Gene GbCYP701A6 for promoting synthesis of ginkgo terpene lactones and application of gene GbCYP701A6

By cloning and regulating the key gene GbCYP701A6 for the synthesis of ginkgolide lactones, the problem of unclear synthesis pathways for ginkgolide lactones was solved, and the content of ginkgolide lactones was significantly increased, providing genetic resources for its medicinal value and industrial development.

CN122012537APending Publication Date: 2026-05-12YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2026-01-29
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The biosynthetic pathway of ginkgolides is unclear, making their complete chemical synthesis difficult. Their natural content is low and unstable, making it difficult to meet market demand. Furthermore, the large genome and long growth cycle of ginkgo, coupled with an immature genetic transformation system, affect its medicinal value and industrial development.

Method used

We cloned and expressed GbCYP701A6, a key gene in Ginkgo biloba that promotes the synthesis of terpene lactones. By constructing overexpression vectors and virus-induced gene silencing vectors, we regulated the expression of GbCYP701A6 in Ginkgo biloba and significantly improved the synthesis of terpene lactones.

Benefits of technology

It significantly increased the content of ginkgolides A, B, C and Ginkgolide in Ginkgo biloba leaves, provided key gene resources for the secondary metabolic pathway of Ginkgo biloba, filled the gap in the synthesis of ginkgolides, and provided gene resources for increasing yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012537A_ABST
    Figure CN122012537A_ABST
Patent Text Reader

Abstract

The invention discloses a gene GbCYP701A6 for promoting synthesis of ginkgo terpene lactones and application of the gene GbCYP701A6. The nucleotide sequence of the gene GbCYP701A6 is shown as SEQ ID NO.1, and the amino acid sequence of protein expressed by the gene GbCYP701A6 is shown as SEQ ID NO.2. The invention further discloses a preparation method of the gene GbCYP701A6. According to the invention, a brand new gene GbCYP701A6 is cloned from gingko for the first time. The GbCYP701A6 gene is transferred into a ginkgo biloba body, the GbCYP701A6 gene is over-expressed, the contents of terpene lactones including ginkgolide A, ginkgolide B, ginkgolide C and bilobalide in ginkgo biloba are remarkably increased, and the contents of the ginkgolide A, ginkgolide B, ginkgolide C and bilobalide are remarkably reduced when the gene is silently expressed, so that the gene is a key gene for promoting synthesis of the ginkgo terpene lactones, and the GbCYP701A6 gene can be used for preparing the ginkgo biloba terpene lactones. Therefore, the regulation and control of the expression of the GbCYP701A6 has important application value in the aspects of improving the medicinal quality of the ginkgo leaves and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a gene GbCYP701A6 that promotes the synthesis of ginkgolide lactones and its applications. Background Technology

[0002] Ginkgo (Ginkgo biloba L.) is the only extant tree species in the genus Ginkgo of the family Ginkgoaceae. As an ancient relict plant, its leaves are rich in various bioactive components, including flavonoids, terpenes, phenolic acids, and ginkgolides, possessing significant medicinal and economic value. Ginkgo biloba extract (GbE) is the active ingredient extracted from ginkgo leaves, mainly consisting of flavonols and terpene lactones, and is an important pharmaceutical raw material for treating cardiovascular diseases. Among them, ginkgolides are unique active substances found in ginkgo, which can be divided into diterpenoid ginkgolides (A / B / C / J / M, etc.) and sesquiterpenoid bilobalide (BB). Ginkgo lactones are specific platelet-activating factor (PAF) antagonists, exhibiting significant pharmacological activity in neuroprotection, anti-allergy, and treatment of cardiovascular and cerebrovascular diseases. Therefore, their content in ginkgo leaves directly affects the quality and medicinal value of the raw material.

[0003] However, the chemical structure of ginkgolides is highly complex, containing a unique twelve-carbon skeleton, multiple lactone rings, and tert-butyl groups, making their total chemical synthesis extremely difficult. Currently, their biosynthetic pathways and key enzyme genes remain unclear, further hindering efficient production through synthetic biology strategies. Furthermore, the natural content of ginkgolides in ginkgo leaves is very low (generally only 0.01%–0.1% of dry weight), and yields are unstable due to variations in variety, tree age, ecological environment, and harvesting time, making it difficult to meet market demand. Therefore, elucidating the biosynthetic pathways of ginkgolides and identifying and verifying their key synthetic genes have become crucial scientific issues for increasing ginkgolide yields and promoting the development of related industries.

[0004] The biosynthesis of Ginkgo terpenoid lactones follows the phytoisoprene metabolic pathway. Upstream, a universal enzyme system forms geraniol-geraniol pyrophosphate (GGPP), which is then cyclized by terpene synthases to form a characteristic backbone. Subsequently, multiple oxidative modifications are required to convert it into the biologically active final product. In this process, the cytochrome P450 monooxygenase (CYP450) superfamily plays a central role, responsible for executing key reactions such as hydroxylation, epoxidation, and oxidative rearrangement, influencing the structural diversity, degree of oxidative modification, and biological activity of terpenoid compounds. Due to the large genome, long growth cycle, and immature genetic transformation system of Ginkgo, progress in Ginkgo gene function research has been slow.

[0005] Therefore, in-depth exploration and functional validation of the key CYP450 enzymes in the synthesis pathway of ginkgo terpene lactones can not only fill the key gap in the secondary metabolic pathway of ginkgo and reveal the molecular basis of its unique medicinal components, but also provide important genetic resources for improving the yield of ginkgo terpene lactones through synthetic biology and metabolic engineering. Summary of the Invention

[0006] Objective of the invention: To address the shortcomings of existing technologies, this invention provides a key gene, GbCYP701A6, for promoting the synthesis of ginkgolide lactones. By promoting the expression of this gene, the content of ginkgolide A, ginkgolide B, ginkgolide C, and ginkgolide in ginkgo can be increased simultaneously, thereby effectively improving the synthesis of terpene lactones in ginkgo.

[0007] This invention also provides the protein, vector, and application of the key gene GbCYP701A6 that promotes the synthesis of ginkgolide lactones.

[0008] This invention also establishes a system for transient overexpression and gene silencing of Ginkgo biloba, providing a reliable technical method for analyzing the function of Ginkgo biloba genes.

[0009] Technical solution: In order to achieve the above objective, the present invention provides a gene GbCYP701A6 that promotes the synthesis of ginkgolide lactones, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] The protein expressed by the gene GbCYP701A6 that promotes the synthesis of ginkgolide lactones according to the present invention has the amino acid sequence shown in SEQ ID NO.2.

[0011] The present invention describes an expression vector containing the gene GbCYP701A6, which promotes the synthesis of ginkgolide lactones.

[0012] Preferably, the expression vector assembles a constitutive promoter CaMV35S at the 5' end of the GbCYP701A6 gene and a NOS-terminator at the 3' end of the GbCYP701A6 gene. The CaMV35S promoter enables efficient expression of the GbCYP701A6 gene in Ginkgo biloba, while the NOS-terminator effectively terminates the transcription of the GbCYP701A6 gene.

[0013] Furthermore, the expression vector is assembled with an NPTⅡ gene expression cassette, which serves as a screening marker for transgenic Ginkgo biloba, and kanamycin is used to screen for transgenic Ginkgo biloba.

[0014] Furthermore, the expression vector is assembled with LB (T-Border left) and RB (T-Border right) sequences, which promote the integration of the GbCYP701A6 gene expression framework and the selection marker gene NPTⅡ assembled therein into the Ginkgo chromosome.

[0015] Preferably, the primer pairs used to amplify the gene GbCYP701A6 to construct the overexpression vector p1305.4 are SEQ ID NO.3: ATGACAAAGCTTCTGTTAGCCACTAT and SEQ ID NO.4: ATGGTTAGTTGCAGAGGATCTTCTG. The primer pairs used to construct the virus-induced gene silencing vector pTRV2 are SEQ ID NO.5: ACGAGTAGACAGGTGGAGATGTCA and SEQ ID NO.6: AATCTGAACGTCCTCGTGAACG.

[0016] The host cell described in this invention contains the gene GbCYP701A6 or its expression vector that promotes the synthesis of ginkgolide lactones, and the host cell is generally Agrobacterium.

[0017] The application of the gene GbCYP701A6, the protein, the expression vector, or the host bacteria described in this invention in promoting the synthesis of ginkgolide lactones.

[0018] The terpene lactone is any one or more of ginkgolide A, ginkgolide B, ginkgolide C, and ginkgolide.

[0019] Among them, the application of overexpression of the gene GbCYP701A6 in Ginkgo biloba in promoting the synthesis of Ginkgo terpene lactones.

[0020] The process of promoting the synthesis of ginkgo terpene lactones is as follows: using ginkgo leaves as material, the gene GbCYP701A6 is cloned and constructed into the overexpression vector P1305.4 to obtain a recombinant vector. This recombinant vector is then transformed into Agrobacterium, and the Agrobacterium resuspension is injected into ginkgo leaves for genetic transformation. Driven by the CaMV35S promoter, GbCYP701A6 can be efficiently expressed in ginkgo, thereby promoting the synthesis of terpene lactones. A virus-induced gene silencing vector pTRV2 targeting GbCYP701A6 was constructed and injected using the same method to achieve specific silencing of this gene, thus verifying its function in the opposite direction.

[0021] The application of the gene GbCYP701A6, which promotes the synthesis of ginkgolide lactones, or the protein, or the expression vector, or the host bacterium described in this invention, in the cultivation of ginkgo with high ginkgolide content.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0023] This invention marks the first time a novel gene, GbCYP701A6, has been cloned from Ginkgo biloba. Transplanting the GbCYP701A6 gene into Ginkgo biloba resulted in a significant increase in the content of terpenoid lactones in transgenic Ginkgo biloba leaves overexpressing the gene. In particular, overexpression of this gene significantly increased the content of ginkgolides A, B, C, and ginkgolide simultaneously. Furthermore, specific inhibition of this gene using virus-induced gene silencing technology significantly suppressed terpenoid lactone synthesis. This indicates that GbCYP701A6 is a key gene promoting terpenoid lactone synthesis in Ginkgo biloba. Therefore, regulating the expression of GbCYP701A6 has significant application value in improving the medicinal quality of Ginkgo biloba leaves.

[0024] Cloning and functional analysis of the GbCYP701A6 gene not only provides a direct theoretical basis for enhancing the synthesis and accumulation of Ginkgo terpenes using gene regulation technology, but also lays the foundation for its regulatory mechanism in the biosynthesis of Ginkgo terpene lactones. Furthermore, the findings of this invention can provide key gene targets and references for the bioengineering production of Ginkgo secondary metabolites, and have important reference value for research on the synthesis and regulation of terpenes in other gymnosperm trees. Simultaneously, the established Ginkgo intrinsic transient overexpression and gene silencing technology system overcomes the technical bottleneck of difficult Ginkgo genetic manipulation, providing an efficient research tool for gene function research in Ginkgo and other difficult-to-transform trees. This invention not only fills a key gap in the secondary metabolic pathway of Ginkgo and reveals the molecular basis for the formation of its unique medicinal components, but also provides important gene resources for increasing the yield of Ginkgo terpene lactones through synthetic biology and metabolic engineering technologies. Attached Figure Description

[0025] Figure 1 The images show the clone of the GbCYP701A6-p1305.4 vector (a), bacterial culture detection (b), and sequence alignment (c).

[0026] Figure 2 This is a schematic diagram of the structure of the plant overexpression vector p1305.4-Dawei;

[0027] Figure 3 The images show the cloning of the GbCYP701A6-pTRV2 vector (a), bacterial culture detection (b), and sequence alignment (c).

[0028] Figure 4 This is a schematic diagram of the structure of the virus-induced gene silencing vector pTRV2;

[0029] Figure 5 Phylogenetic tree analysis of GbCYP701A6 with CYP701A6 proteins from other species;

[0030] Figure 6 The expression level of GbCYP701A6-p1305.4 transgenic Ginkgo biloba leaves was detected.

[0031] Figure 7 The content of terpene lactones in GbCYP701A6-p1305.4 transgenic Ginkgo biloba leaves was detected.

[0032] Figure 8 The expression level of GbCYP701A6-pTRV2 transgenic Ginkgo biloba leaves was detected.

[0033] Figure 9 This study investigated the content of terpene lactones in GbCYP701A6-pTRV2 transgenic Ginkgo biloba leaves. Detailed Implementation

[0034] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0035] Example 1

[0036] Cloning the GbCYP701A6 gene

[0037] (1) Based on the Ginkgo genome and transcriptome data, the target DNA fragments used in the exoclast vectors (SEQ ID NO. 3 and 4) and silencing vectors (SEQ ID NO. 7 and 8) were amplified, respectively. The primers are shown below. The target gene was obtained by amplification using Ginkgo leaf cDNA template.

[0038]

[0039] (2) PCR amplification was performed using PrimeSTAR Max (Takara, Japan). The PCR system is as follows:

[0040]

[0041] Gently mix the above mixture, briefly centrifuge at low speed, and then place it in a standard PCR instrument. Set the following program:

[0042]

[0043] Electrophoresis: Remove the gene amplification product from the PCR instrument and spot an appropriate amount of the product onto a 1% agarose gel using an electrophoresis apparatus. After about 20 minutes, remove the gel and observe it using an imaging system to obtain the target fragment. Figure 1 a / Figure 3 a).

[0044] Example 2

[0045] Construction of GbCYP701A6 gene overexpression vector p1305.4 and silencing vector pTRV2

[0046] (1) In this experiment, TaKaRa QuickCut restriction enzyme (TaKaRa, Japan) was used to perform enzyme digestion reactions on p1305.4 vector, pTRV2 (TaKaRa, Japan) and GbCYP701A6 gene. The specific reaction system is as follows:

[0047]

[0048] After mixing all solutions in the system, the mixture was briefly centrifuged and incubated in a 37°C water bath for 30 min to stop the enzyme digestion reaction. The enzyme digestion bands were observed by agarose gel electrophoresis. Subsequently, the target gene and vector fragments were digested and recovered for subsequent vector ligation reactions.

[0049] (2) Following the instructions for TaKaRa T4 DNA Ligase (TaKaRa, Japan), the expression vector recovered after the enzyme digestion reaction was ligated with the target DNA fragment product recovered from the purification gel. The system is as follows:

[0050]

[0051] The solutions in the system were mixed in a microtube and reacted in a metal bath at 16°C for 5-6 h.

[0052] (4) Escherichia coli transformation

[0053] Following the instructions for TaKaRa E.coli DH5α Competent Cells, the ligated product was mixed with competent cells, and after ice bath, heat shock, and recovery, an appropriate amount was spread on LB plates, the plates were inverted, and cultured overnight at 37°C.

[0054] (5) Screening and sequencing analysis of positive clones

[0055] Single colonies were selected from the screening culture plate and inoculated into LB liquid medium. The culture was incubated overnight at 37°C and 200 rpm. The recombinant transformants were then directly detected by PCR using the overnight culture as a template.

[0056] Reaction system:

[0057]

[0058] Reaction procedure:

[0059]

[0060] Clones that tested positive for bacterial culture PCR ( Figure 1 b / Figure 3 b) The gene sequence of the overexpression vector p1305.4, as shown in SEQ ID NO. 1, is the full-length CDS sequence of the GbCYP701A6 gene, and was used for subsequent experiments. The amino acid sequence of the expressed protein is shown in SEQ ID NO. 2. The gene sequence of the virus-induced gene silencing vector pTRV2, as shown in SEQ ID NO. 5, is the specific 279bp CDS sequence of the target gene GbCYP701A6. The amino acid sequence of the expressed protein is shown in SEQ ID NO. 6.

[0061] PCR testing confirmed the successful construction of the GbCYP701A6 overexpression vector and the virus-induced gene silencing vector pTRV2. They were named p35S::GbCYP701A6 and pTRV2-GbCYP701A6, respectively. Figure 2 and Figure 4 As shown in the diagram. The constructed overexpression vector was initiated by the CaMV 35S strong promoter, with a poly(A) signal added to terminate transcription. The overexpression vector contained a kanamycin KanR prokaryotic resistance selection tag and a hygromycin HYG plant resistance selection tag, as well as a GFP green fluorescent protein tag and a GUS tag initiated by the 35S strong promoter. The constructed pTRV2 silencing vector also used the CaMV 35S strong promoter to initiate approximately 300 bp sequences specific to the RNA2 and GbCYP701A6 genes from the TRV strain ppk20, with a NOS-terminator assembled at the 3' end. The VIGS silencing vector contained a kanamycin KanR resistance selection tag, which can serve as a selection marker for transgenic Ginkgo biloba. Both expression vectors contained RB and LB T-DNA transfer repeat sequences, facilitating the integration of the gene expression framework and selection marker genes such as HYG and KanR into the chromosome of the Ginkgo biloba recipient cell.

[0062] (3) Transformation of Agrobacterium

[0063] Following the instructions for transformation with Shanghai Weidi GV3101 (Agrobacterium), the constructed p35S::GbCYP701A6 expression vector plasmid or pTRV2-GbCYP701A6 silencing vector was mixed with competent cells. The mixture was then subjected to the following steps: static incubation on ice for 5 min, rapid freezing in liquid nitrogen for 1 min, water bath at 37℃ for 3 min, and rapid ice bath for 2 min. 700 μL of liquid LB medium was added and cultured with shaking for 2 h. After centrifugation at 5000 rpm for 1 min, 100 μL of the supernatant was collected, gently mixed, and spread onto LB agar plates containing kanamycin and rifampin antibiotics. The plates were incubated upside down at 28℃ for 2-3 days. Single clones were picked from the plates, and an appropriate amount of LB liquid medium was added. The plates were incubated at 28℃ and 220 rpm for 48 h. PCR detection of positive clones was then performed. Figure 3 Agrobacterium was obtained containing either the p35S::GbCYP701A6 vector or the pTRV2-GbCYP701A6 vector.

[0064] Example 3

[0065] Evolutionary analysis of GbCYP701A6 protein

[0066] Protein sequences of the CYP701A subfamily from eight other species (Torreya grandis [TG3g02881], Pinustabuliformis [PtJG44780.1], Gnetum montanum [TnS000842589t08], Oryza sativa [Q5Z5R4], Salvia miltiorrhiza [A0A0G2RKY1], Arabidopsis thaliana [Q93ZB2], Populus trichocarpa [Potri.002G129700.1], Selaginella moellendorffii [EFJ15089]) were downloaded and extracted from Uniprot, Ensembl Plants databases, and a self-built genomic dataset in the laboratory. Phylogenetic analysis of the GbCYP701A6 protein sequences was performed using the MEGA7 method with a neighbor-joining approach. MEME was used to predict conserved motifs. Protein sequence analysis revealed that the CYP701A6 gene shares many conserved motifs between gymnosperms and angiosperms. Phylogenetic analysis showed that the Ginkgo CYP701A6 gene protein is closely related to the CYP701A6 genes of Torreya grandis and Pinus tabuliformis. Figure 5 ).

[0067] Example 4

[0068] Genetic transformation of the GbCYP701A6-p1305.4 gene

[0069] 1. Ginkgo leaf transformation

[0070] (1) Agrobacterium containing the 35S::GbCYP701A6 vector obtained in Example 2 was plated on LB agar plates. After incubation, single Agrobacterium colonies were picked from the LB agar plates and inoculated into 100 ml of LB liquid medium, and incubated at 28°C for 24 h until OD. 600 It is 0.5;

[0071] (2) Place the bacterial culture into a centrifuge tube, centrifuge at 25℃, 4000 rpm for 10 min, and then remove the supernatant;

[0072] (3) Add resuspension solution (100 mL MS liquid medium containing 100 μM acetylsyl syringone) to the centrifuge tube to resuspend the bottom cells and incubate at room temperature for 2 h;

[0073] (4) Use a sterile syringe (with removable needle) to draw up the bacterial solution and inject it into the back of the leaf until the bacterial solution submerges the entire leaf;

[0074] (5) The infected ginkgo leaves were cultured in the dark at 25°C for 1 day, then under light for 2 days. They were then taken out and quick-frozen in liquid nitrogen and stored in an ultra-low temperature freezer for subsequent determination of terpene lactone content.

[0075] 2. Detection of gene expression and determination of terpene lactone content in transgenic materials

[0076] (1) Real-time quantitative PCR was used to detect the expression of exogenous genes at the RNA level. Primer Premier 5.0 software was used to design fluorescent quantitative primers for GbCYP701A6. The forward primer was 5'-GCGGGAAAGCGAGCGTGTAC-3', and the reverse primer was 5'-AGCGGACGGTGTCAGCAATATCATC'. The internal control (Actin) forward primer was 5'-CTGCCAAGGCTGTAGGTAAGG-3', and the reverse primer was 5'-TCAGATTCCTCCTTGATGGCG'. The results showed that the expression level of GbCYP701A6 in the transgenic Ginkgo leaves obtained in step 1 was significantly increased (…). Figure 6 ).

[0077] (2) Detection of terpene lactone content

[0078] The content of terpene lactones in transgenic Ginkgo biloba leaves was determined. 0.15 g of dried Ginkgo biloba leaves were weighed, added to 1 mL of methanol solution, shaken thoroughly, and extracted by sonication for 30 minutes. The mixture was centrifuged at 12000 rpm for 5 minutes, and the supernatant was collected. 1 mL of methanol was added to the centrifuge tube, and vortexing was performed. Steps 3-5 were repeated twice. The supernatant collected from the three centrifugations was added to an acidic alumina column and eluted with 5 mL of methanol. The eluent was collected and placed in a fume hood, and the supernatant was purged using a nitrogen evaporator until the sample was completely evaporated. 1.00 mL of methanol was accurately added, vortexed, and the tube wall was washed clean. The solution was dissolved by sonication, and 1.00 mL of ddH2O was added, followed by vortexing. The solution was further dissolved by sonication, and 1 mL was filtered through a 0.22 μm filter membrane for analysis. The terpene lactone content was analyzed using high-performance liquid chromatography-refractive index detection (HPLC-RID). The instrument was an Agilent 1260 series high-performance liquid chromatography system equipped with a refractive index detector (RID). The UPLC chromatographic conditions were as follows: C18 column (3.0 x 150 mm 2.7 μm); flow rate 0.5 mL / min; column temperature 40℃. The results showed that the contents of four terpene lactones—ginkgolides A, B, C, and ginkgolide—were significantly increased in transgenic Ginkgo biloba leaves. Figure 7 These results indicate that the GbCYP701A6 gene is a key gene in terpene lactone synthesis.

[0079] Example 5

[0080] Genetic transformation of the GbCYP701A6-pTRV2 gene

[0081] 1. Ginkgo leaf transformation

[0082] (1) Agrobacterium containing the pTRV2-GbCYP701A6 vector obtained in Example 2 was plated on LB agar plates. After incubation, single Agrobacterium colonies were picked from the LB agar plates and inoculated into 100 ml of LB liquid medium, and incubated at 28°C for 24 h until OD. 600 It is 0.5-0.6;

[0083] (2) Place the bacterial culture into a centrifuge tube, centrifuge at 25℃, 4000 rpm for 10 min, and then remove the supernatant;

[0084] (3) Add resuspension solution (100 mL MS liquid medium containing 100 μM acetylsyl syringone) to the centrifuge tube to resuspend the bottom cells and incubate at room temperature for 2 h;

[0085] (4) Use a sterile syringe (with removable needle) to draw up the bacterial solution and inject it into the back of the leaf until the bacterial solution submerges the entire leaf;

[0086] (5) The infected ginkgo leaves were cultured in the dark at 25°C for 1 day, then under light for 2 days. They were then taken out and quick-frozen in liquid nitrogen and stored in an ultra-low temperature freezer for subsequent determination of terpene lactone content.

[0087] 2. Detection of gene expression and determination of terpene lactone content in transgenic materials

[0088] (1) Real-time quantitative PCR was used to detect the expression of exogenous genes at the RNA level. Primer primers for GbCYP701A6 were artificially designed using Primer Premier 5.0 software. The forward primer was 5'-GCGGGAAAGCGAGCGTGTAC-3', and the reverse primer was 5'-AGCGGACGGTGTCAGCAATATCATC'. The internal control (Actin) forward primer was 5'-CTGCCAAGGCTGTAGGTAAGG-3', and the reverse primer was 5'-TCAGATTCCTCCTTGATGGCG'. The expression level of GbCYP701A6 in the transgenic Ginkgo leaves obtained in step 1 was significantly reduced ( Figure 8 ).

[0089] (2) Detection of terpene lactone content

[0090] The content of terpene lactones in transgenic Ginkgo biloba leaves was determined. 0.15 g of dried Ginkgo biloba leaves were weighed, added to 1 mL of methanol solution, shaken thoroughly, and extracted by sonication for 30 minutes. The mixture was centrifuged at 12000 rpm for 5 minutes, and the supernatant was collected. 1 mL of methanol was added to the centrifuge tube, and vortexing was performed. Steps 3-5 were repeated twice. The supernatant collected from the three centrifugations was added to an acidic alumina column and eluted with 5 mL of methanol. The eluent was collected and placed in a fume hood, and the supernatant was purged using a nitrogen evaporator until the sample was completely evaporated. 1.00 mL of methanol was accurately added, vortexed, and the tube wall was washed clean. The solution was dissolved by sonication, and 1.00 mL of ddH2O was added, followed by vortexing. The solution was further dissolved by sonication, and 1 mL was filtered through a 0.22 μm filter membrane for analysis. The terpene lactone content was analyzed using high-performance liquid chromatography-refractive index detection (HPLC-RID). The instrument was an Agilent 1260 series high-performance liquid chromatography system equipped with a refractive index detector (RID). The UPLC chromatographic conditions were as follows: C18 column (3.0 x 150 mm 2.7 μm); flow rate 0.5 mL / min; column temperature 40℃. The results showed that the contents of four terpene lactones—ginkgolides A, B, C, and ginkgolide—were significantly reduced in transgenic Ginkgo biloba leaves. Figure 9 These results indicate that the GbCYP701A6 gene is a key gene in terpene lactone synthesis.

Claims

1. A gene GbCYP701A6 that promotes the synthesis of ginkgolide lactones, characterized in that, The nucleotide sequence of the gene GbCYP701A6 is shown in SEQ ID NO.

1.

2. A protein expressing the gene GbCYP701A6, which promotes the synthesis of ginkgolide lactones as described in claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. An expression vector containing the gene GbCYP701A6, which promotes the synthesis of ginkgolide lactones as described in claim 1.

4. The expression vector according to claim 3, characterized in that, The preferred primer pair for amplifying the gene GbCYP701A6 to construct the overexpression vector p1305.4 is SEQ ID NO.3:ATGACAAAGCTTCTGTTAGCCACTAT and SEQ ID NO.4:ATGGTTAGTTGCAGAGGATCTTCTG.

5. A host bacterium containing the gene GbCYP701A6 for promoting the synthesis of ginkgolide lactones as described in claim 1 or the expression vector as described in claim 3.

6. The use of the gene GbCYP701A6 for promoting the synthesis of ginkgolide lactones as described in claim 1, or the protein as described in claim 2, or the expression vector as described in claim 3, or the host bacterium as described in claim 5, in promoting the synthesis of ginkgolide lactones.

7. The application according to claim 6, characterized in that, The terpene lactone is any one or more of ginkgolide A, ginkgolide B, ginkgolide C, and ginkgolide.

8. The application according to claim 6, characterized in that, Application of GbCYP701A6 overexpression in Ginkgo biloba in promoting the synthesis of Ginkgo terpene lactones.

9. The application according to claim 6, characterized in that, The process of promoting the synthesis of ginkgo terpene lactones is as follows: using ginkgo leaves as material, the gene GbCYP701A6 is cloned and constructed into the overexpression vector p1305.4 to obtain a recombinant vector. The recombinant vector is transformed into Agrobacterium, and then Agrobacterium resuspension is injected into ginkgo leaves for indigenous genetic transformation. Under the drive of the promoter CaMV35S, GbCYP701A6 can be efficiently expressed in ginkgo, thereby promoting the synthesis of terpene lactones.

10. The application of the gene GbCYP701A6 for promoting the synthesis of ginkgolides as described in claim 1, or the protein as described in claim 2, or the expression vector as described in claim 3, or the host bacterium as described in claim 5, in the cultivation of ginkgo with high ginkgolide content.