Plant piercing-sucking pest related gene MED25 and application thereof
By regulating the loss of function or overexpression of the maize MED25 gene and controlling the expression of the terpene synthase gene, the problem of aphid resistance was solved, achieving high-efficiency plant resistance to aphids and promoting the development of a green plant protection system.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-01-29
- Publication Date
- 2026-05-12
AI Technical Summary
Existing chemical control methods have led to increased aphid resistance, which harms human health and disrupts the ecological balance. There is an urgent need to explore endogenous insect-resistant genes in plants to cultivate stable-yielding insect-resistant crops.
By using the loss-of-function or overexpression of the maize MED25 gene, plant resistance to aphids can be regulated. This method participates in aphid resistance by regulating the expression of terpene synthase genes (TPSs), and has been applied to plants such as Arabidopsis thaliana, rapeseed, maize, rice, and sorghum.
It improves plants' resistance to aphids, provides a safe, efficient, and sustainable green plant protection system, reduces aphid reproduction rate and weight, and enhances crops' insect resistance.
Smart Images

Figure CN122012520A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a gene MED25 related to plant piercing-sucking pests and its applications. Background Technology
[0002] Piercing-sucking pests (aphids) are widely distributed globally, seriously threatening the growth of various types of plants, including food crops and oil crops. Aphids are characterized by their small size, rapid reproduction rate, and strong migratory ability. They can reproduce rapidly on plants in a short period of time. While aphids reproduce in large numbers, they threaten plant photosynthesis and spread various plant viruses, leading to weakened plant growth and causing huge economic losses to global agricultural production.
[0003] Currently, chemical control is the main means of reducing aphid damage. However, with the large-scale use of various insecticides on the market, aphids have developed resistance to insecticides, which has become a major challenge in the field of pest management. Long-term application of insecticides such as pyrethroids, organophosphates, and neonicotinoids (such as imidacloprid) leads to mutations in aphids, such as increased activity of detoxification enzymes and decreased sensitivity. This control method ultimately leads to a vicious cycle of "increased pesticide use and increased pest resistance", which not only harms human health but also disrupts the ecological balance.
[0004] Given the surge in pesticide resistance and ecological imbalance caused by chemical control, it is urgent to explore endogenous insect-resistant genes in plants. By deeply analyzing the molecular mechanisms by which crops defend against aphid infestations and using modern biotechnology to precisely introduce natural resistance genes into target crops, it is hoped that new varieties with stable yields and insect resistance can be cultivated. From the perspective of endogenous resistance and sensitivity genes in plants, this approach can not only alleviate pest damage at its source but also provide a safe, efficient, and sustainable green plant protection system for crop insect resistance. Summary of the Invention
[0005] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide a gene related to piercing-sucking pests, MED25, and its application.
[0006] The present invention achieves the above objectives through the following technical solutions: This invention provides a gene MED25 related to piercing-sucking pests. The MED25 gene is derived from maize, and its nucleotide sequence is shown in SEQ ID NO.1.
[0007] The present invention also provides a protein encoded by the MED25 gene, the amino acid sequence of which is shown in SEQ ID NO.2.
[0008] This invention also provides the application of the plant-associated piercing-sucking pest gene MED25, as described above, in regulating plant resistance to piercing-sucking pests.
[0009] As a further optimization of the present invention, the mutation of the MED25 gene causes the gene to lose its function, thereby increasing the plant's resistance to piercing-sucking pests, while the overexpression of the MED25 gene reduces the plant's resistance to piercing-sucking pests.
[0010] As a further optimization of the present invention, the plant is Arabidopsis thaliana, rapeseed, corn, rice, or sorghum.
[0011] As a further optimization of the present invention, the corn is a corn inbred line B73 or B104.
[0012] As a further optimization of the present invention, the piercing-sucking pest is an aphid.
[0013] The present invention also provides the application of the MED25 gene or the protein encoded as described above in the preparation of drugs for controlling piercing-sucking pests.
[0014] As a further optimization of the present invention, the piercing-sucking pest is an aphid.
[0015] The present invention has the following beneficial effects: This invention is the first to demonstrate that a mutation in the MED25 gene of maize, which results in the loss of gene function, can enhance maize's resistance to piercing-sucking pests. Furthermore, the MED25 gene participates in resistance to piercing-sucking pests by transcribing and regulating the expression of terpene synthase genes (TPS genes). This provides important theoretical and technical support for breeding maize varieties resistant to piercing-sucking pests and has significant production and application value. Attached Figure Description
[0016] Figure 1 This is an electrophoresis image of the full-length amplified MED25 gene of this invention; Figure 2 This is an identification diagram of the homozygous mutant med25 of the MED25 gene of the present invention; Figure 3 This is a comparison chart showing the changes in aphid weight after 7 days of forced feeding of the homozygous mutant med25 of wild-type maize B73 and MED25 genes to aphids. Figure 4 This is a comparison chart showing the changes in aphid reproduction rate after the homozygous mutant med25 of the wild-type maize B73 and MED25 genes was forcibly fed to aphids for different durations. Figure 5 This is a comparison chart showing the changes in aphid weight after 7 days of forced feeding of aphids to wild-type maize lines overexpressing the B73 and MED25 genes of this invention. Figure 6This is a comparison chart showing the changes in aphid reproduction rate after forced feeding of aphids to wild-type maize lines overexpressing the B73 and MED25 genes for different durations, according to the present invention.
[0017] Figure 7 The expression level of TPSs gene in maize plants was determined after the homozygous mutant med25 of wild-type maize B73 and MED25 genes was forcibly fed with aphids for 24 hours. Detailed Implementation
[0018] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.
[0019] 1. Materials Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.
[0020] 2. Method 2.1 Cloning of the maize MED25 gene Using maize variety B73 as material, total RNA was extracted and then reverse transcribed to synthesize the first strand of cDNA, which was used as a template for PCR amplification. Amplification was performed using designed specific primers, the nucleotide sequences of which are as follows: SEQ ID NO.3: MED25-F1: 5'>ATGGCGGCGGCGGATAGGCAGTT<3'; SEQ ID NO.4: MED25-R1: 5'>ATGCCTGGGGGAGGCTTCCTACCT<3'; A 2601 bp gene fragment was obtained after amplification (electrophoresis results are shown below). Figure 1 (As shown), it was ligated into the T-cloning vector PEASY-T3 simple vector to obtain the recombinant plasmid T3-MED25, which was then transformed into E. coli. Positive clones were picked and sequenced. The sequencing results were consistent with the predicted results, and the nucleotide sequence of the MED25 gene as shown in SEQ ID NO.1 was obtained. The amino acid sequence of the encoded protein is shown in SEQ ID NO.2. This gene belongs to the transcription mediator complex subunit member.
[0021] 2.2 Identification and Aphid Resistance Analysis of the med25 Mutant Based on the nucleotide sequence of the MED25 gene, a homozygous mutant of the maize MED25 gene (gene number Zm00001d005573), denoted as mutant med25, was ordered from the maize EMS mutagenesis mutant library website (https: / / maizeems.qlnu.edu.cn / ). After PCR amplification, the mutant was recovered and sequenced. Sequencing results showed that the med25 mutant, compared to B73, underwent a CAG mutation to a TAG mutation, leading to premature termination. The sequencing results are as follows: Figure 2 As shown. PCR amplification primers were designed using the dCAPS Finder 2.0 website, and the identification primers shown below were synthesized: SEQ ID NO.5: MED25-F2: 5'>CAGCTACAGCAATTTCAACAGCTG<3'; SEQ ID NO.6: MED25-R2: 5'>CAACCTTCGCAGATGCAGCA<3'.
[0022] Subsequently, aphid weight indicators were tested on wild-type maize B73 and med25 mutants. The specific procedures are as follows: Wild-type maize B73 and the med25 mutant maize were planted separately in pots. When the maize reached the V4 stage, one one-day-old aphid was placed on the pulvinus of the second leaf of each plant. After the aphids reproduced for the first time, aphids that had reproduced for 7 consecutive days were removed, and 5 aphids were randomly selected and weighed. The weight of each aphid was then divided by 5 to obtain the weight of a single aphid. The results are as follows. Figure 3 As shown.
[0023] The aphid reproduction rate of wild-type maize mutants B73 and med25 was detected using the following procedures: Wild-type maize B73 and the med25 mutant maize were planted separately in pots. When the maize reached the V4 stage, one one-day-old aphid was placed on the leaf pulvinus of the second leaf of each plant. The number of days from birth to the first reproduction, and the total number of aphids per day for 14 consecutive days of reproduction were recorded. An aphid reproduction rate graph was plotted, and the results are as follows: Figure 4 As shown, based on mutation 3-4 analysis, the aphid reproduction rate and body weight of the maize med25 mutant were significantly lower than those of the wild-type B73, indicating that the loss of function of the MED25 gene enhanced maize's resistance to aphids.
[0024] 2.3 Creation of maize lines overexpressing the MED25 gene and analysis of their aphid resistance Using the Ubi promoter to drive the CDS sequence of the FLAG gene and the target gene MED25, the pCAMBIA-Ubi overexpression vector was constructed and transformed into maize B104 to create transgenic maize lines overexpressing MED25 (denoted as MED25-OE#1, MED25-OE#2, and MED25-OE#3). Subsequently, the aphid resistance performance of the above-mentioned MED25 gene overexpressing maize materials was evaluated, and the specific steps were the same as in 2.2.
[0025] The results are as follows Figure 5 and Figure 6 As shown, the reproduction rate and body weight of aphids on maize materials overexpressing the MED25 gene were significantly higher than those on wild-type maize B104, indicating that overexpression of the MED25 gene reduced maize's resistance to aphids.
[0026] 2.4 Changes in TPSs gene expression after aphids infest wild-type maize B73 and med25 mutants Wild-type maize B73 and the med25 mutant maize were planted separately in pots. When the maize reached the V4 stage, two groups were established under the same environmental conditions: one group was inoculated with aphids, and the other was not. In the aphid-inoculated group, 50 aphids of appropriate age were placed on the middle part of the third leaf of each maize seedling. After 24 hours, the aphids were removed, and liquid nitrogen samples were taken from the inoculated leaf areas. Total RNA was then extracted, and the extracted total RNA was reverse transcribed to synthesize the first strand of cDNA, which was used as a template for RT-PCR amplification. The expression level of the TPSs gene in wild-type maize B73 and the med25 mutant maize was measured. The experimental results are as follows: Figure 7 As shown, the results indicate that there was no significant difference in the expression level of TPSs gene between med25 mutant maize and wild-type maize B73 when aphids were not inoculated; however, 24 hours after aphid inoculation, the expression level of TPSs gene in med25 mutant maize was significantly lower than that in wild-type maize B73.
[0027] 3. Conclusion After aphids fed on the med25 mutant maize material, its body weight and reproductive rate were significantly lower than those of wild-type maize B73, exhibiting a phenotype of resistance to maize aphids. Overexpression of the MED25 gene in maize resulted in a significantly more sensitive phenotype to aphids. RT-PCR experiments showed that 24 hours after aphid inoculation, the expression level of TPSs in the med25 mutant was significantly lower than that in B73, indicating that MED25 participates in maize aphid resistance by regulating TPSs gene expression. These results demonstrate that maize overexpressing MED25 is sensitive to aphids, while the loss of MED25 function provides significant resistance to aphids.
[0028] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
[0029] sequence list Title: MED25, a gene associated with plant piercing-sucking pests, and its application Inventors: Li Peijin, Zhao Yibing, Wang Tengyue, Tao Zhen, Wang Chuanhong, Tang Zhiwei, Dong Jinghui, Lei Sisi, Cui Mingliang, Li Tingchun Applicant: Anhui Agricultural University Serial Number: SEQ ID NO.1 Type: DNA Length: 2604 Source: Corn (Zea mays L) Sequence number: SEQ ID NO.2 Type: AA Length: 868 aa Source: Zea mays L MAAADRQLVVAVEGTAALGPYWSTIVAEYVEKIVRSFCASELPGQKLVGTPPELALVVFHTHGPYSAFDVQRSGWTKDVDAFLSWLSGILFSGGGFSEASTCEGLAEALKILQGNPNTTQGHQNHEAQKHCILVAASNPYPLPTPVYCLPTQSTDHKENIETSKEPSIADAETVAKSFAQCSVSLSVISPKQLPTLKAIYNAGKRNLRAADPSVDHAKNPHFLVLLSENFMEARTALSRPLHGNLAPNQTITKMDTAPAVTMPGPTSNGNSSVNAMAGRQPIVGGISTTSVKVEPTTMPPIVSAPAFSHVTPISNVASQGISALQTSSPSLISQEANMGNDNVQEHKPIINPVQQPIRPGGHGSLLNNLSQVRLMNSTSLGGGATSMGLPNMGATPIQVHMSNMISSGMTSTPSVISSMSGPGQPISTQQMVQSTALGSFGSNTPTVTGNSTIAVSSSLTNNQSSMGMGQSVQSVAQGGLVSGSQLGQGGIVANQNVMSTLGPTAISSTPAMMPTPGMVPQTGVNSLGVNNNSAMNMPITQQHANAQQPPPKYVKIWEGTLSGQRQGQPVIICKLEGYRSGTASETLAADWPETMQIVRLIAQEHMNNKQYVGKADFLVFRTLNHHGFLVQLQEKKLCAVIQLPSQTLLLSMADKAGRLIGMLFPGDMVVFKPQASTQQTPMQQQQLQQFQQQQQQLQQHMHMQPQGLPLQQSQMQLQQQQPQMQPMQQQQPSQMQQQMQSMQQQMQPMQQQMQHQQQQMQHQQQQMQQMQQQQQQQQQQQQQIQPQQQQMQQMQQQQQQQMPQQQQMQQMQQQQQQMQPQQQQQPQMVGTGMGQQFMQGHNRAVQMMQGKITPQGPGSMPGGGFLP* Sequence number: 3 Type: DNA Length: 23 Source: Artificial sequence ATGGCGGCGGCGGATAGGCAGTT Serial Number: 4 Type: DNA Length: 24 Source: Artificial sequence ATGCCTGGGGGAGGCTTCCTACCT Serial Number: 5 Type: DNA Length: 24 Source: Artificial sequence CAGCTACAGCAATTTCAACAGCTG Serial Number: 6 Type: DNA Length: 20 Source: Artificial sequence CAACCTTCGCAGATGCAGCA
Claims
1. A plant-sucking pest-related gene, MED25, characterized in that, The MED25 gene is derived from maize, and its nucleotide sequence is shown in SEQ ID NO.
1.
2. A protein encoded by the MED25 gene as described in claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.
2.
3. The application of the plant susceptibility-to-sucking pest-related gene MED25 as described in claim 1 in regulating plant resistance to suscepting pests.
4. The application according to claim 3, characterized in that, The mutation of the MED25 gene causes the gene to lose its function, which increases the plant's resistance to piercing-sucking pests, while the overexpression of the MED25 gene reduces the plant's resistance to piercing-sucking pests.
5. The application according to claim 4, characterized in that, The plants mentioned are Arabidopsis thaliana, rapeseed, corn, rice, or sorghum.
6. The application according to claim 5, characterized in that, The maize mentioned is maize inbred lines B73 and B104.
7. The application according to claim 4, characterized in that, The piercing-sucking pest is an aphid.
8. The use of the MED25 gene as described in claim 1 or the protein encoded as described in claim 2 in the preparation of drugs for controlling piercing-sucking pests.
9. The application according to claim 8, characterized in that, The piercing-sucking pest is an aphid.