprep kit used in the following examples were purchased from Tiangen Biotech Co., Ltd.; the restriction endonucleases (HindIII, EcoRI, ScaI) and GeneJET gel extraction kit used in the following examples were purchased from Thermo Fisher Scientific, USA; the high-fidelity enzymes and rapid cloning kits used in the following examples were purchased from Nanjing Novizan Biotechnology Co., Ltd.; the lysozyme, agarose, and chloramphenicol used in the following examples were purchased from Sangon Biotech Co., Ltd.; the linoleic acid used in the following examples was purchased from Shanghai Aladdin Biotech Co., Ltd.; and other routine biochemical reagents and consumables were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0035] The vector construction and bacterial competent cell production involved in the following examples are all based on the "Molecular Cloning Handbook".

[0036] The primers and sequencing involved in the following examples were performed by Suzhou Genewiz Biotechnology Co., Ltd.

[0037] Bifidobacterium breve ( Bifidobacterium breve CCFM683, FJSWX38M7, CCFM1310, CCFM1400, Bifidobacterium longum subsp. infantis ( Bifidobacterium longum subsp. Infantis CCFM1427, Bifidobacterium longum subsp. ( Bifidobacterium longum subsp. Longum CCFM1375, Bifidobacterium adolescentis ( Bifidobacterium adolescentis CCFM1322, Bifidobacterium animalis ( Bifidobacterium animalum CCFM1148 is a commercial strain and can be purchased from the Wuxi Institute of Special Foods and Nutrition.

[0038] The culture media involved in the following examples are as follows: LB liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, with chloramphenicol added to a final concentration of 10 µg / mL before use.

[0039] LB solid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar; add chloramphenicol to a final concentration of 10 µg / mL before use. Modified MRS liquid medium: 10 g / L tryptone, 10 g / L beef extract, 5 g / L yeast extract, 20 g / L anhydrous glucose, 2.6 g / L dipotassium hydrogen phosphate trihydrate, 2 g / L diammonium hydrogen citrate, 2 g / L anhydrous sodium acetate, 0.1 g / L magnesium sulfate heptahydrate, 0.05 g / L manganese sulfate monohydrate, 1 g / L Tween 80, 0.5 g / L L-cysteine; add chloramphenicol to a final concentration of 10 µg / mL or 0.2 g / L linoleic acid before use.

[0040] Modified MRS solid medium: tryptone 10 g / L, beef extract 10 g / L, yeast extract 5 g / L, anhydrous glucose 20 g / L, dipotassium hydrogen phosphate trihydrate 2.6 g / L, diammonium hydrogen citrate 2 g / L, anhydrous sodium acetate 2 g / L, magnesium sulfate heptahydrate 0.1 g / L, manganese sulfate monohydrate 0.05 g / L, Tween 80 1 g / L, L-cysteine ​​0.5 g / L, 20 g / L agar. Before use, add chloramphenicol to a final concentration of 10 µg / mL or linoleic acid of 0.2 g / L.

[0041] The solvent preparation methods involved in the following examples are as follows: Free linoleic acid (LA) stock solution (20 mg / mL, 20 mL): 400 mg LA, 100 mg Tween 80, diluted to 20 mL with sterile water. Vortex at room temperature for 20 min until fully emulsified. Filter through a sterile 0.22 μm aqueous filter membrane for sterilization, then aliquot into 1 mL containers and store at -20°C protected from light. To avoid demulsification after freeze-thaw cycles, vortex for 5 min before use. Example 1: Construction of constitutive promoter and linoleic acid-inducible promoter libraries derived from Bifidobacterium breve. Transcriptome and whole genome sequencing were performed on Bifidobacterium breve CCFM683, which is highly converted to conjugated linoleic acid. The transcriptome was divided into linoleic acid-induced group (LA group) and non-linoleic acid-induced group (NC group) for detection. The bacteria were collected and sent for testing at 3 h, 8 h and 15 h, and a total of 6 groups of transcriptome data were detected (LA_3h, NC_3h, LA_8h, NC_8h, LA_15h, NC_15h), with 3 biological replicates for each group.

[0042] Gene expression levels were measured using fragments per kilobase of transcript per million fragments mapped (FPKM). The top 50 highly expressed genes were identified from six sets of transcriptome data from *Bifidobacterium breve* CCFM683. Then, stably highly expressed genes present in all six sets of data were screened. Finally, based on whole-genome data, the non-coding region between the stably highly expressed gene and its upstream gene was used as the promoter sequence to screen 13 candidate promoters, named P. C1 P C2 P C3 P C4 P C5 P C6 P C7 P C8 P C9 P C10 P C11 P C12 P C13 A candidate constitutive promoter library was constructed, with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13. In addition, other constitutive promoters P from lactic acid bacteria with high strength were supplemented from the literature. Idh (Derived from Lactobacillus paracasei, nucleotide sequence as shown in SEQ ID NO.14) and P 23 (Derived from Lactococcus lactis, nucleotide sequence as shown in SEQ ID NO.15) and added to the candidate constitutive promoter library, and with P gap (Derived from Bifidobacterium breve UCC2003, nucleotide sequence as shown in SEQ ID NO.16) as a reference promoter.

[0043] Based on the transcriptome data of *Bifidobacterium breve* CCFM683, the relative expression levels of genes in the LA group compared to those in the NC group at the same time point were calculated. Genes with a log2 (Fold Change) value greater than 1.5 in the LA group compared to the NC group at each time point (LA_3h vs NC_3h, LA_8h vs NC_8h, LA_15h vs NC_15h) responded to LA. Then, using the non-coding region between the candidate gene and its upstream gene as the promoter sequence, eight candidate promoters were selected and named P. C1-LA P C2-LA P C3-LA P C4-LA P C5-LA P C6-LA P C7-LA P C8-LA A library of LA-inducible promoters was constructed, the nucleotide sequences of which are shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, and SEQ ID NO.36.

[0044] Depend on Figure 1 It can be seen that constitutive promoter and linoleic acid inducible promoter libraries were constructed from transcriptome and whole genome data of Bifidobacterium breve CCFM683.

[0045] Example 2: Cloning of promoter activity detection vector The genome of Bifidobacterium breve CCFM683 was extracted using a bacterial genome extraction kit. Using this genome as a template, the upstream non-coding region of the candidate gene was amplified by PCR using a high-fidelity enzyme. The primers used are shown in Table 1.

[0046] The PCR instrument used was a BIO-RAD T100 Thermal Cycler, and KOD plus high-fidelity DNA polymerase was used. The reaction system was 50 μL, and the contents of the system were prepared according to the instructions of the DNA polymerase. The PCR reaction process was as follows: 95℃ pre-denaturation for 3 min, then 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, and the above three steps were repeated 30 times. Then, the system was fully extended at 72℃ for 5 min, and finally, the temperature was lowered to 12℃ and held for 5 min before stopping.

[0047] After the reaction was completed, the amplification product was obtained. The PCR product was separated by 1% agarose gel and then purified using the Thermo Fisher GeneJET gel extraction kit to obtain the promoter fragment to be inserted.

[0048] Table 1 Primer sequences used and their uses

[0049] Example 3: Expression of promoter detection vector in Bifidobacterium breve (1) Construction of promoter detection vector The fluorescent protein genes mCherry and sfGFP were obtained from the NCBI database and their codons were optimized to obtain the nucleotide sequences shown in SEQ ID NO.37 and SEQ ID NO.38, which were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. mCherry and sfGFP were amplified using primers pNZ123-mCherry-F / R and pNZ123-sfGFP-F / R, respectively, and then isolated and purified. A promoter activity detection vector was constructed using plasmid pNZ123 as the backbone. First, the vector pNZ123 was linearized using the restriction endonuclease EcoRI-ScaI and purified by gel electrophoresis. Then, mCherry was seamlessly ligated into the purified linearized vector pNZ123 to obtain the recombinant plasmid pNZ123-mCherry. Similarly, the recombinant plasmid pNZ123-sfGFP was obtained. Next, the promoter sequence was ligated into the HindIII-EcoRI-linearized pNZ123-mCherry to obtain a series of promoter activity detection vectors pNZ123-P-mCherry, where P represents the promoter number and structure. Figure 2 As shown.

[0050] Add 10 μL of the ligation product to a centrifuge tube containing 100 μL of competent E. coli cells, gently tap to mix, and incubate on ice for 30 min. Then, heat shock the competent cells at 42°C for 45 s, and immediately cool them on ice for 2-3 min. Next, add 1000 mL of LB medium preheated to 37°C, and culture at 37°C and 200 rpm for 1 h with shaking. Spread an appropriate amount of bacterial culture onto an LB plate containing 10 μg / mL chloramphenicol and incubate at 37°C for 12-16 h. Perform colony PCR using primers pNZ123-F / R and sequence the cells to screen for correctly ligated recombinant plasmids.

[0051] (2) Transformation screening of Bifidobacterium breve Add 200 ng of recombinant plasmid to a centrifuge tube containing 100 μL of Bifidobacterium competent cells, gently tap to mix, and then transfer to a 2 mm electroporation cuvette. Electroporate the competent cells at 2500 V, 25 μF, and 200 Ω. Then add 1000 mL of antibiotic-free mMRS liquid medium to the electroporation cuvette and incubate anaerobically at 37°C for 3 h. Spread an appropriate amount of bacterial culture onto selective mMRS plates and incubate anaerobically at 37°C for 48-72 h until white colonies appear. Perform colony PCR using primers pNZ123-F / R and sequence the colonies to screen for positive clones containing the correct insertion fragment (PCR results are shown in the figure). Figure 3 (As shown in the image). Positive clones with verified sequences were expanded in liquid culture medium, then supplemented with 30% (v / v) glycerol and stored at -80°C. PCR was performed using the Taq enzyme system, and the primers used were universal primers for the plasmid vector. The specific sequences are as follows: Upstream primer pNZ123-F (5'→3'): CGACATCATTGAACATGCTG; Downstream primer pNZ123-R (5'→3'): TGAGATAATGCCGACTGTAC.

[0052] Depend on Figure 3 It can be seen that PCR verification using universal primers successfully amplified the region carrying the promoter sequence, and the band size met the theoretical value (because the primers were designed on the vector and contained a reporter gene, the obtained fragment was 889 bp larger than the actual promoter fragment), indicating that the target gene was successfully transferred into Bifidobacterium breve CCFM683.

[0053] Glycerol tubes containing wild-type Bifidobacterium breve CCFM683, Bifidobacterium breve CCFM683 pNZ123-mCherry, and Bifidobacterium breve CCFM683 pNZ123-sfGFP containing recombinant plasmids were removed from the -80℃ freezer and thawed on ice. Then, they were streaked onto mMRS or mMRS solid medium containing chloramphenicol at a final concentration of 10 μg / mL in a sterile operating table and anaerobically cultured at 37℃ for 48 h. Subsequently, single colonies were picked and cultured into 5 mL of mMRS or mMRS liquid medium containing chloramphenicol at a final concentration of 10 μg / mL, and anaerobically cultured at 37℃ for 12–20 h. Finally, the same mMRS liquid medium was inoculated again at a 1% (v / v) inoculum and cultured for 12–20 h as the seed culture for the next experiment.

[0054] Example 4: Fluorescent Protein Expression and Detection Recombinant Bifidobacterium breve CCFM683 pNZ123-mCherry and Bifidobacterium breve CCFM683 pNZ123-sfGFP seed cultures containing different promoters constructed in Example 3 were transferred to 5 mL of mMRS liquid medium at an inoculation rate of 1% (v / v) and cultured anaerobically at 37°C until the corresponding time points for harvesting. Empty vector plasmids without promoters were used as controls. Note that an additional 10 μg / mL of chloramphenicol needs to be added to the medium for the inducible promoter P. C1-LA P C2-LA P C3-LA P C4-LA P C5-LA P C6-LA P C7-LA P C8-LA Add the appropriate volume of LA stock solution to a final concentration of 0.2 g / L. Transfer 1 mL of culture medium to a 1.5 mL centrifuge tube, centrifuge at 5000 rpm for 1 min to collect the bacterial cells, wash the cells with 1 mL of sterile PBS solution, centrifuge at 5000 rpm for 1 min, and discard the supernatant. Repeat the washing once, centrifuge, discard the supernatant, and resuspend the cells in 1 mL of sterile PBS. Incubate the bacterial solution at room temperature for 90 min in the presence of oxygen. Adjust the OD of the bacterial solution using the same PBS. 600 The concentration was increased to 0.4, and then 200 μL of bacterial culture was transferred to a 96-well black-walled transparent ELISA plate. The OD was then measured using an ELISA reader. 600 Fluorescence intensity was measured. An empty plasmid without a promoter was used as a control. Fluorescence intensity was normalized after subtracting the background blank. The excitation light used for mCherry assays was 545 nm, and the emission light was 610 nm.

[0055] Depend on Figure 4 -a indicates that the constitutive promoter P derived from Bifidobacterium breve is used. C6 and P C9 The recombinant strain *Bifidobacterium breve* CCFM683, which regulates expression, showed the highest fluorescence intensity compared to the reference promoter P. gap They increased by 1.65 and 1.40 times respectively. p <0.05), compared to promoter P Idh Increased by 2.52 and 2.14 times ( p < 0.05), compared to promoter P 23 Increased by 5.31 and 4.51 times ( p < 0.001); in addition, the endogenous constitutive promoters C1 and C11 and the exogenous constitutive promoter P Idh The fluorescence intensity was significantly lower than that of the reference promoter P. gap However, overall it is higher than that of the exogenous constitutive promoter P. 23 Compared to promoter P23 Increased by 1.34 and 1.21 times ( p < 0.05).

[0056] Depend on Figure 4 -b indicates that, in addition to promoter P, the endogenous linoleic acid-inducible promoter of Bifidobacterium breve is present in the Bifidobacterium breve endogenous linoleic acid-inducible promoter. C1-LA and P C8-LA The fluorescence intensity showed no significant difference under the two culture medium conditions. p > 0.05), and all other promoters showed highly significant differences ( p < 0.001), where P C2-LA P C3-LA P C4-LA The response to linoleic acid was stronger, increasing by 1.7, 3.5, and 2.2 times after induction with linoleic acid. p < 0.001).

[0057] The above results provide a solid theoretical basis for the screening of promoters for Bifidobacterium breve and other Bifidobacteria, and also provide an efficient promoter tool for gene manipulation of Bifidobacterium breve.

[0058] Example 5: Exploring the Application Scope of Constitutive Promoters The constitutive promoter P screened from Bifidobacterium breve CCFM683 C1 P C6 P C9 P C11 And the literature reports the promoter P Idh P 23 P gap Introduced into other Bifidobacterium hosts, including: Bifidobacterium breve ( Bifidobacterium breve FJSWX38M7, CCFM1310, CCFM1400, UCC2003, Bifidobacterium longum subsp. infantis ( Bifidobacterium longum subsp. Infantis CCFM1427, Bifidobacterium longum subsp. ( Bifidobacterium longum subsp. Long CCFM1375, Bifidobacterium adolescentis ( Bifidobacterium adolescentis CCFM1322, Bifidobacterium animalis ( Bifidobacterium animalum (CCFM1148) Using an imported empty vector without a promoter as a negative reference, the same experimental procedures as in Examples 3-4 were followed to detect the corresponding fluorescence intensity of the promoter activity detection system in different hosts.

[0059] Table 2 shows that *Bifidobacterium breve* CCFM1310, FJSWX38M7, UCC2003, and *Bifidobacterium longum* subsp. *infant* CCFM1427 all exhibited higher levels of the reference promoter P than the control promoter. gapPromoters with high fluorescence intensity include the P promoter derived from Bifidobacterium breve CCFM683. C1 P C6 P C9 P C11 Promoters P from other species Idh P 23 In summary, referring to promoter P gap It has poor universality in Bifidobacteria, while the promoter P C1 P C6 P C9 P C11 With P Idh P 23 The universality among different Bifidobacteria is complementary.

[0060] Table 2 Fluorescence Intensities in Different Hosts

[0061] The above results provide a solid theoretical basis for the universality of promoters in Bifidobacterium breve and other Bifidobacteria, and also provide direction for the semi-rational modification of constitutive promoters.

[0062] Example 6: Semi-rational Modification of General Constitutive Promoters Strong promoter sequences screened from *Bifidobacterium breve* were uploaded to the Softberry-BPROM server (http: / / www.softberry.com) for promoter -10 and -35 region prediction, with the region between -10 and -35 designated as the spacer region. Conservation analysis of the -35 to -10 regions of the strong promoter sequences was performed using the WebLogo server (http: / / weblogo.berkeley.edu / logo.cgi).

[0063] By semi-rational design, the core elements of strong promoters—the -10 region, -35 region, and spacer spacer—are adjusted to screen for widely applicable constitutive strong promoters. Specifically, based on the application of strong promoters in exogenous Bifidobacterium hosts, promoters with broad application potential are selected as templates for rational design. Other promoters that are strong in transcription in the original host but cannot be widely applied are then replaced sequentially with their -10 region, -35 region, and spacer spacer region to achieve the widespread application of strong promoters.

[0064] Depend on Figure 1 As indicated by the -c option, 12 promoters were ultimately created and named P. B1 P B2 PB3 P B4 P B5 P B6 P B7 P B8 P B9 P B10 P B11 P B12 The nucleotide sequences are shown in SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, and SEQ ID NO.28. Following the methods described in Examples 2-4, the promoter was ligated to the recombinant plasmid pNZ123-mCherry to construct a promoter activity detection system. Promoter activity was then detected in *Bifidobacterium breve* CCFM683. As shown in Table 3, promoter P... B5 The corresponding mCherry fluorescence intensity is the strongest, P B2 P B6 P B7 The corresponding fluorescence intensity was also significantly higher than that of the reference promoter P. gap These figures represent increases of 2.26, 1.29, 1.51, and 1.21 times, respectively.

[0065] Table 3. Promoter fluorescence intensity in Bifidobacterium breve CCFM683

[0066] Example 7: Verification of the bidirectional transcriptional properties of constitutive promoters For constitutive promoter P C1 P C6 P C9 P C11 P Idh P 23 P gap The bidirectional transcriptional activity of the promoter was investigated using fluorescent sfGFP and mCherry as reporter genes to detect upstream and downstream transcriptional activity. The construction, culture, and detection methods were the same as in Examples 2-4. The promoter was ligated into the recombinant plasmid pNZ123-sfGFP-mCherry to construct a bidirectional promoter activity detection system, and then the bidirectional transcriptional activity of the promoter was detected in *Bifidobacterium breve* CCFM683. Figure 5 It can be seen that the promoter P c9 It can transcribe mCherry in the forward direction and sfGFP in the reverse direction, compared to the reference promoter P. gap PC9 The fluorescence generated by bidirectional activity accounts for 56%, indicating strong bidirectional transcriptional properties.

[0067] The above results provide a promoter with bidirectional transcriptional activity for Bifidobacterium breve, expanding the application scope of promoters.

[0068] Example 8: Expression of exogenous protein spCas9 To verify whether the promoter can transcribe other proteins and to expand the application of the CRISPR system in Bifidobacterium breve, the constitutive promoter P was used. C6 Downstream, the spCas9 protein gene is linked, and mCherry is ligated to the spCas9 protein via a flexible linker. Expression is verified by fluorescence detection. The nucleotide sequence of spCas9-Linker-mCherry is shown in SEQ ID NO. 40. Following the methods described in Examples 2-4, the promoter P... C6 or P gap The cells were ligated into the recombinant plasmid pNZ123-spCas9-Linker-mCherry, and the fluorescence intensity in recombinant Bifidobacterium breve CCFM683 was then detected. Table 4 shows that, compared to the control group, P... C6 and P gap Both groups showed weak fluorescence, with fluorescence folds of 3.17 and 1.53, respectively, indicating that the spCas9 protein can be screened by the promoter P in this protocol. C6 Transcription and expression.

[0069] The above results demonstrate that the selected promoter can transcribe other exogenous genes in Bifidobacterium breve. spCas9 This expands the application scope of promoters.

[0070] Table 4. Fluorescence detection in the exogenous protein spCas9 expression system

[0071] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A promoter, characterized in that, For (a) or (b): (a) Bidirectional promoter P C9 The nucleotide sequence is shown in SEQ ID NO.9; (b) Promoter P, which can increase gene expression intensity C6 The nucleotide sequence is shown in SEQ ID NO.

6.

2. Launch the sub-library, characterized in that, Contains promoters of decreasing strength: P C6 P C9 P C1 P C11 Their nucleotide sequences are shown in SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.1, and SEQ ID NO.11, respectively. And the promoters that respond to linoleic acid expression intensity from high to low: P C2-LA P C4-LA P C3-LA Their nucleotide sequences are shown in SEQ ID NO.30, SEQ ID NO.32, and SEQ ID NO.31, respectively.

3. Launch the sub-library, characterized in that, Contains promoter P with strength from high to low B5 P B6 P B2 P B7 P B12 Their nucleotide sequences are shown in SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.18, SEQ ID NO.23, and SEQ ID NO.28, respectively.

4. A recombinant plasmid carrying the promoter of claim 1 or the promoter library of any one of claims 2 to 3.

5. The recombinant plasmid according to claim 4, characterized in that, The promoter is only used to connect the target gene downstream.

6. The recombinant plasmid according to claim 4, characterized in that, promoter P C9 The upstream and downstream of the target gene are connected simultaneously.

7. A genetically engineered Bifidobacterium bacterium, characterized in that, Using pNZ123 as a vector, the expression of the target protein is regulated by a promoter with a nucleotide sequence as shown in any of SEQ ID NO.1~36.

8. The Bifidobacterium genetically engineered bacterium according to claim 7, characterized in that, The Bifidobacteria include, but are not limited to, Bifidobacterium breve, Bifidobacterium longum, Bifidobacterium bifidum, or Bifidobacterium animalis.

9. The use of the promoter according to claim 1, or the promoter in any of the promoter libraries according to claims 2 to 3, in regulating gene expression.

10. The application according to claim 9, characterized in that, The application involves using constitutive promoters to regulate the continuous and stable expression of genes, or using inducible promoters to respond to the increased expression of linoleic acid-regulated genes at specific time points.

Images