Stress-inducible promoter proLc318 and use thereof
By integrating multiple cis-elements into Leymus chinensis to construct the artificial promoter proLc318, the low efficiency problem of promoter design in the prior art was solved, and the expression of stress-resistance genes was efficiently activated under drought stress, thereby improving the drought resistance of plants.
Patent Information
- Application Number
- CN202610460415.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-09
- Publication Date
- 2026-07-28
- Estimated Expiration
- 2046-04-09
AI Technical Summary
Existing technologies make it difficult to design promoters with high specificity and high inducibility in plants, resulting in low expression efficiency of stress resistance genes and an inability to effectively improve plant resistance to drought and other adverse conditions.
By integrating multiple cis-elements from the promoters of classic drought-regulated genes in Leymus chinensis, an artificial promoter proLc318 was constructed, which combines with multiple transcription factors to improve the expression efficiency of downstream genes under drought stress.
We have developed an artificial promoter with high specificity and strong inducibility under drought stress, which significantly improves the expression efficiency of downstream stress-resistance genes and provides a molecular breeding tool for drought resistance in various plants.
Smart Images

Figure CN122012507B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to the abiotic stress-induced promoter proLc318 and its applications. Background Technology
[0002] sheepgrass ( Leymus chinensis (Trin.) Tzvel *Cephalotaxus fortunei* is a typical drought-resistant native grass species found in the grasslands of northern my country. Through long-term evolution, it has developed a multi-layered drought-resistance regulatory network, providing crucial gene resources and regulatory mechanisms for the genetic improvement of drought resistance in crops. Within this network, transcription factors such as NAC and bZIP specifically recognize and bind to conserved cis-elements in gene promoter regions, thereby activating the expression of core drought-resistant genes such as NCED, LEA, and DHN, forming a core regulatory module for drought response. This regulatory mechanism is highly conserved in the plant kingdom, providing a molecular blueprint for the design of artificial promoters. Furthermore, by modularly assembling the aforementioned key cis-elements, short synthetic promoters can be constructed. These promoters exhibit high specificity and strong inducibility under drought stress, significantly improving the temporal and spatial expression efficiency of downstream stress-resistant genes, opening new avenues for the precise design of synthetic promoters with "low background and high inducibility." Summary of the Invention
[0003] This invention integrates multiple cis-elements that may be induced by drought in the classic drought-regulated gene promoters of Leymus chinensis and synthesizes an abiotic stress-inducible promoter to improve the temporal and spatial expression efficiency of downstream stress-resistant genes, opening up a new avenue for the precise synthetic promoter design with "low background and high induction".
[0004] The technical solution of this invention is implemented as follows: The first aspect of the present invention provides a DNA molecule, which is any one of the following 1) to 3): 1) The nucleotide sequence shown in SEQ ID NO:1; 2) DNA molecules that have more than 75% nucleotide sequence identity with the nucleotide sequence defined in 1) and possess promoter function; or 3) DNA molecules that hybridize with the nucleotide sequence shown in 1) under strict conditions and have promoter activity.
[0005] A second aspect of the invention is to provide a biomaterial containing the DNA molecule described in the first aspect, wherein the biomaterial is any one of the following: A1) DNA expression cassette; A2) Nucleic acid constructs; A3) Recombinant vector; A4) Recombinant microorganisms; A5) Recombinant cell lines.
[0006] A third aspect of the invention is to provide applications of the DNA molecule described in the first aspect, including: B1) as a promoter; B2) is used as a promoter to initiate the expression of the target gene.
[0007] A fourth aspect of the present invention is to provide a method for increasing the expression level of a target gene in plants under drought stress, comprising introducing the DNA molecule described in the first aspect into a target plant to obtain a transgenic plant, wherein the target gene in the transgenic plant is transcribed using the DNA molecule described in the first aspect as a promoter, and the expression level of the target gene is increased after transcription.
[0008] Furthermore, the target gene is an endogenous gene or an exogenous gene of the target plant.
[0009] Furthermore, the target gene is a gene that enhances resistance to abiotic stress.
[0010] Furthermore, the abiotic stresses are drought stress, high salt stress, abscisic acid stress, low temperature stress, and / or alkaline stress.
[0011] A fifth aspect of the present invention is to provide the application of the DNA molecule described in the first aspect, or the biological material described in the second aspect, or the preparation method described in the third aspect, in initiating the expression of a target gene.
[0012] A sixth aspect of the present invention is to provide the application of the DNA molecule described in the first aspect, or the biological material described in the second aspect, or the preparation method described in the third aspect, in the cultivation of transgenic plants.
[0013] Furthermore, the plant is tobacco or alfalfa.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is the first to integrate 15 drought-inducible cis-elements from the classic drought-regulated NCED, LEA, and DHN gene promoters in Leymus chinensis, synthesizing a drought-induced artificial promoter. Testing revealed that this promoter possesses drought-stress-induced transcriptional activity, capable of driving the efficient expression of downstream target genes in plants, thus opening a new avenue for precise promoter design with "low background and high induction."
[0015] The DNA molecule provided by this invention serves as a drought stress-inducible promoter, exhibiting high specificity and strong inducibility when faced with drought stress. It can be used to activate the expression of target genes under drought stress conditions, significantly improving the expression efficiency of downstream stress-resistance genes in time and space, thereby providing an efficient tool for drought-resistant molecular breeding research in various plants. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 This is a diagram showing the base sequence and element distribution of the artificial promoter proLc318 of this invention; Figure 2 This is a heatmap of the gene co-expression module-trait relationship in Example 1 of the present invention, showing the correlation between the gene co-expression module and the expression level of the drought resistance functional gene NCED; Figure 3 This is a scatter plot of enrichment analysis of the Skyblue3 module in Example 1 of the present invention, showing the status of the genes in this module in biological function (GO enrichment) and metabolic pathway (KEGG enrichment); Figure 4 The following are the types, quantities, and functional prediction results of the elements on the promoters of the three core drought-resistant functional genes in Example 1 of this invention; Figure 5 This is a heatmap of gene expression of three core drought-resistant functional genes and eight key transcription factors in Example 1 of the present invention under different treatments with ABA and polyethylene glycol. Figure 6 The results of the interaction between eight key transcription factors and the promoters of three core drought-resistant functional genes, and the interaction of fifteen promoter elements, verified by the Y1HGold-pAbAi system in Example 1 of this invention; Figure 7 The results of the interaction between ten key transcription factors and the promoters of three core drought-resistant functional genes, and the interaction of fifteen promoter elements, were verified by the Dual-LUC system in Example 1 of this invention. Figure 8This diagram illustrates the accumulation of betaine in leaves of *Nicotiana benthamiana* under different ABA treatments and with different promoters activating the Ruby reporter gene in Example 2 of the invention. a: Leaves of wild tobacco plants without any treatment; b: Tobacco leaves without a promoter fragment activating the Ruby gene; c: Tobacco leaves with the proCaMV35S promoter activating the Ruby gene; d: Tobacco leaves with the proLc318 promoter activating the Ruby gene; e: Tobacco leaves with the proLc318 promoter activating the Ruby gene, sprayed with 12 μM ABA; f: Tobacco leaves with the proLc318 promoter activating the Ruby gene, sprayed with 24 μM ABA. Figure 9 This figure shows the accumulation of Ruby reporter gene mRNA in leaves of *Nicotiana benthamiana* under different ABA treatments and with different promoters in Example 2 of the invention. The bars labeled with different lowercase letters show significant differences (LSD test, p < 0.05). Figure 10 This diagram illustrates the accumulation of betaine in alfalfa seedlings under different PEG6000 treatments and with different promoters activating the Ruby reporter gene in Example 2 of the invention. a: Alfalfa seedlings without any treatment; b: Alfalfa seedlings with the Ruby gene activated by the proLc318 promoter; c: Alfalfa seedlings with the Ruby gene activated by the proLc318 promoter, with the alfalfa immersed in 20% PEG6000. Figure 11 This invention example 2 uses semi-quantitative PCR to show the accumulation of Ruby gene mRNA in alfalfa seedlings treated with PEG6000. Different gel tanks represent different samples. a: Ruby gene-specific primer amplification in water without PCR template; b: Ruby gene-specific primer amplification. Figure 10 b: Alfalfa cDNA; c: Ruby gene-specific primer amplification Figure 10 c: Alfalfa cDNA; d: Alfalfa housekeeping gene actin-specific primer amplification in water without PCR template; e: Alfalfa housekeeping gene actin-specific primer amplification. Figure 10 b: Alfalfa cDNA; f: Amplification of the alfalfa housekeeping gene actin using specific primers. Figure 10 alfalfa cDNA in c. Detailed Implementation
[0018] The present invention will be further described below with reference to specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention and are not intended to limit the scope of the present invention.
[0019] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.
[0020] In a first aspect, this invention uses the transcriptome of *Leymus chinensis* treated with polyethylene glycol to simulate drought and ABA to identify three functional genes responding to drought stress: Lc5NS007055 (NCED3), Lc5Xm066036 (DHN1), and Lc2Xm053684 (LEA1). The nucleotide sequence of the promoter for Lc5NS007055 (NCED3) is shown in SEQ ID NO:2; the nucleotide sequence of the promoter for Lc5Xm066036 (DHN1) is shown in SEQ ID NO:3; and the nucleotide sequence of the promoter for Lc2Xm053684 (LEA1) is shown in SEQ ID NO:4.
[0021] In a second aspect, the promoter sequences 2000 bp upstream of the ATG of three functional genes, Lc5NS007055 (NCED3), Lc5Xm066036 (DHN1), and Lc2Xm053684 (LEA1), were mined from the Leymus chinensis genome, and cis elements were identified through PlantCARE analysis.
[0022] In a third aspect, this invention identifies eight transcription factors that may regulate the expression of drought-responsive genes by utilizing cis-elements present in the transcriptome and promoters of functional genes. These include NAC family members: Lc1Ns014266 and Lc4Xm045877; BZIP family member: Lc7Ns019412; WRKY family member: Lc1Xm060353 and Lc4Xm046498; ERF family CBF4 subclass: Lc2Ns002366 and Lc5Ns009729; and HD-ZIP class I transcription factor: Lc6Xm081008. The amino acid sequences of Lc1Ns014266 are shown in SEQ ID NO:5; Lc4Xm045877 are shown in SEQ ID NO:6; Lc7Ns019412 are shown in SEQ ID NO:7; Lc1Xm060353 are shown in SEQ ID NO:8; Lc4Xm046498 are shown in SEQ ID NO:9; Lc2Ns002366 are shown in SEQ ID NO:10; Lc5Ns009729 are shown in SEQ ID NO:11; and Lc6Xm081008 are shown in SEQ ID NO:12.
[0023] The fourth aspect of this invention verifies, through yeast monohybrid and luciferase experiments, that the above-mentioned eight transcription factors can directly bind to the promoters of three functional genes and activate gene expression.
[0024] In the fifth aspect of this invention, PlantCARE analysis identified 15 drought-stress-responsive cis-elements in the promoters of the three functional genes mentioned above. Based on functional prediction, these elements were divided into three groups: 1) Core induction modules: DRE1, DREcore, ABRE, MBS, TGACG-motif; 2) Co-enhancing modules: G-box, W-box, MYB recognition site, Myb-binding site, CCGTCC motif; 3) Auxiliary regulatory modules: plant_AP-2-like, LTR, TCT-motif, P-box, CGTCA-motif. The specific sequences of each cis-element are shown in Table 1.
[0025] In a preferred embodiment, by linking 15 key elements from these truncated fragments and constructing them into the pAbAi reporter vector, it was further verified that the approximately 96-base DNA sequence composed of only 15 elements is sufficient to efficiently bind eight drought-related transcription factors, thereby enabling the initiation of downstream gene expression upon exposure to drought stress signals. The 96-base sequence is shown in SEQ ID NO:13.
[0026] In a preferred embodiment, the components of the artificial promoter are synthesized sequentially and combined with the mini35s promoter to form an artificial promoter. This artificial promoter sequentially links the core induction module, the co-enhancing module, and the auxiliary regulatory module before connecting them to the mini35s promoter. This artificially synthesized promoter possesses drought stress-induced transcriptional activity and can drive the efficient expression of its downstream target gene in plants.
[0027] In the preferred embodiments described above, in the sequentially synthesized artificial promoter DNA molecule, an 8-10 bp base sequence rich in AT (AAAATTTT or AATATATAT, AAAAATTTTT or AATATATATAT) is inserted between adjacent modules, and an 8-10 bp base sequence rich in AT (AAAATTTT or AATATATAT, AAAAATTTTT or AATATATATAT) is also inserted between adjacent elements within any module to reduce competition between elements. The preferred synthesized artificial promoter is proLc318. Figure 1 Its nucleotide sequence is shown in SEQ ID NO:1, where 229bp to 318bp is the mini35s promoter fragment.
[0028] In some embodiments, a DNA molecule having at least 75% identity with the nucleotide sequence defined in SEQ ID NO:1, preferably at least 80%, more preferably at least 85%, and possessing promoter function, is also proposed. This DNA molecule also has the ability to initiate downstream gene expression upon receiving drought stress signals. The DNA molecule includes: 1) The insertion of AT-rich bases between two adjacent modules and / or between adjacent elements in any module in the sequence shown in SEQ ID NO:1 alters the expression of the cis element; 2) The order of modules in the sequence shown in SEQ ID NO:1 remains unchanged, but the order of elements in a single module changes.
[0029] In some embodiments, a DNA molecule that hybridizes to the nucleotide sequence defined in SEQ ID NO:1 under stringent conditions and possesses promoter activity is also proposed. This DNA molecule also has the ability to initiate downstream gene expression upon exposure to drought stress signals. Hybridization under stringent conditions refers to the formation of stable double-stranded hybrid molecules through hydrogen bonds and complementary base pairing under suitable conditions.
[0030] In some specific embodiments, experiments have verified that the artificial promoter proLc318 has the ability to initiate the expression of target genes in plants such as tobacco and alfalfa after being subjected to drought stress signals. The target genes include endogenous genes and exogenous genes, and the expression of the target genes was detected as high in any tissue of the transgenic plants.
[0031] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold SpringHarbor).
[0032] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials in this invention. In fact, the sources of the biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted according to the instructions in the embodiments. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.
[0033] The nucleotides involved in the following examples can all be synthesized using existing technologies.
[0034] Example 1: Screening of drought-responsive elements and synthesis of artificial promoters for Leymus chinensis
[0035] (1) Drought-resistant functional genes and drought-responsive transcription factors that bind to their promoters
[0036] Seedlings of Leymus chinensis at the three-leaf stage were subjected to drought simulation treatment (PEG6000). Time gradient: After treatment with 15% PEG6000, leaves and roots were collected at 0, 1, 3, 6, 9, 12, 24, and 48 h. Significant response time points were screened by qPCR, and transcriptome sequencing was performed (n=3 biological replicates). Concentration gradient: Treatment with 0%, 1%, 3%, 5%, 10%, 15%, 20%, and 25% PEG6000 for 27 h. Significant response concentrations were screened by qPCR, and transcriptome sequencing was performed (n=3).
[0037] Leymus chinensis seedlings at the three-leaf stage were treated with ABA. Time gradient: After treatment with 2 μM ABA, tissues were collected at 0, 1, 3, 6, 9, 12, 24, and 48 h to screen for significant responses and perform transcriptome sequencing (n=3). Concentration gradient: Treatment with 0, 0.5, 1, 2, 4, 8, 12, and 24 μM ABA for 27 h, with significant response concentrations screened for transcriptome sequencing (n=3).
[0038] All treatments were validated by qPCR to assess the expression dynamics of NCED3 (Lc5Ns007055) to ensure that the selection of transcriptome samples was based on biological evidence.
[0039] Based on bioinformatics analysis, the Skyblue3 module was found to be highly correlated with the expression level of the drought-resistance gene NCED in the gene co-expression module-trait relationship heatmap. Figure 2 195 genes were identified through screening. Furthermore, this module contained a large number of genes involved in ABA-induced responses, abiotic stress responses, and hormone signaling. Figure 3 Among these genes, eight transcription factors—including NAC family members Lc1Ns014266 and Lc4Xm045877; BZIP family member Lc7Ns019412; WRKY family members Lc1Xm060353 and Lc4Xm046498; ERF family CBF4 subclass Lc2Ns002366 and Lc5Ns009729; and HD-ZIP class I transcription factor Lc6Xm081008—show a co-expression trend with three drought-resistance functional genes. Induced by ABA and simulated drought stress, they are potentially key transcription factors regulating drought resistance in Leymus chinensis. Figure 5 ).
[0040] (2) In vitro verification of 15 drought-responsive elements in the promoter of drought-resistant genes.
[0041] Based on the Leymus chinensis Lc6-5 genome and the obtained CDS and PEP fasta files, we searched for 2000 bp sequences upstream of the promoters of the drought-resistant functional genes Lc5NS007055 (NCED3), Lc5Xm066036 (DHN1), and Lc2Xm053684 (LEA1) in Leymus chinensis. PlantCARE analysis identified cis-elements. Among them, 15 cis-elements regulated by drought stress response or directly by drought-induced transcription factors were predicted, including: DRE1, DRE core, ABRE, MBS, TGACG-motif, G-box, W-box, MYB recognition site, Myb-binding site, CCGTCCmotif, plant_AP-2-like, LTR, TCT-motif, P-box, and CGTCA-motif. Their functional predictions are shown in Table 1.
[0042] Table 1: Promoter cis-acting elements associated with drought response
[0043] Next, the Y1HGold-pAbAi yeast one-hybrid system was used to verify the interactions between eight drought-resistance-related transcription factors and the promoters of three functional genes, as well as the interactions of 15 elements. By dissecting the 2000bp NCED3, DHN1, and LEA1 promoters into multiple fragments of approximately 300bp each, the binding sites with the eight transcription factors Lc1Ns014266, Lc4Xm045877, Lc7Ns019412, Lc1Xm060353, Lc4Xm046498, Lc2Ns002366, Lc5Ns009729, and Lc6Xm081008 were further identified. After ligating the 15 key elements from these truncated fragments, the resulting pAbAi reporter vector was constructed, further validating that a DNA sequence of approximately 96 bases consisting of only 15 elements is sufficient to efficiently bind the eight drought-resistance-related transcription factors. Figure 6 This enables the expression of downstream genes upon exposure to drought stress signals. The 96-base sequence is: GACACGTGGCGCCGACACCGAGATGACGCAACAGTTGACCTCTTACCCTTTTGCGTCACACGTGCCGAAACAACTGCCGTCCCGACCAGGCCGTTG (SEQ ID NO:13).
[0044] Similarly, the Dual-LUC luciferase system was used to verify the interactions between eight drought-resistance-related transcription factors and three functional gene promoters, as well as the interactions of 15 elements. It was also verified that a DNA sequence of approximately 96 bases, consisting of only 15 elements, is sufficient to efficiently bind eight drought-resistance-related transcription factors, with an effect far exceeding that of any single 2000 bp functional gene promoter. Figure 7 This further validates that these 15 elements have the ability to initiate downstream gene expression after being subjected to drought stress signals.
[0045] Example 2: Synthesis of the artificial promoter proLc318 and verification of its function
[0046] Based on functional predictions, the 15 drought-induced promoters were divided into three groups: core induction modules (DRE1, DRE core, ABRE, MBS, TGACG-motif); synergistic enhancement modules (G-box, W-box, MYB recognition site, Myb-binding site, CCGTCC motif); and auxiliary regulatory modules (plant_AP-2-like, LTR, TCT-motif, P-box, CGTCA-motif). These were synthesized sequentially into components for an artificial promoter, which, together with the mini35s promoter, formed the artificial promoter. Figure 1 This promoter is used to initiate the expression of the Ruby system. The Ruby system ensures efficient and independent release of each protein after translation by fusing three key enzyme genes—CYP76AD1, DODA, and GT—into a single open reading frame with a self-cleaving 2A peptide sequence embedded in the middle. This system utilizes the abundant naturally occurring tyrosine in plants as the sole substrate, allowing for continuous intracellular synthesis of bright red betaine without the need for exogenous chemical additives, resulting in a clearly visible red phenotype in the target tissue. In this case, the brighter the red of the tissue, the more Ruby protein is theoretically expressed, indicating higher promoter activity. Therefore, the depth of redness in plant tissue indicates promoter strength.
[0047] The Ruby reporter gene, initiated by an artificial promoter, was expressed in *Tobacco Bunge*. Ruby expression was observed in the experimental and control groups under spraying with 0 μM, 12 μM, and 24 μM abscisic acid (ABA). The redness of the leaves and the expression level of the Ruby gene were also observed. It was found that with increasing concentrations of ABA, a key drought signaling hormone, the redness of tobacco leaves initiated by the proLc318 promoter gradually increased, but was less than that of tobacco leaves initiated by the constitutive proCaMV35S promoter. Untreated wild tobacco leaves and tobacco leaves without the promoter fragment for the Ruby gene showed almost no redness. Figure 8The results of quantitative real-time detection of Ruby gene expression levels were consistent with the degree of leaf redness, both indicating that the proLc318 promoter is capable of responding to drought hormone signals and inducing the expression of downstream genes. Figure 9 ).
[0048] Using the YK-50ATPro plant in vivo transformation system provided by Medcard Technology Co., Ltd., an artificial promoter-driven Ruby reporter gene was expressed in alfalfa seedlings. The infection method was as follows: plant material was placed in an OD medium containing Agrobacterium tumefaciens. 600 After being treated with a 0.6% resuspension of the infection solution using a 40kHz water bath ultrasonic instrument for 3 minutes, Agrobacterium tumefaciens was infected under vacuum at 300 mmHg for 20 minutes. After returning to normal pressure, the infection was continued under vacuum at 300 mmHg for another 20 minutes. The treated material was then placed in 0% and 20% PEG6000 solutions to observe the expression of Ruby in the experimental and control groups, specifically the redness of the seedlings and the expression level of the Ruby gene. It was found that alfalfa seedlings with the proLc318-activated Ruby gene exhibited a betalain red color, and the redness of alfalfa seedlings treated with PEG6000 to simulate drought was stronger than that of the untreated group. Figure 10 The results of semi-quantitative PCR detection of Ruby gene expression levels were consistent with the redness of the seedlings. In alfalfa seedlings treated with PEG6000 to simulate drought, the Ruby gene expression level was higher than that in the untreated group. This indicates that the proLc318 promoter responds to drought signals and induces the expression of downstream genes. Figure 11 ).
[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A DNA molecule, whose nucleotide sequence is shown in SEQ ID NO:
1.
2. Biomaterials containing the DNA molecule of claim 1, characterized in that, The biological material is any one of the following: A1) a DNA expression cassette; A2) a nucleic acid construct; A3) a recombinant vector; A4) a recombinant microorganism; A5) a recombinant cell line.
3. Use of a DNA molecule according to claim 1, characterised in that, The application comprises: B1) use as a promoter; B2) use as a promoter to initiate expression of a target gene.
4. A method for increasing the expression level of a gene of interest in plants under drought stress, characterized in that, The application comprises introducing the DNA molecule of claim 1 into a target plant to obtain a transgenic plant, and using the DNA molecule of claim 1 as a promoter to initiate transcription of a target gene in the transgenic plant, so that the expression amount of the target gene is increased after transcription; the plant is tobacco or alfalfa.
5. The method of claim 4, wherein, The target gene is an endogenous gene or an exogenous gene of the target plant.
6. The method of claim 4, wherein, The target gene is a gene related to the ability to resist abiotic stress.
7. The method of claim 6, wherein, The abiotic stress is drought stress, high-salt stress, abscisic acid stress, low-temperature stress, and / or alkali stress. 8.Use of the DNA molecule of claim 1, or the biological material of claim 2, or the preparation method of any one of claims 4-7, to initiate expression of a target gene in a plant; the plant is tobacco or alfalfa. 9.Use of the DNA molecule of claim 1, or the biological material of claim 2, or the preparation method of any one of claims 4-7, to cultivate a transgenic plant; the transgenic plant is tobacco or alfalfa.