Osrdh mutant and application thereof in improving rice quality

Abstract

The invention discloses an Osrdh mutant and application of the Osrdh mutant in improving rice quality. The Osrdh mutant is a homozygous mutant, comprises an Osrdh-1 mutant, an Osrdh-2 mutant and an Osrdh-3 mutant, and is a function loss type mutant which targets a first exon of a rice OsRDH gene through a CRISPR / Cas9 gene editing technology and is subjected to nucleotide deletion at a target site. Compared with wild type rice, the Osrdh homozygous mutant shows the following synergistically improved rice quality characters: the grain length is obviously increased, the chalkiness area and the chalkiness degree are obviously reduced, endosperm starch grains are more compactly arranged, and the rice appearance quality is obviously improved; the head rice rate is remarkably improved, and the rice processing quality is remarkably improved; the amylose content is obviously reduced, and the cooking taste quality of the rice is obviously improved. The invention discloses a new function of the OsRDH gene in rice quality formation for the first time, provides an important gene resource capable of simultaneously and positively improving the appearance quality, the processing quality and the cooking taste quality of rice and a mutant material of the important gene resource, and has extremely high application value in high-quality rice molecular breeding.

Description

Technical Field

[0001] This invention belongs to the fields of agricultural biotechnology and plant genetics and breeding, specifically involving Osrdh Mutants and their application in improving rice quality, especially in enhancing rice appearance, processing quality and cooking taste. Background Technology

[0002] With economic and social development and the continuous improvement of people's living standards, consumers have increasingly higher requirements for rice quality. Rice quality generally includes appearance quality, nutritional quality, processing quality, and cooking and eating quality. The appearance quality of rice is mainly determined by grain size or shape, chalkiness, and translucency. The processing quality of rice is mainly measured by three indicators: brown rice percentage (%), milled rice percentage (%), and head rice percentage (%). Cooking and eating quality refers to the sensory and physicochemical properties of rice during cooking, typically including amylose content, taste value (TV), gel consistency (GC), and gelatinization temperature (GT). Cooking and eating quality is an important indicator for measuring rice quality and is one of the quality traits that consumers are most concerned about.

[0003] Retinol dehydrogenase (RDH) is a core enzyme in vitamin A metabolism, catalyzing a cascade reaction from retinol to retinal and then to retinoic acid. The resulting retinoic acid acts as a signaling molecule, regulating biological processes such as energy metabolism, fat synthesis, breakdown and transport, and protein synthesis and modification. In plants, RDH isoenzymes (such as Arabidopsis thaliana AtSDR1) catalyze the redox reaction of carotenoid derivatives (such as β-ionone) to generate plant-specific retinal analogs, which in turn regulate reactive oxygen species (ROS) and plant hormone levels. Notably, the plant RDH metabolic network and hormone signaling exhibit cross-regulation. RDH regulates ROS levels and antioxidant activity through its metabolites, while simultaneously influencing the biosynthesis and signal transduction of ABA and IAA, thereby synergistically regulating cell growth and differentiation. Therefore, RDH is a key enzyme in the metabolism of retinol and vitamin A, playing a crucial role in cell growth and differentiation.

[0004] OsRDH It is unclear whether it participates in biological processes such as rice growth and development, and whether it affects rice quality. Summary of the Invention

[0005] The purpose of this invention is to provide a new technical solution that can simultaneously and effectively improve several important quality traits of rice (appearance, processing, and cooking taste). Specifically, it provides... Osrdh Mutants and their application in improving rice quality.

[0006] The above objectives are achieved through the following technical solutions: A sort of Osrdh mutant, the mutant OsRDH A nucleotide deletion mutation in the first exon of the gene leads to the aforementioned OsRDH The mutant exhibits loss of gene function and, compared to wild-type rice, possesses at least one of the following traits: increased grain length, decreased chalky area, decreased chalkiness, increased head rice yield, and decreased amylose content.

[0007] In some implementations, the Osrdh Mutants include Osrdh-1 mutants Osrdh-2 mutants Osrdh-3 Mutants, among which, Osrdh-1 The nucleotide sequence of the mutant is shown in SEQ ID NO: 3. Osrdh-2 The nucleotide sequence of the mutant is shown in SEQ ID NO: 4. Osrdh-3 The nucleotide sequence of the mutant is shown in SEQ ID NO: 5.

[0008] In some implementations, the Osrdh Mutants are created through the following steps: design OsRDH The target site was induced by CRISPR / Cas9 gene editing technology to fuse sgRNA with Cas9 protein. OsRDH Specific splicing of a PAM site in the first exon to construct OsRDH The gene-editing expression vector pYLCRISPR / Cas9-MH (B) was obtained through Agrobacterium-mediated genetic transformation. OsRDH Gene-edited plants were identified and isolated through DNA sequencing.

[0009] Including the above Osrdh Mutant rice plants, tissues, cells, or seeds.

[0010] The Osrdh The application of mutants in improving rice quality includes improving rice appearance quality, improving rice processing quality, improving rice cooking and eating quality, and / or improving rice germplasm resources.

[0011] In some embodiments, the improved rice appearance quality is manifested as: increased grain length, and / or, reduced chalky area in the endosperm, and / or, reduced chalkiness in the endosperm.

[0012] In some embodiments, the improved rice processing quality is manifested in an increased head rice yield.

[0013] In some embodiments, the improved rice cooking and eating quality is manifested by a reduction in amylose content.

[0014] In some embodiments, the rice germplasm resource improvement includes treatment with ABA or GA to promote... Osrdh Mutant seed germination.

[0015] A method for improving rice quality includes the following steps: The Osrdh Mutants are introduced into target rice varieties through hybridization, backcrossing, or gene editing techniques, and rice lines carrying homozygous mutations are screened to improve rice quality.

[0016] Technical effect This invention clarifies for the first time OsRDH Genes are key negative regulators of the overall quality of rice, and the loss of their function can simultaneously improve multiple important quality traits. Osrdh The mutant grains exhibited significant changes in the content of various nutrients, which in turn had a major impact on the appearance, processing quality, and nutritional quality of the rice. Furthermore, Osrdh It also participates in regulating the expression of genes related to GA and abscisic acid metabolism, thereby affecting rice seed germination and taproot growth. Therefore, OsRDH It has a significant impact on various rice quality traits and participates in biological processes such as rice seed germination and taproot growth, providing important clues for molecular design breeding of high-quality rice varieties.

[0017] Compared to wild-type rice, Osrdh The homozygous mutant exhibits the following synergistically improved rice quality traits: significantly increased grain length, significantly reduced chalky area and chalkiness, denser endosperm starch granule arrangement, and significantly improved rice appearance quality; significantly increased head rice yield and significantly improved rice processing quality; and significantly reduced amylose content and significantly improved rice cooking and eating quality. This invention discloses for the first time... OsRDH The novel function of genes in rice quality formation provides important gene resources and mutant materials that can simultaneously and positively improve the appearance quality, processing quality and cooking taste quality of rice, and have extremely high application value in molecular breeding of high-quality rice. Attached Figure Description

[0018] Figure 1 Example 1 is shown Osrdh The creation and structure of mutants. A: Osrdh Mutant type identification; B: OsRDH A schematic diagram illustrating the changes in amino acids caused by mutations.

[0019] Figure 2 Example 2 is shown Osrdh Results of the analysis of the mutant's appearance and quality traits. A: Osrdh Mutant seed type, scale bar: 1 cm; B: Osrdh Statistical analysis of mutant seed length; C: Osrdh Phenotypic of mature seed glume of mutant, scale bar: 200 μm; D: Osrdh Statistical analysis of longitudinal cell number in mutant glumes cells in vitro; E: Osrdh Analysis of dynamic changes in fresh weight during the grain-filling period of mutants; F: Osrdh Analysis of dynamic changes in dry weight of mutants during the grouting period; G: Osrdh Seed hulling phenotypes of mutant seeds at the grain-filling stage (DAP) at 5, 10, 15, 20, and 25 days after flowering. Scale bar: 1 mm; H: Osrdh Statistical analysis of chalky area in mutant rice; I: Osrdh Statistical analysis of chalkiness in mutant rice; J: Osrdh Optical microscopy and scanning electron microscopy were used to observe the chalky parts of the mutant rice and the starch granules of the rice.

[0020] Figure 3 Example 3 is shown Osrdh Results of the detection and analysis of the appearance quality traits of the mutant. A: Osrdh Mutant seed kernel width phenotype, scale bar: 1 cm; B: Osrdh Statistical analysis of seed width in mutants; C: Osrdh Statistical analysis of seed thickness in mutants; D: Osrdh Statistical analysis of transverse length of outer glume cells in mutant seeds; E: Osrdh Statistical analysis of chalkiness rate in mutant rice. Error is the standard error of the mean (SEM).

[0021] Figure 4 Example 3 is shown Osrdh Results of analysis on the cooking taste and processing quality traits of mutant rice. A: Osrdh Analysis of amylose content in mutant rice; B: Osrdh Analysis of the gel consistency of mutant rice; C: Osrdh Analysis of gelatinization temperature of mutant rice; D: Osrdh Statistics on head rice yield of mutant rice; E: Osrdh Statistics on the milling rate of mutant rice; F: Osrdh Statistics on the brown rice rate of mutant rice.

[0022] Figure 5 The following is an example of normal conditions shown in Example 4. Osrdh Statistical results of seed germination in mutant strains. A: Osrdh Phenotypic characteristics of seed germination and growth in mutants, scale bar: 1 cm; B: Osrdh Statistical analysis of seed germination rate of mutants; C: Osrdh Time (days) required for 50% germination of mutant seeds.

[0023] Figure 6 The ABA and GA treatment conditions in Example 4 are shown. Osrdh Analysis results of germination and related gene expression in mutant seeds. A: ABA treatment conditions. Osrdh Seed germination and growth of mutants, scale bar: 1 cm; B: GA treatment conditions Osrdh Seed germination and growth of mutants, scale bar: 1 cm; C: ABA treatment conditions Osrdh Statistical analysis of seed germination rate of mutants; D: ABA treatment conditions Osrdh Time required for 50% germination of mutant seeds (days); E: GA treatment conditions Osrdh Statistical analysis of seed germination rate of mutants; F: GA treatment conditions Osrdh Time required for 50% germination of mutant seeds (days); G: Osrdh Mutant seeds showed expression of genes related to GA synthesis and ABA degradation 5 days after normal treatment; H: Osrdh Mutant seeds treated with ABA for 5 days showed increased expression of genes related to GA synthesis and ABA degradation; I: Osrdh Mutant seeds treated with GA for 5 days showed expression of genes related to GA synthesis and ABA degradation.

[0024] Figure 7 The IAA treatment conditions in Example 4 are shown. Osrdh Germination results of mutant seeds. A: Osrdh Phenotypic characteristics of seed germination and growth in mutants, scale bar: 1 cm; B: Osrdh Statistical analysis of seed germination rate of mutants; C: Osrdh Time (days) required for 50% germination of mutant seeds.

[0025] Figure 8 The rice in Example 5 is shown. Osrdh Statistical analysis results of root growth during the mutant seedling stage. A: Osrdh Statistical analysis of taproot length 7 days after seed germination in mutants; B: Osrdh C: Root length phenotype of mutant seeds 7 days after germination; Osrdh Statistical analysis of total root count of mutants; D: Osrdh Statistical analysis of stem length 7 days after seed germination of mutants; E: Osrdh Statistical analysis of lateral root length 7 days after mutant seed germination. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. The following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0027] Example 1: Osrdh Creation and identification of mutants Using rice ZH11 as the genetic background, targeting OsRDH Gene (SEQ ID NO: 1) designed target sites, that is, targeting OsRDH A specific single guide RNA (sgRNA, SEQ ID NO: 2: AAGTACACCTGCTGGGTTCCCC) was designed for the first exon of the gene. Using CRISPR / Cas9 gene editing technology, the sgRNA was induced to fuse with the Cas9 protein. OsRDH Specific splicing is performed at a PAM site in the first exon of the gene. Construction OsRDH The gene-editing expression vector pYLCRISPR / Cas9-MH (B) was used to create a targeted knockout gene based on CRISPR / Cas9 gene editing technology. OsRDH The mutant was obtained through Agrobacterium-mediated genetic transformation. OsRDH 48 gene-edited plants, of which Osrdh Forty-two mutant strains were isolated using PCR and Sanger sequencing techniques after sequencing and T1 generation isolation detection. Osrdh Homozygous mutants. Among them, Primer sequences for mutants (gene editing): OsRDH-sgRNA-U3F: 5'-GGCAAGTACCTGCTGGGTTCCCC-3' (SEQ ID NO: 6) OsRDH-sgRNA-U3R: 5'-AAACGGGGAACCCAGCAGGTACT-3' (SEQ ID NO: 7) The primers for mutant sequencing (identification) are as follows: OsRDH-F: 5'-GGTCGCACAGTTATGGTCAC-3' (SEQ ID NO: 8) OsRDH-R: 5'-GGAGATCAGTGAGAGTGACG-3' (SEQ ID NO: 9) DNA sequencing analysis revealed OsrdhThere are three types of mutations in the mutant: Osrdh-1 Mutant (deleted 1 base, -1 bp, SEQ ID NO: 3) Osrdh-2 Mutant (deleted 4 bases, -4 bp, SEQ ID NO: 4) Osrdh -3 Mutant (19 bases missing, -19 bp, SEQ ID NO: 5). Osrdh-1 and Osrdh-3 A base deletion at exon 1 of the target sequence results in a frameshift mutation, while Osrdh-2 Premature termination due to base deletion ( Figure 1 A-1B). Among them: Osrdh-1 Mutants are Osrdh The first type of mutation involves the deletion of a C base at position 35 of ATG, which causes a subsequent frameshift mutation. Osrdh-2 Mutants are Osrdh The second type of mutation involves a deletion of 4 bases at position 29 of ATG, which causes the TGA to terminate prematurely at position 422 due to a frameshift mutation. Osrdh-3 Mutants are Osrdh The third type of mutation involves a 19bp deletion at position 33 of ATG, which causes a subsequent frameshift mutation.

[0028] Example 2 Will Osrdh Homozygous mutants and their wild-type controls (WT, ZH11) were planted in a standard experimental field (Xinyang Normal University Experimental Base) with a planting density of 16.5 cm between plants within a row and 26 cm between rows. The paddy fields were managed according to local agricultural practices. Before rice quality testing, the harvested seeds were naturally dried and stored at room temperature for at least 3 months. Rice quality was tested using fully filled grains.

[0029] right Osrdh The grain shape of the mutant seeds was examined. The results showed... Osrdh The mutant seeds were significantly longer, while the width and thickness remained largely unchanged. Figure 2 A-2B, Figure 3 A-3C).

[0030] To clarify Osrdh The reason for the change in seed length in mutant seeds was observed by scanning electron microscopy of the seed husks. Figure 2 C). The results showed that, Osrdh The mutant cells showed a significantly increased number of glumes, while the transverse length of the glumes did not change significantly. Figure 2D, Figure 3 D), that is OsRDH Mutations can promote an increase in the number of cells, thereby increasing the length of the grain.

[0031] In order to further Osrdh The grain shape of the mutant seeds was analyzed; in this embodiment, it was detected that... Osrdh Fresh and dry weight of seeds after shelling at the grain-filling stage (DAP) at 5, 10, 15, 20, and 25 days post-flowering. Results analysis showed that... Osrdh The mutant exhibited longer grains, and both fresh and dry weights were significantly higher than the wild type. Figure 2 E-2G).

[0032] Subsequently Osrdh The chalky white trait of the mutant rice was tested, and the results showed: Osrdh The chalky area and chalkiness of the mutant rice were significantly reduced. Figure 2 H-2I), there was no significant difference in chalkiness rate ( Figure 3 E).

[0033] right Osrdh Further observation of the chalky white portion of the mutant rice revealed that, under a regular optical microscope, Osrdh The mutant exhibits a smaller chalky area, primarily due to a reduction in the chalky area of ​​the cardiac leukocyte; scanning electron microscopy revealed... Osrdh The mutant starch grains exhibit a more densely packed polygonal structure, similar in size, and more tightly arranged. Figure 2 J, scale: 1 mm; scale: from left to right: 1 mm, 10 μm, 20 μm and 50 μm. Significant differences were determined based on a two-tailed t-test, “**” indicates P≤0.01, “*” indicates P≤0.05, and the error is the standard error of the mean (SEM)).

[0034] therefore, OsRDH Mutations can significantly reduce the chalkiness trait in rice and promote grain lengthening, which is beneficial for improving the appearance quality of rice.

[0035] Example 3 right OsrdhThe cooking and processing quality of the mutant rice was analyzed. The gelatinization temperature of the rice was determined using the alkali digestion method, and the gel consistency of the polished rice was determined according to the method specified in the National Standard of the People's Republic of China (GB / T17891-1999, High-Quality Rice). The amylose content was determined using a near-infrared cereal analyzer (INFRAEC Nova). All samples were tested in triplicate. Significant differences were assessed using a two-tailed t-test. "***" indicates P ≤ 0.001, "**" indicates P ≤ 0.01, and "*" indicates P ≤ 0.05. The error is the standard error of the mean (SEM).

[0036] turn out Osrdh The amylose content of the mutant rice was significantly reduced, while the gel consistency and gelatinization temperature remained largely unchanged. (See appendix) Figure 4 (A-4C) Osrdh The head rice yield of the mutant rice was significantly increased, while the brown rice yield and milled rice yield did not change significantly (see appendix). Figure 4 D-4F). The above results indicate that OsRDH Mutations can increase the head rice yield of rice, thereby improving its processing quality; at the same time, they can reduce the amylose content in rice, which helps to improve the cooking and eating quality of rice.

[0037] Example 4 because Osrdh The levels of plant hormones in the mutants changed significantly, and the levels of hormones such as ABA and GA3 were closely related to rice seed germination. To investigate... OsRDH Does mutation affect seed germination? This example first examines whether mutation affects seed germination. Osrdh The mutant was subjected to a normal seed germination test. Rice seeds were disinfected with 0.1% mercuric chloride for 45 min, then rinsed three times each with tap water and distilled water, and placed in a 25℃ incubator for 1 day to germinate. Clean 12*12cm petri dishes were numbered. Normal germination tests and treatment tests with 5 μM hormones IAA (indole-3-acetic acid), ABA (abscisic acid), and GA3 (gibberellin) were conducted. A piece of filter paper the same size as the bottom of the petri dish was placed in each dish. Sixteen germinated rice seeds were placed neatly in the dish using tweezers, with the sprout tip facing upwards and the embryo facing the same side. The dishes were covered and incubated in the dark at room temperature for 7 days. Seed germination was recorded daily, and the growth of rice seedlings was observed and photographed. Three replicates were performed.

[0038] turn out, Osrdh The seed germination rate and the time to reach 50% seed germination were not significantly different between the mutant and the wild type (see appendix). Figure 5 (A-5C). However, under the conditions of treatment with 0.5 μM ABA and 5 μM GA respectively, Osrdh The germination rate of the mutant was significantly increased, and the time to reach 50% seed germination was significantly shortened. Figure 6 (A-6F). However, under 5 μM IAA treatment conditions, it does not affect... Osrdh Germination of mutant seeds (with appendix) Figure 7 A-7C).

[0039] To investigate the relationship between the levels of hormones ABA and GA and the germination of Osrdh mutant seeds, this study examined the expression levels of genes related to GA synthesis and ABA catabolism in seeds that had undergone normal 5-day imbibition and seeds that had undergone 5-day imbibition with ABA or GA treatment, respectively. The results showed that compared to seeds that had undergone normal 5-day imbibition, seeds treated with ABA or GA for 5 days showed significantly higher expression levels of genes related to GA synthesis and catabolism. OsGA20ox1 , OsGA20ox2 , OsGA20ox3 and KAO ) and ABA catabolism-related genes ( OsABAox1 , OsABAox2 and OsABAox3 Both were significantly upregulated in the Osrdh mutant, while KAO Genes under normal treatment and GA treatment Osrdh All mutants showed significant upregulation, while no significant change was observed under ABA treatment. Figure 6 G-6I). The above results indicate that under ABA or GA hormone treatment, it helps to improve... Osrdh The mutant seeds express genes related to GA synthesis and ABA catabolism, thereby promoting seed germination.

[0040] Example 5 After peeling and disinfecting the rice seeds, place them in 50 mL centrifuge tubes and disinfect with 75% ethanol for 2-3 minutes. Discard the ethanol and soak the seeds in 0.15% mercuric chloride for 15 minutes, shaking the centrifuge tubes several times during this period. Discard the mercuric chloride and rinse the seeds 10-12 times with sterile distilled water in a clean bench to remove as much mercuric chloride as possible from the seed surface. Inoculate the treated seeds into 1 / 2 MS medium and incubate them in a 28℃ constant temperature and light incubator for seven days. Observe the growth of rice seedlings.

[0041] In Arabidopsis thaliana, retinol dehydrogenase affects root development. To investigate... OsRDH To investigate whether mutations affect root growth and development in rice, this example tested the effects during the rice seedling stage (7 days after seed germination). Osrdh The mutant's taproot length, lateral root length, total number of roots, and stem length were measured. The results showed that: Osrdh The mutant showed a significant increase in taproot length during the seedling stage. Figure 8 A-8B); and OsrdhThere were no significant differences in the total number of roots, stem length, and lateral root length among the mutant plants. Figure 8 C-8E). The above results indicate that OsRDH Mutations can help promote the growth of the taproot in rice.

[0042] In summary, this invention is the first to elucidate... OsRDH The key role of genes in regulating the overall quality of rice, and the provision of loss-of-function mutants ( Osrdh-1 mutants Osrdh-2 mutants and Osrdh-3 The specific application of mutants in improving the appearance, processing, and cooking quality of rice. This provides new genetic resources and a clear technical path for molecular design breeding for rice quality improvement.

Claims

1. A kind Osrdh mutant, the mutant OsRDH A nucleotide deletion mutation in the first exon of the gene leads to the aforementioned OsRDH The mutant exhibits loss of gene function and, compared to wild-type rice, possesses at least one of the following traits: increased grain length, decreased chalky area, decreased chalkiness, increased head rice yield, and decreased amylose content.

2. The method according to claim 1 Osrdh Mutant, characterized by, The Osrdh Mutants include Osrdh-1 mutants Osrdh-2 mutants Osrdh-3 mutants, among which, Osrdh-1 The nucleotide sequence of the mutant is shown in SEQ ID NO:

3. Osrdh-2 The nucleotide sequence of the mutant is shown in SEQ ID NO:

4. Osrdh-3 The nucleotide sequence of the mutant is shown in SEQ ID NO:

5.

3. As described in claim 1 or 2 Osrdh Mutant, characterized by, The Osrdh Mutants are created through the following steps: design OsRDH The target site was induced by CRISPR / Cas9 gene editing technology to fuse sgRNA with Cas9 protein. OsRDH Specific splicing of a PAM site in the first exon to construct OsRDH The gene-editing expression vector pYLCRISPR / Cas9-MH (B) was obtained through Agrobacterium-mediated genetic transformation. OsRDH Gene-edited plants are identified and isolated through DNA sequencing.

4. The product comprising any one of claims 1-3 Osrdh The mutant rice plant, tissue, cell or seed.

5. The claim 1-3 Osrdh The application of mutants in improving rice quality includes improving rice appearance quality, improving rice processing quality, improving rice cooking and eating quality, and / or improving rice germplasm resources.

6. The application according to claim 5, wherein, The improved rice appearance quality is characterized by: increased grain length, and / or reduced chalky area in the endosperm, and / or reduced chalkiness in the endosperm, and denser arrangement of starch granules in the rice.

7. The application according to claim 5, wherein, The improved rice processing quality is characterized by an increased head rice yield.

8. The application according to claim 5, wherein, The steamed and cooked food quality is characterized by a decrease in the content of amylose in the rice.

9. The application according to claim 5, wherein, The rice germplasm resource improvement includes the use of ABA or GA treatment to promote... Osrdh Mutant seed germination.

10. A method for improving rice quality, comprising the following steps: Any one of claims 1-3 Osrdh Mutants are introduced into target rice varieties through hybridization, backcrossing, or gene editing techniques, and rice lines carrying homozygous mutations are screened to improve rice quality.

Images