SgRNA and target DNA for detecting SpCas9 D10A Nickase activity and detection method

The detection of SpCas9 D10A Nickase activity by ion-exchange high-performance liquid chromatography solves the problems of high dependence on experimental animals and cells and long cycle of traditional detection methods, and achieves efficient and accurate activity detection, which is suitable for quality control of gene editing products.

CN122012506APending Publication Date: 2026-05-12KACTUS BIOSYSTEMS SHANGHAI LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KACTUS BIOSYSTEMS SHANGHAI LTD
Filing Date
2026-03-23
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In existing technologies, biological activity detection methods based on animals and cells have high requirements for experimental environment and conditions, long detection cycles, and the gel electrophoresis method is difficult to quantify accurately, resulting in large errors in the judgment of biological activity results and affecting product quality assessment.

Method used

A reaction system was established by simulating the activity of base editing enzyme nickase, and the SpCas9 D10A Nickase activity was detected by ion exchange high performance liquid chromatography (IEX-HPLC). The activity was calculated by detecting the open-ring plasmid content, which reduced the need for experimental animals and cells and shortened the detection cycle.

Benefits of technology

It achieves efficient and accurate detection of SpCas9 D10A Nickase activity, reduces experimental complexity, and improves the convenience and accuracy of detection. It conforms to the 3R principle of modern scientific research and is suitable for quality testing of gene editing products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012506A_ABST
    Figure CN122012506A_ABST
Patent Text Reader

Abstract

The invention provides sgRNA (small guide ribonucleic acid) and target DNA (deoxyribonucleic acid) for detecting the activity of SpCas9 D10A Nickase and a detection method. A reaction system capable of expressing the function and a quantitative detection method (IEX-HPLC method) are established by simulating the enzyme activity function of a base editing enzyme incision, so that the requirements on experimental animals and cells are remarkably reduced, the detection period is shortened, and the 3R (reduction, optimization and substitution) principle of modern scientific research is met; meanwhile, the invention also provides an efficient and practical analysis method for the quality characteristic analysis work of the base editing enzyme, the convenience of quality detection in gene editing product production and research is improved, and the method has a large-scale commercial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioanalysis, and more specifically, to a method for detecting sgRNA and target DNA for SpCas9 D10A Nickase activity. Background Technology

[0002] The evaluation of biological properties is an equally important step as the comprehensive structural verification of a product. It reflects the product’s ability to exert its intended biological effects and is a key quality attribute.

[0003] Methods for bioactivity assays include: animal-based bioactivity assays, which measure the biological response of an organism to a product; cell culture-based bioactivity assays, which measure the biochemical and physiological effects of a product at the cellular level; and biochemical methods, which measure bioactivity using enzyme reaction rates or immune interaction-induced biological responses. Among these, animal and cell culture-based bioactivity assays cannot escape the need for animals and cells, and they also have high requirements for experimental environment and conditions, and long testing cycles.

[0004] Currently, the main in vitro activity testing method for similar products on the market is the gel electrophoresis method. However, because the gel electrophoresis method is difficult to quantify accurately and cannot provide continuous quantitative data, it can lead to significant errors in the judgment of bioactivity results, which can affect the quality assessment of the product. Summary of the Invention

[0005] This invention aims to overcome the aforementioned shortcomings by simulating the nicking enzyme activity of base editing enzymes and establishing a reaction system and quantitative detection method (IEX-HPLC) that can express this function. This significantly reduces the need for experimental animals and cells, shortens the detection cycle, and conforms to the 3R (reduce, optimize, replace) principle of modern scientific research. At the same time, this invention also provides an efficient and practical analytical method for the quality characteristic analysis of base editing enzymes, improves the convenience of quality detection in gene editing product production and research, and has the prospect of large-scale commercial application.

[0006] The present invention provides an sgRNA comprising the sequence shown in SEQ ID No. 1.

[0007] SEQ ID No. 1: mCmUmAACAGUUGCUUUUAUCAC.

[0008] The present invention also provides an sgRNA, which has the sequence shown in SEQ ID No. 2.

[0009] SEQ ID No. 2: mCmUmAACAGUUGCUUUUAUCACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmUmUmUU.

[0010] Furthermore, the present invention also suggests the application of the sgRNA shown in SEQ ID No. 1 or SEQ ID No. 2 in the assay of SpCas9 D10A Nickase activity.

[0011] In addition, the present invention provides a target DNA comprising the sequence shown in SEQ ID No. 3.

[0012] SEQ ID No. 3: CTAACAGTTGCTTTTATCAC.

[0013] In addition, the present invention provides a target DNA, which is a sequence as shown in SEQ ID No. 4.

[0014] SEQ ID No.4: TGATGGACCTTGGGTGCTATTCCTGTGATAAGGAAGGCAGCTAGACAGGACTTGGGAGTTATCTGTAGTGAGATGGCTGAAAAGCGATACAGGGCTGGCTCTATGCCCCAGGTGTGCATAAGT AAGAGCAGATAGCTGATTCCAGTGCAAAGTCCATACAGGTAATAACATAGGCCAGAAAAGAGATATGGCATCTACTCTTAGACATAACACACCAGGGTCAATACAACTTTGAAGCTAGTCTAGTGCAAG CTAACAGTTGCTTTTATCAC AGGCTCCAGGAAGGGTTTGGCCTCTGATTAGGGTGGGGGCGTGGGTGGGGTAGAAGAGGACTGGCAGACCTCTCCATCGGTGGCCGTTTGCCCAGGGGGGCCTCTTTCGGAAGGCTCTCTTGGTGATGGAGAATTGGATTTTATTTCTCAATGGGAATGAAATAATTTGTATGCCATGCCGTGTGGAC.

[0015] Furthermore, the present invention also provides the application of the target DNA shown in SEQ ID No. 1 or SEQ ID No. 2 above in the SpCas9 D10A Nickase activity assay.

[0016] In addition, the present invention provides a product for detecting SpCas9 D10A Nickase activity, comprising target DNA as shown in SEQ ID No. 3 or SEQ ID No. 4, and sgRNA capable of recognizing the sequence shown in SEQ ID No. 5.

[0017] SEQ ID No. 5: CTAACAGTTGCTTTTATCAC.

[0018] In addition, the present invention provides a product for detecting SpCas9 D10A Nickase activity, comprising sgRNA as shown in SEQ ID No. 1 or SEQ ID No. 2, and target DNA as shown in SEQ ID No. 3 or SEQ ID No. 4.

[0019] In addition, the present invention also provides a method for detecting SpCas9 D10A Nickase activity. Specifically, after the target DNA is specifically cleaved by the complex of SpCas9 D10A Nickase protein and sgRNA, the content of open circular plasmid is detected, and the difference between the content of open circular plasmid with added SpCas9 D10A Nickase protein and the content of open circular plasmid without added SpCas9 D10A Nickase protein is calculated as the activity detection result.

[0020] Wherein, the sgRNA is the sgRNA shown in SEQ ID No. 1 or SEQ ID No. 2;

[0021] The target DNA is as shown in SEQ ID No. 3 or SEQ ID No. 4.

[0022] Furthermore, the method for detecting SpCas9 D10A Nickase activity described above is characterized by the use of ion exchange chromatography to determine the content of the open-ring plasmid.

[0023] The function and effects of this invention:

[0024] This invention utilizes the cleavage enzyme activity of SpCas9 D10A Nickase protein. When it forms a complex with specific sgRNA, a plasmid with a supercoiled structure (i.e., target DNA) is selected, allowing the complex to specifically cleave one strand of the target DNA. Once this complex cleaves one strand, the supercoiled structure of the plasmid is converted into an open-circular structure. The open-circular and supercoiled structures of the target DNA can be detected by ion-exchange chromatography. Ion-exchange chromatography uses a gradient elution of the sample with mobile phases of different salt concentrations. After the different plasmid components are separated, they enter the detector and are examined at a specific wavelength (e.g., 260 nm). The percentage of open-circular plasmid peak area in the sample is obtained by peak area normalization. Using the percentage of open-circular plasmid peak area in the sample without SpCas9 D10A Nickase protein as the initial value, the percentage of open-circular plasmid peak area in the enzyme-digested sample is the detection value. Therefore, the difference between the detection value and the initial value is the detection activity of the SpCas9 D10A Nickase protein sample. Attached Figure Description

[0025] Figure 1 Spectra of repeated injections of the same sample;

[0026] Figure 2 Results of gel electrophoresis;

[0027] Figure 3 Chromatographic detection results. Detailed Implementation

[0028] This invention is capable of various modifications and embodiments, and therefore specific embodiments are illustrated and described in the accompanying drawings. However, this is not intended to limit the invention to specific implementations, but should be understood to include all modifications, equivalents, and even substitutions that fall within the spirit and scope of this invention.

[0029] Example 1. This example aims to develop a methodology for testing the activity of SpCas9 D10A Nickase (IEX-HPLC method) so that the activity of SpCas9 D10A Nickase can be tested and analyzed by in vitro detection.

[0030] 1.1. The specific definitions of the abbreviations appearing in this embodiment are as follows:

[0031]

[0032] 1.2. Materials and equipment information for this test example:

[0033] 1.2.1. Sample Information

[0034]

[0035] *The target DNA selected for this activity detection method is a plasmid containing an sgRNA recognition site. The plasmid construction process is as follows: First, a target fragment containing an sgRNA recognition site (460 bp in size, sequence below) is prepared, and its blunt ends are ligated into the SmaI site of the pUC57-Kan vector; after transformation into DH5α competent cells, the cells are plated on Kanamycin LB plates, single colonies are picked, and colony PCR is performed using primers KL01-SeqF / KL01-SeqR. Positive clones are screened and sequenced for verification, and finally, the KH35 in pUC57-Kan plasmid with a completely correct sequence is obtained.

[0036] 1.2.2. Materials and Reagents

[0037]

[0038] 1.2.3. Instruments and Equipment

[0039]

[0040] 1.2.4. Main Equipment

[0041]

[0042] 1.3. Design Principles of this Experiment

[0043] Recombinant SpCas9 D10A Nickase is cloned from Streptococcus pyogenes and is a mutant of the Cas9 protein. This protein mutates one domain of the Cas9 nuclease while retaining the function of the other cleavage domain, specifically cutting the target single strand to create a nick. Typically, it cuts at different locations on both DNA strands separately, forming double nicking, thus reducing off-target effects. This experiment utilizes the nicking enzyme activity of SpCas9 D10A Nickase to develop an in vitro activity detection method for SpCas9 D10A Nickase.

[0044] 1.4. Test Method Design and Optimization

[0045] 1.4.1. Design of Activity Detection Method

[0046] Based on the cleavage enzyme activity principle of SpCas9 D10A Nickase protein, KH35 plasmid with a concentration of 100 µg / ml was prepared as target DNA. The reagents required for each reaction system were taken and in vitro enzyme digestion reactions were carried out according to Table 1. After enzyme digestion, the samples were taken and separated by gradient elution using a TSKgel DNA-NPR ion exchange column according to the difference in charge density of each component of KH35 plasmid. The initial method gradient is detailed in Table 2.

[0047] Table 1. SpCas9 D10A Nickase digestion reaction process (before optimization)

[0048]

[0049] Table 2. Parameters of the activity testing method (before optimization)

[0050]

[0051] Note: The average percentage of the open-ring plasmid peak area of ​​all quality control samples is taken as the initial value (before cutting), and the percentage of the open-ring plasmid peak area of ​​the test sample is taken as the detection value (after cutting). The difference between the detection value and the initial value is the detection activity of the SpCas9 D10ANickase protein sample.

[0052] 1.4.2. Optimization of Activity Detection Method

[0053] 1.4.2.1. Determination of SpCas9 D10A Nickase Protein Concentration

[0054] A. Experimental Design

[0055] Take SpCas9 D10A Nickase samples and use the sample storage solution as a diluent to prepare SpCas9 D10A Nickase detection sample solutions of different concentrations according to Table 3. After the samples are mixed, perform enzymatic digestion and testing according to the conditions in Table 1 and Table 2.

[0056] Table 3 Sample preparation for different SpCas9 D10A Nickase protein detection concentrations

[0057]

[0058] B. Test Results

[0059] Table 4. Results of detection of different SpCas9 D10A Nickase protein concentrations

[0060]

[0061] In this experimental example, the results of multiple detections of SpCas9 D10A Nickase protein at different concentrations are shown in Table 4 above. The results show that higher SpCas9 D10A Nickase protein concentrations result in higher detection activity. Detection activity fluctuates at different times for the same SpCas9 D10A Nickase protein. Under the pre-optimization detection system, the detection activity is consistent when the detection concentration is between 0.030 mg / ml and 0.050 mg / ml; therefore, 0.030 mg / ml is the limiting concentration for this reaction system. Therefore, considering the fluctuations in detection activity and ensuring accurate detection of SpCas9 D10A Nickase samples, 0.020 mg / ml is chosen as the detection concentration for this method.

[0062] 1.4.2.2. Optimization of injection sequence and testing methods

[0063] A. Analysis of the reasons for method optimization

[0064] When using the activity assay method in Table 2, the same sample (KH35-sgRNA, i.e., target DNA before protein cleavage, with SpCas9 D10A Nickase stock solution added to the system in Table 1) was repeatedly tested, and its detection chromatogram ( Figure 1 Significant changes were observed, namely, the retention times of different component peaks shifted, the open-ring plasmid peak increased significantly, and the supercoiled plasmid peak disappeared. It is speculated that this result may be due to residual sample in the injection needle or column during the injection process, leading to contamination of subsequent samples and consequently, cleavage of the KH35-sgRNA sample.

[0065] B. Method Optimization

[0066] To analyze the reasons for the differences in the results of repeated KH35-sgRNA injections, the injection sequence and testing methods were optimized, as detailed in Table 5:

[0067] Table 5. Reasons for Method Parameter Optimization and Changes

[0068]

[0069] The results of all quality control samples tested in the activity testing method validation were summarized in Table 6. As shown in Table 6, the peak area percentages of different components in the same repeatedly tested quality control samples were consistent (RSD values ​​were all less than 2.0%). Therefore, the SpCas9 D10A Nickase activity testing method needs to be optimized and adjusted according to the information in Table 5.

[0070] Table 6 Results of Repeated Testing of Quality Control Products

[0071]

[0072] C. Optimized detection method

[0073] In summary, the optimized method is as follows: the detection concentration of SpCas9 D10A Nickase protein was determined to be 0.020 mg / ml, and KH35 plasmid with a concentration of 100 µg / ml was prepared as target DNA. The required reagents for each reaction system were taken, and in vitro enzyme digestion reactions were performed according to Table 7. Detection and analysis were performed according to the 8-gradient elution method.

[0074] Table 7. SpCas9 D10A Nickase digestion reaction process (optimized)

[0075]

[0076] Table 8 Parameters of Activity Testing Method (Optimized)

[0077]

[0078] The initial value (before cutting) is the average percentage of the open-ring plasmid peak area of ​​all quality control samples, and the detection value (after cutting) is the percentage of the open-ring plasmid peak area of ​​the test sample. The difference between the detection value and the initial value is the detection activity of the SpCas9 D10ANickase protein sample.

[0079] After establishing and optimizing the SpCas9 D10A Nickase activity assay method, it was used as a platform method for SpCas9 D10A Nickase protein products. Method validation was performed, including specificity, linearity, accuracy, precision (reproducibility and intermediate precision), and robustness (incubation temperature and column). The validation results are summarized in the table below, and all validation items met the acceptable criteria. Based on the validation results, this method can be used as a platform method for SpCas9 D10A Nickase activity assay.

[0080]

[0081] Example 2. Method Comparison

[0082] Comparative Example 1. Methods for detecting biological activity in animals and cells:

[0083] Animal testing methods typically take weeks to months, while traditional cell proliferation methods require 48-56 hours. Furthermore, different cultured individuals or cell lines and culture conditions can lead to deviations in the results.

[0084] Comparative Example 2. Other in vitro activity detection methods:

[0085] The same sample was tested using the gel electrophoresis method, such as... Figure 2 As shown, since the quantitative accuracy of gel permeation spectroscopy for each component is lower than that of liquid chromatography (e.g., liquid chromatography can accurately detect the difference between 80% and 83%, but gel permeation cannot), it is difficult to accurately quantify and provide continuous quantitative data using gel permeation spectroscopy. This can lead to a large error in the judgment of bioactivity results and affect the quality assessment of the product.

[0086] Comparative Example 3. The method of Example 1

[0087] In this embodiment, the method in Example 1 detects the open-loop and supercoiled structures of the target DNA using ion exchange chromatography. The percentage of open-loop plasmid peak area in the sample is obtained using peak area normalization. The percentage of open-loop plasmid peak area in the untreated sample is taken as the initial value, and the percentage of open-loop plasmid peak area in the enzyme-digested sample is taken as the detection value. The difference between the detection value and the initial value is used as the detection activity of the protein sample. Figure 3 ).

[0088] Therefore, compared to animal methods, the method in this embodiment not only reduces the need for experimental animals and cells but also shortens the detection cycle, obtaining quantitative results in just a few hours, thus improving the convenience of quality testing in gene editing product production and research. Compared to the gel electrophoresis method, the method in this embodiment has high stability and high efficiency.

[0089] While the foregoing has focused on embodiments, these are merely illustrative and do not limit the invention. Those skilled in the art will understand that various modifications and applications not illustrated above can be made without departing from the essential characteristics of these embodiments. For example, the constituent elements specifically shown in the embodiments can be implemented through modifications. Furthermore, various differences related to such modifications and applications should be interpreted as being included within the scope of the invention as defined in the appended claims.

Claims

1. An sgRNA, characterized in that: It contains a sequence as shown in SEQ ID No.

1.

2. The sgRNA as described in claim 1, characterized in that: It is a sequence as shown in SEQ ID No.

2.

3. The application of sgRNA as described in claim 1 or 2 in the assay of SpCas9 D10A Nickase activity.

4. A target DNA, characterized in that: It contains a sequence as shown in SEQ ID No.

3.

5. The target DNA as described in claim 4, characterized in that: It is a sequence as shown in SEQ ID No.

4.

6. The application of the target DNA as described in claim 4 or 5 in the assay of SpCas9 D10A Nickase activity.

7. A product for detecting SpCas9 D10A Nickase activity, characterized in that: It contains target DNA as shown in SEQ ID No. 3 or SEQ ID No. 4, and sgRNA capable of recognizing the sequence shown in SEQ ID No.

5.

8. A product for detecting SpCas9 D10A Nickase activity, characterized in that: It contains sgRNA as shown in SEQ ID No. 1 or SEQ ID No. 2, and target DNA as shown in SEQ ID No. 3 or SEQ ID No.

4.

9. A method for detecting SpCas9 D10A Nickase activity, characterized in that: After the target DNA is specifically cleaved by the complex of SpCas9 D10A Nickase protein and sgRNA, the content of open circular plasmid is detected, and the difference between the content of open circular plasmid with added SpCas9 D10A Nickase protein and that without added SpCas9 D10A Nickase protein is calculated as the activity detection result. Wherein, the sgRNA is the sgRNA shown in SEQ ID No. 1 or SEQ ID No. 2; The target DNA is as shown in SEQ ID No. 3 or SEQ ID No.

4.

10. The method for detecting SpCas9 D10A Nickase activity as described in claim 9, characterized in that: The content of open-ring plasmids was determined by ion exchange chromatography.