D-lactic dehydrogenase, engineering strain containing D-lactic dehydrogenase and construction and application of D-lactic dehydrogenase

Abstract

The invention provides D-lactic dehydrogenase, an engineering strain containing the D-lactic dehydrogenase as well as construction and application of the D-lactic dehydrogenase. The invention discloses a d-lactic dehydrogenase (d-lactic dehydrogenase), which has unique properties and is derived from thermodesulfurization bacillus, and the d-lactic dehydrogenase has very good thermophilic property and thermal stability. The invention further discloses a preparation method of the d-lactic dehydrogenase. By utilizing the d-lactic acid dehydrogenase and the genetic engineering modification method, a fermentation product of the modified bacillus licheniformis is redirected from naturally produced 2, 3-butanediol to high-yield optically pure d-lactic acid, and the optical purity of the produced d-lactic acid reaches 99.9%; raw materials used for fermentation are low in price, and the fermentation state is between anaerobic fermentation and micro-aerobic fermentation. The method for producing d-lactic acid through high-temperature fermentation can save the cost and improve the production efficiency, and has a wide industrial application prospect.

Description

[0001] This application is a divisional application of the following application: Application date: January 25, 2017; Application number: 201710056240.7; Invention title: "A D-lactic acid dehydrogenase, an engineered strain containing the enzyme, and its construction and application". Technical Field

[0002] This invention relates to the field of genetic engineering, specifically to a D-lactic acid dehydrogenase, the construction of a genetically engineered Bacillus bacterium containing the enzyme, and its application in the production of D-lactic acid. Background Technology

[0003] Lactic acid is an important industrial raw material with applications in pharmaceuticals, food, cosmetics, and petrochemicals. In recent years, lactic acid has also been used as a monomer to synthesize polylactic acid (PLA), a high-strength biodegradable plastic. Traditionally, PLA is polymerized from highly optically pure L-lactic acid. However, using a mixture of L- and D-lactic acid can significantly improve the mechanical properties, thermal stability, and hydrolysis resistance of PLA products, thus greatly stimulating market demand for D-lactic acid. Although lactic acid can be synthesized from petroleum, the synthesized lactic acid is a mixture of two isomers, unsuitable for PLA production. The highly optically pure L- and D-lactic acid required for PLA production can only be obtained through microbial fermentation, leading many researchers to explore the use of microbial fermentation to produce D-lactic acid.

[0004] High-temperature fermentation offers advantages such as minimizing contamination risks, increasing feed conversion rates, and reducing heating costs. To date, the high-temperature production of optically pure L-lactic acid has been extensively studied, significantly contributing to its commercialization. As for D-lactic acid, its high-temperature fermentation production has long been a desired goal, but reports on thermophilic D-lactic acid production are scarce, and the reported concentrations, production rates, and rich culture medium compositions are unsuitable for industrial-scale production. Therefore, it is essential to develop a low-cost, robust microbial platform for high-temperature, high-yield D-lactic acid production.

[0005] Nicotinamide adenine dinucleotide (NADH)-dependent d-lactate dehydrogenase is a key enzyme in the microbial synthesis of d-lactate. However, most naturally occurring d-lactate dehydrogenases are heat-labile, which is one of the main bottlenecks in the high-temperature production of d-lactate by microorganisms. There are reports of in vitro assays for *Lactobacillus plantarum* (...) Lactobacillus plantarumThe activity of d-lactate dehydrogenase in the above-reported strains showed that the enzyme had high activity at 42°C, but was completely inactivated after incubation at 50°C for 3 minutes. In contrast, the l-lactate dehydrogenase in the same strain retained 94% of its activity after treatment with the same method. Other in vivo experiments also indicated that d-lactate dehydrogenase is easily inactivated under high-temperature conditions. In summary, the low activity, or extremely poor thermostability, of the d-lactate dehydrogenase in the above-reported strains hinders their production of d-lactate under high-temperature conditions. Finding a thermostable d-lactate dehydrogenase is an important task for achieving efficient high-temperature d-lactate production.

[0006] Thermoresistant Bacillus licheniformis ( Bacillus licheniformis ATCC 14580 is a facultative anaerobic, Gram-positive, endospore-forming bacterium. It possesses several potential advantages as a microbial fermentation platform: 1) it can utilize various pentose and hexose sugars; 2) it has a relatively fast cell growth rate, thus shortening the fermentation cycle; 3) it can be genetically manipulated; and 4) it is a "generally considered safe" strain by the Food and Drug Administration. These advantages suggest that strain ATCC 14580 could be an ideal platform strain. Currently, this strain has been proven to be suitable for the high-temperature fermentation production of 2,3-butanediol.

[0007] Therefore, those skilled in the art are dedicated to developing a high-temperature, high-yield engineered strain of d-lactic acid using Bacillus licheniformis ATCC 14580 as the starting strain, as well as its preparation and application. Summary of the Invention

[0008] To address the shortcomings of existing technologies, such as the poor thermostability of most naturally occurring d-lactic acid dehydrogenases, high production costs of thermophilic d-lactic acid production methods, and unsuitability of d-lactic acid concentration and production rate for industrial-scale production, this invention provides a high-temperature, high-yield engineered strain of d-lactic acid, along with its preparation and application. This invention discloses a strain with unique properties from the genus *Thermodesulfurobacterium* (…). Thermodesulfatator indicus The d-lactic acid dehydrogenase of *Bacillus licheniformis* exhibits excellent thermophilicity and thermal stability. After optimizing the use of *E. coli* codons for this enzyme, and utilizing the optimized enzyme and genetic engineering methods, the fermentation product of the modified *Bacillus licheniformis* was redirected from the natural production of 2,3-butanediol to a high-yield optically pure d-lactic acid.

[0009] One aspect of the present invention provides a d-lactate dehydrogenase. In one specific embodiment, the d-lactate dehydrogenase has one of the following amino acid sequences: 1) The amino acid sequence shown in SEQ ID No. 1; 2) An amino acid sequence derived from the amino acid sequence shown in SEQ ID No. 1 by substitution, deletion, insertion or addition of one or more amino acid residues, and the resulting protein has d-lactate dehydrogenase activity. 3) The amino acid sequence shown in SEQ ID No. 1, with conserved substitutions; 4) Contains an amino acid sequence that has at least 80% homology with the amino acid sequence shown in SEQ ID No. 1.

[0010] Furthermore, the substitution, deletion, insertion, or addition of this amino acid residue occurs outside the functional domain, which includes the enzyme catalytic site, ligand binding site, and NAD binding site of d-lactate dehydrogenase.

[0011] Furthermore, based on relative positions, the key amino acids at the enzyme catalytic site are Arg at position 229, Glu at position 258, and His at position 290; the key amino acids at the ligand binding site are Ser, Ala, and Gly at positions 75-77, Tyr at position 99, Arg at position 229, His at position 290, and Phe at position 293. The key amino acids for the NAD binding site are: Tyr at position 99, Ile at position 104, Gly at position 150, Gly, Lys, Ile, and Gly at positions 152-155, Tyr, Asp, and Pro at positions 172-174, His, Cys, Pro, and Leu at positions 199-202, Asn at position 206, Met at position 209, Thr, Ala, and Arg at positions 227-229, Asp and Val at positions 253-254, His at position 290, and Ala and Phe at positions 292-293.

[0012] Another aspect of the invention provides a nucleotide sequence. In one specific embodiment, the nucleotide sequence encodes the d-lactate dehydrogenase as described in claim 1.

[0013] Furthermore, the nucleotide sequence has one of the following nucleotide sequences: 1) The nucleotide sequence shown in SEQ ID No. 2; 2) The nucleotide sequence shown in SEQ ID No. 3; 3) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3; 4) A nucleotide sequence that hybridizes with the complementary strand of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3 under highly stringent conditions.

[0014] Another aspect of the invention provides the use of the d-lactic acid dehydrogenase as described above or the nucleotide sequence as described above in the production of d-lactic acid.

[0015] Another aspect of the present invention provides a genetically engineered strain. In one specific embodiment, the genetically engineered strain has the d-lactate dehydrogenase described above or the d-lactate dehydrogenase encoded by the nucleotide sequence described above.

[0016] Furthermore, the pathway for pyruvate to synthesize L-lactic acid and the pathway for pyruvate to synthesize 2,3-butanediol were blocked in this genetically engineered bacterium.

[0017] Preferably, the pathway for pyruvate to synthesize L-lactic acid is blocked by the inactivation or deletion of the L-lactic acid dehydrogenase gene; the pathway for pyruvate to synthesize 2,3-butanediol is blocked by the inactivation or deletion of one or both of the acetolactate synthase gene and the acetolactate decarboxylase gene.

[0018] Preferably, one or more of the pathways in the genetically engineered bacteria for the synthesis of formic acid from pyruvate, the synthesis of acetic acid from pyruvate, and the synthesis of ethanol from pyruvate are blocked.

[0019] Preferably, the pathway for the synthesis of formic acid from pyruvate is blocked by the inactivation or deletion of one or both of the pyruvate-formate lyase gene and the pyruvate-formate lyase activator gene; the pathway for the synthesis of acetic acid from pyruvate is blocked by the inactivation or deletion of one or both of the pyruvate dehydrogenase gene and the acetate kinase gene; and the pathway for the synthesis of ethanol from pyruvate is blocked by the inactivation or deletion of one or both of the pyruvate dehydrogenase gene and the alcohol dehydrogenase gene.

[0020] Preferably, the original d-lactate dehydrogenase gene in the genetically engineered strain is inactivated or deleted.

[0021] Furthermore, the starting bacteria of this genetically engineered strain are thermophilic bacteria.

[0022] Furthermore, the starting bacteria of this genetically engineered strain is Bacillus.

[0023] Preferably, the Bacillus is selected from Bacillus licheniformis, Bacillus coagulans, Bacillus subtilis, Bacillus liquefyingus, Bacillus pumilus, Bacillus circulans, and Bacillus thiamine dehydrogenase.

[0024] Preferably, the restriction modification system in the starting bacteria is inactivated or knocked out.

[0025] Preferably, the starting bacteria is Bacillus licheniformis (B. licheniformis) Bacillus licheniformis ATCC 14580 Δ hsdR1ΔhsdR2 Double mutant strain MW3.

[0026] Furthermore, the promoter of the gene encoding d-lactic acid dehydrogenase was modified into a constitutive promoter.

[0027] Preferably, the constitutive promoter is the promoter P of α-acetolactate synthase from Bacillus licheniformis ATCC 14580. als P in plasmid pMMPc c Promoter, Bacillus subtilis ( B. subtilis P in ) 43 The promoter or the promoter P of L-lactate dehydrogenase of Bacillus licheniformis ATCC 14580 ldh .

[0028] More preferably, the constitutive promoter is the promoter P of α-acetolactate synthase from Bacillus licheniformis ATCC 14580. als .

[0029] Furthermore, this genetically engineered strain is Bacillus licheniformis (Bacillus licheniformis). Bacillus licheniformis BN11, accession number CCTCC NO: M2016026, was deposited at the China Center for Type Culture Collection on January 8, 2016.

[0030] Another aspect of the present invention provides a method for preparing the genetically engineered strain as described above. In one specific embodiment, the method includes inactivating or deleting the l-lactate dehydrogenase gene in the starting bacteria; and introducing the nucleotide sequence of the d-lactate dehydrogenase described above.

[0031] Furthermore, the method also includes inactivating or deleting the original d-lactate dehydrogenase gene in the starting bacteria; blocking the pathway of pyruvate to 2,3-butanediol synthesis.

[0032] Furthermore, the method also includes modifying the promoter of the introduced nucleotide sequence into a constitutive promoter.

[0033] Furthermore, the starting strain was Bacillus licheniformis ATCC 14580. ΔhsdR1ΔhsdR2 Double mutant strain MW3; replace the α-acetolactate decarboxylase (alsD) and acetolactate synthase (alsS) genes with the nucleotide sequences described above.

[0034] Another aspect of the invention provides for the application of the above-mentioned genetically engineered strains, particularly in the production of d-lactic acid.

[0035] In one specific embodiment, the carbon source used in the production is selected from one or more of glucose, xylose, maltose, lactose, and sucrose.

[0036] Preferably, the production process uses an inexpensive culture medium containing peanut meal or corn steep liquor for fermentation.

[0037] Preferably, the fermentation temperature for this production is 45°C to 55°C.

[0038] Preferably, the pH of the fermentation medium produced is 6.0 to 8.0.

[0039] Preferably, the fermentation process used in this production is a continuous fermentation or a fed-batch process.

[0040] Another aspect of the present invention provides a d-lactate dehydrogenase. In one specific embodiment, the d-lactate dehydrogenase has one of the following amino acid sequences: 1) It has the amino acid sequence shown in SEQ ID No. 1; 2) The amino acid sequence of a derivative protein produced by substituting, deleting or inserting one or more amino acid residues of the amino acid sequence of SEQ ID No. 1, wherein the derivative protein has d-lactate dehydrogenase activity; 3) Contains an amino acid sequence that has at least approximately 80% homology with SEQ ID No. 1.

[0041] This protein originates from the genus *Thermodesulfurobacterium* (… T. indicus The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0042] The present invention also provides nucleic acid molecules encoding the above-mentioned d-lactate dehydrogenase, which may be DNA, such as cDNA, genomic DNA or recombinant DNA; or RNA, such as mRNA, hnRNA or tRNA.

[0043] Furthermore, the present invention provides a nucleotide sequence encoding the above-mentioned d-lactate dehydrogenase, the nucleotide sequence having one of the following nucleotide sequences: 1) It has the nucleotide sequence shown in SEQ ID No. 2; 2) Possesses the nucleotide sequence shown in SEQ ID No. 3; 3) A nucleotide sequence that has more than 80% homology with SEQ ID No. 2 or SEQ ID No. 3.

[0044] Another aspect of the present invention provides the application of the above-described d-lactic acid dehydrogenase or the above-described nucleotide sequence in the production of d-lactic acid.

[0045] Another aspect of the present invention provides a genetically engineered strain, characterized in that the genetically engineered strain has the d-lactate dehydrogenase as described in claim 1 or the d-lactate dehydrogenase encoded by the nucleotide sequence as described in claim 2.

[0046] Furthermore, the above-mentioned genetically engineered strains exhibit inactivation or deletion of the l-lactate dehydrogenase gene, as well as inactivation or deletion of the acetolactate synthase and / or acetolactate decarboxylase genes.

[0047] Furthermore, the above-mentioned genetically engineered strains also have one or more genes that are inactivated or deleted, wherein the one or more genes are selected from: pyruvate-formate lyase gene, pyruvate-formate lyase activator gene, pyruvate dehydrogenase gene, acetate kinase and alcohol dehydrogenase gene.

[0048] Further, the starting strain of the above-mentioned genetically engineered strain is Bacillus. Further, the Bacillus is selected from Bacillus licheniformis, Bacillus coagulans, Bacillus subtilis, Bacillus liquefactionus, Bacillus pumilus, Bacillus circulans, and Bacillus thiamine-degrading. Preferably, the starting strain is Bacillus licheniformis. Preferably, the starting strain is Bacillus licheniformis (…). Bacillus licheniformis ATCC 14580. Preferably, the starting bacteria is Bacillus licheniformis ATCC 14580. Δ hsdR1ΔhsdR2 Double mutant strain MW3.

[0049] Furthermore, the promoter of the aforementioned d-lactate dehydrogenase gene is the promoter P of the α-acetolactate synthase from Bacillus licheniformis ATCC 14580. als P in plasmid pMMPc c Promoter, Bacillus subtilis ( B. subtilis P in ) 43 The promoter or the promoter P of L-lactate dehydrogenase of Bacillus licheniformis ATCC 14580 ldh Preferably, the above-mentioned promoter is... ldh Ti The start codon "ATG" of the gene is directly linked.

[0050] Furthermore, the aforementioned genetically engineered strain is *Bacillus licheniformis* (accession number: *Bacillus licheniformis*). Bacillus licheniformis BN11, accession number CCTCC NO: M2016026, was deposited at the China Center for Type Culture Collection on January 8, 2016.

[0051] Another aspect of the present invention provides a method for preparing the above-mentioned genetically engineered strain, comprising the following steps: 1) Knock out the l-lactate dehydrogenase gene in the starting strain; 2) Introduce the nucleotide sequence encoding d-lactate dehydrogenase as described above; 3) Inactivate or delete the genes for acetolactate synthase and / or acetolactate decarboxylase; 4) At the same time as or after step 3), add a promoter sequence before the nucleotide sequence introduced in step 2).

[0052] Specifically, using the mutant strain MW3 of Bacillus licheniformis ATCC 14580 with the l-lactate dehydrogenase gene knocked out as the host, and replacing α-acetolactate decarboxylase (alsD) and acetolactate synthase (alsS) with the aforementioned d-lactate dehydrogenase, a heat-resistant engineered spore strain CCTCCNO: M2016026 capable of producing d-lactate by fermenting glucose at a temperature of 30°C to 55°C was obtained.

[0053] Another aspect of the present invention provides an application of the above-mentioned genetically engineered strain, particularly its application in the production of d-lactic acid. Further, the strain is used in the production of d-lactic acid using glucose, xylose, maltose, lactose, sucrose, or combinations thereof as carbon sources. Further, fermentation is carried out using an inexpensive culture medium containing peanut meal and corn steep liquor. Further, fermentation for d-lactic acid production is conducted under anaerobic and microaerobic conditions, at a pH of 6.0–8.0 and a temperature of 45°C–55°C. Further, the fermentation process is a continuous fermentation or a fed-batch process.

[0054] Further, the above-mentioned genetically engineered strain was first cultured to obtain a seed culture solution. Then, fermentation was carried out in a fermentation medium using one of glucose, xylose, maltose, lactose, or sucrose as the carbon source and yeast powder, peptone, peanut meal, or corn steep liquor powder as the nitrogen source to obtain d-lactic acid. The specific steps include the following: 1) Slant culture: Inoculate engineered Bacillus strains onto solid slant culture medium containing 20 g / L agar and incubate at 45-55°C for 24-48 h; 2) Seed culture: The engineered Bacillus slant cultured was inoculated into seed culture medium under aseptic conditions, and cultured statically at 45~55°C for 24~36 h. A neutralizing agent was added to control the pH of the fermentation broth to obtain the seed culture medium. 3) Fermentation culture: Inoculate the fermentation medium at a volume ratio of 5-20% and culture at 45°C-55°C for 48-90 h, with 50°C being the preferred temperature.

[0055] Preferably, the seed culture medium in step 2) contains per liter: 60-120 g glucose or 40-70 g xylose, 8-12 g yeast extract, 3-8 g peptone, 50 g calcium carbonate, with the remainder being water. More preferably, it contains: 90 g glucose, 10 g yeast extract, 5 g peptone, 50 g calcium carbonate, with the remainder being water. The pH of this seed culture medium is 6.0. It is sterilized at 115°C for 15 min. The neutralizing agent includes one or more of NaOH, NH4OH, and Ca(OH)2.

[0056] Preferably, the components and contents of the fermentation medium in step 3) are: carbon source 40~180 g / L, nitrogen source 5~20 g / L. Preferably, the fermentation process in step 3) is a fed-batch process, which means that when the total reducing sugar content in the fermentation broth is lower than 20 g / L, carbon source is added to maintain the total reducing sugar content at 30~70 g / L, or to reach 50~70 g / L. Preferably, the pH of the fermentation medium is 6.0~8.0.

[0057] The modified genetically engineered strain provided by this invention can produce high-concentration, high-optical-purity d-lactic acid using low-cost raw materials and relatively high fermentation temperatures. This improves production efficiency while saving costs, making it suitable for widespread industrial application. The highest d-lactic acid yield can reach 226 g / L, with an optical purity of 99.9%, a sugar-acid conversion rate of up to 93.6%, and a fermentation production capacity of 3.2 g / [L·h]. Therefore, using the method of this invention to produce d-lactic acid can save costs, simplify the operation process, and has broad prospects for industrial application.

[0058] The following will further explain the concept, specific steps, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0059] Figure 1 This is a schematic diagram illustrating the construction of heat-resistant Bacillus licheniformis and its D-lactic acid production pathway, according to a specific embodiment of the present invention.

[0060] Figure 2 This is an example of SDS-PAGE assay used to determine the molecular weight of purified d-lactate dehydrogenase protein. Lane M represents the protein molecular weight standard; lane 1 contains E. coli bacteria carrying the pETDuet-1 empty vector. E. coli The crude enzyme solution obtained after BL21(DE3) induction; lane 2 contains the prokaryotic expression vector pETDuet-ldh Ti E. coli E. coli The crude enzyme solution obtained after BL21(DE3) induction; lane 3 contains purified d-lactate dehydrogenase.

[0061] Figure 3 This is the result of the optimal reaction pH value determination for d-lactate dehydrogenase.

[0062] Figure 4 This is the result of determining the optimal reaction temperature of d-lactate dehydrogenase.

[0063] Figure 5 Construction of various plasmids: A. pKVMΔ ldh ; B. pKVMN1; C. pKVMN2; D. pKVMN4; E. pKVMN6; F. pKVMA1.

[0064] Figure 6 This is an HPLC optical purity analysis of d-lactic acid produced by strain BN11.

[0065] Figure 7 This describes the fermentation process of strain BN11 to produce d-lactic acid using different glucose concentrations: A. Sugar consumption at different concentrations; B. d-lactic acid production at different sugar concentrations. Initial sugar concentration: , 60.0 g / L; ■, 87.0 g / L; ●, 122.0 g / L; 148.0 g / L; , 180.0 g / L; ◆, 202.0 g / L.

[0066] Figure 8 This describes the production of d-lactic acid using strain BN11 through batch fermentation and fed-batch (glucose) fermentation. A. Batch fermentation results; B. Fed-batch (glucose) fermentation results. ■, Cell density; ●, Glucose; d-lactic acid; ◆, formic acid; Acetic acid; ★ Ethanol.

[0067] Figure 9 This describes the production of d-lactic acid using strain BA11 through batch fermentation and fed-batch (glucose) fermentation. A. Batch fermentation results; B. Fed-batch (glucose) fermentation results. ■, Cell density; ●, Glucose; d-lactic acid; ◆, formic acid; Acetic acid; ★ Ethanol.

[0068] Figure 10 This describes the case of strain BN11 using xylose in fed-batch fermentation to produce d-lactic acid. ■, cell density; ●, xylose; d-lactic acid; ◆, formic acid; Acetic acid; ★ Ethanol.

[0069] Figure 11This describes the production of d-lactic acid using strain BN11 via fed-batch (glucose) fermentation on an inexpensive culture medium. ■ Cell density; ● Glucose; d-lactic acid; ◆, formic acid; Acetic acid; ★ Ethanol.

[0070] Figure 12 It is a developmental tree of d-lactate dehydrogenase predicted in some typical thermophilic bacteria.

[0071] Figure 13 The results are obtained by comparing the amino acid sequence (query) shown in SEQ ID No. 1 with the amino acid sequences of other d-lactate dehydrogenases, and analyzing the enzyme catalytic sites.

[0072] Figure 14 The results are obtained by comparing the amino acid sequence (query) shown in SEQ ID No. 1 with the amino acid sequences of other d-lactate dehydrogenases, and analyzing the ligand binding sites.

[0073] Figure 15 The results are obtained by comparing the amino acid sequence (query) shown in SEQ ID No. 1 with the amino acid sequences of other d-lactate dehydrogenases, and analyzing the NAD binding sites. Detailed Implementation

[0074] One aspect of the present invention provides a d-lactic acid dehydrogenase that catalyzes the synthesis of d-lactic acid from pyruvate.

[0075] In a preferred embodiment, the d-lactate dehydrogenase has one of the following amino acid sequences: 1) The amino acid sequence shown in SEQ ID No. 1; 2) An amino acid sequence derived from the amino acid sequence shown in SEQ ID No. 1 by substitution, deletion, insertion, or addition of one or more amino acid residues; 3) The amino acid sequence shown in SEQ ID No. 1, with conserved substitutions; 4) Contains an amino acid sequence that has at least 80% homology with the amino acid sequence shown in SEQ ID No. 1.

[0076] The term "conservative substitution" as used in this article should be understood as: substitutions in which a given amino acid in a polypeptide is replaced by another amino acid with similar characteristics. Typically, the following substitutions are considered conservative substitutions: replacing an aliphatic amino acid such as Ala, Val, Leu, and Ile with another aliphatic amino acid; replacing Ser with Thr, and vice versa; replacing an acidic residue such as Asp or Glu with another acidic residue; replacing an amide residue such as Asn or Gln with another amide residue; replacing a basic residue such as Lys or Arg with another basic residue; and replacing an aromatic residue such as Phe or Tyr with another aromatic residue.

[0077] Functionally equivalent amino acids are generally similar to the amino acids they replace in terms of size and / or characteristics (e.g., charge or hydrophobicity). Amino acids with similar properties can be grouped as follows: (1) Hydrophobicity: His, Trp, Trp, Tyr, Phe, Met, Leu, Ile, Val, Ala; (2) Neutral hydrophobicity: Cys, Ser, Thr; (3) Polarity: Ser, Thr, Asn, Gln; (4) Acidic / negatively charged: Asp, Glu; (5) Charged: Asp, Glu, Asn, Lys, His; (6) Alkaline / positively charged: Asn, Lys, His; (7) Alkaline: Asn, Gln, His, Lys, Arg; (8) Residues affecting chain orientation: Gly, Pro; and (9) Aromatics: Trp, Tyr, Phe, His.

[0078] The amino acid sequences of d-lactate dehydrogenases predicted from some typical thermophilic bacteria were plotted using MEGA 5 software via neighbor-joining, and a phylogenetic tree was constructed as follows: Figure 12 As shown. The strain in bold is the donor bacterium of d-lactate dehydrogenase shown in SEQ ID No. 1, and its lowest homology is... Truepera radiovictrix The amino acid similarity between the two is 28%; the one with the highest similarity is d-lactate dehydrogenase. Treponema caldarium The d-lactate dehydrogenase in DSM 7334 has an amino acid similarity of 45%.

[0079] Preferably, the substitution, deletion, insertion, or addition of amino acid residues occurs outside the functional domain, which includes the enzyme catalytic site, ligand binding site, and NAD binding site of d-lactate dehydrogenase. The amino acid sequence of SEQ ID No. 1 is compared with that of other d-lactate dehydrogenases to obtain the following... Figure 13 , 14 The results of the comparative analysis of the catalytic site, ligand binding site and NAD binding site shown in Figure 15.

[0080] More preferably, the substitution, deletion, insertion, or addition of amino acid residues occurs outside the key amino acids of the enzyme catalytic site, ligand binding site, and NAD binding site. Specifically, the key amino acids of the enzyme catalytic site are Arg at position 229, Glu at position 258, and His at position 290; the key amino acids of the ligand binding site are Ser, Ala, and Gly at positions 75-77, Tyr at position 99, Arg at position 229, His at position 290, and Phe at position 293; the key amino acids of the NAD binding site are Tyr at position 99, Ile at position 104, Gly at position 150, and Arg at position 229, His at position 290, and Phe at position 293; 52-155: Gly, Lys, Ile, Gly; 172-174: Tyr, Asp, Pro; 199-202: His, Cys, Pro, Leu; 206: Asn; 209: Met; 227-229: Thr, Ala, Arg; 253-254: Asp, Val; 290: His; 292-293: Ala, Phe.

[0081] Another aspect of the invention provides a nucleotide sequence encoding the aforementioned d-lactate dehydrogenase.

[0082] In a preferred embodiment, the nucleotide sequence has one of the following nucleotide sequences: 1) The nucleotide sequence shown in SEQ ID No. 2; 2) The nucleotide sequence shown in SEQ ID No. 3; 3) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3; 4) A nucleotide sequence that hybridizes with the complementary strand of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3 under highly stringent conditions.

[0083] The phrase "hybridization under low, medium, high, or very high rigor conditions" used in this article describes the conditions for hybridization and washing. Instructions for conducting hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1–6.3.6. Both aqueous and non-aqueous methods are described in this literature and can be used. The specific hybridization conditions described herein are as follows: 1) Low-rigidity hybridization conditions involve hybridization in 6X sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by two washes in 0.2X SSC, 0.1% SDS at at least 50°C (for low-rigidity conditions, the washing temperature should be increased to 55°C); 2) Medium-rigidity hybridization conditions involve hybridization in 6X SSC at approximately 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 60°C; 3) High-rigidity hybridization conditions involve hybridization in 6X SSC at approximately 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 65°C; 4) Very high-rigidity hybridization conditions involve hybridization in 0.5M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2X SSC, 1% SDS at 65°C. High-rigidity condition (3) is preferred and should be used unless otherwise specified.

[0084] Another aspect of the invention provides a genetically engineered strain having d-lactic acid dehydrogenase as described above or d-lactic acid dehydrogenase encoded by the nucleotide sequence as described above.

[0085] In one specific embodiment, the pathways of pyruvate to L-lactic acid and pyruvate to 2,3-butanediol in the starting strain of the genetically engineered strain are blocked. In one embodiment, the pathway of pyruvate to L-lactic acid is blocked by inactivation or deletion of the L-lactic acid dehydrogenase gene; and the pathway of pyruvate to 2,3-butanediol is blocked by inactivation or deletion of one or both of the acetolactate synthase gene and the acetolactate decarboxylase gene.

[0086] In another specific embodiment, in addition to the above-described pathways being blocked, one or more of the pathways of pyruvate to formic acid, pyruvate to acetic acid, and pyruvate to ethanol in the starting strain are also blocked. The pathway of pyruvate to formic acid is blocked by the inactivation or deletion of one or both of the pyruvate-formic acid lyase gene and the pyruvate-formic acid lyase activator gene; the pathway of pyruvate to acetic acid is blocked by the inactivation or deletion of one or both of the pyruvate dehydrogenase gene and the acetate kinase gene; and the pathway of pyruvate to ethanol is blocked by the inactivation or deletion of one or both of the pyruvate dehydrogenase gene and the alcohol dehydrogenase gene.

[0087] Preferably, the starting strain is a thermophilic bacterium. More preferably, the restriction modification system in the starting strain is inactivated or knocked out.

[0088] Preferably, the promoter of the above-mentioned d-lactate dehydrogenase gene is modified into a constitutive promoter, that is, it does not require an inducer; the regulation of the constitutive promoter is not affected by external conditions, and the expression of the gene it promotes is continuous.

[0089] Figure 1 This is a schematic diagram of the construction of the D-lactic acid engineered strain and the D-lactic acid production pathway in one embodiment.

[0090] In this article, "blocking" refers to interrupting a pathway through various genetic engineering methods. This includes inactivating or deleting the genes of one or more catalytic enzymes in the pathway, thereby preventing the pathway from proceeding.

[0091] In this article, "original d-lactate dehydrogenase gene" refers to the d-lactate dehydrogenase gene carried by the initiating bacteria itself.

[0092] Those skilled in the art will know that the starting strain may also not contain the enzymes or pathways that are missing or inactivated, or blocked, such as the L-lactate dehydrogenase gene or the D-lactate dehydrogenase gene. In this case, when constructing genetically engineered strains, these genes or pathways are naturally missing, and no additional genetic engineering operations are required to inactivate, delete, or block them.

[0093] Another aspect of the present invention provides the application of the above-mentioned genetically engineered strains, particularly in the production of d-lactic acid.

[0094] In one specific embodiment, the aforementioned genetically engineered strain can produce d-lactic acid through fermentation using one or more carbon sources selected from glucose, xylose, maltose, lactose, and sucrose; it can also produce d-lactic acid through fermentation using an inexpensive culture medium containing peanut meal or corn steep liquor. Since the starting strain of this genetically engineered strain is a thermophilic bacterium, and the original source of the introduced d-lactic acid dehydrogenase is also a thermophilic bacterium, this genetically engineered strain can produce d-lactic acid at relatively high fermentation temperatures.

[0095] The present invention will be further described in detail below with reference to specific embodiments.

[0096] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, and bacterial strains used in the following examples are commercially available.

[0097] Reagents and Strains: All reagents used in this invention were commercially available reagent-grade or higher. FastPfu DNA polymerase was purchased from Beijing TransGen Biotech Co., Ltd. All restriction endonucleases and T4 DNA ligases were purchased from NEB (New England Biolabs). Isopropyl-β-d-thiopyranoside (IPTG), dithiothreitol (DTT), and benzyl sulfonyl fluoride (PMSF) were purchased from Merck AG, Germany. L-lactic acid and d-lactic acid standards were purchased from Sigma-Aldrich. pMD18-T and all primers were synthesized by Dalian Takara Bio Inc. Bacillus licheniformis ATCC 14580 can be purchased directly from the ATCC website. The double mutant strain MW3 of Bacillus licheniformis ATCC 14580... ΔhsdR1 , ΔhsdR2 (Based on the literature: Generation of readily transformable) Bacillus licheniformis The double mutant strain MW3 was constructed using the method described in *Mutants* (Bianca Waschkaw et al., *Appl Microbiol Biotechnol*, (2008) 78:181-188) and used as the host bacterium for DNA manipulation. *Escherichia coli* E. coli DH5α and BL21(DE3) were used as cloning and expression host bacteria, respectively. *Escherichia coli* E. coli S17-1 was used as the donor bacteria for conjugation transfer. pETDuet-1 was used as the expression vector. The shuttle plasmid pKVM1, carrying resistance to ampicillin and erythromycin, was used for gene knockout of Bacillus licheniformis MW3. Luria-Bertani (LB) medium was used to culture Escherichia coli and Bacillus. Ampicillin (100 g / mL), erythromycin (5 g / mL), and polymyxin B (40 g / mL) were used for screening Escherichia coli and Bacillus. X-Gal (40 g / mL) was used for blue-white screening.

[0098] The chiral column used for HPLC analysis of d-lactic acid production by the strain was MCI GEL CRS10W.

[0099] Example 1: Obtaining the d-lactate dehydrogenase gene and its protein

[0100] 1. d-lactate dehydrogenase Ldh Ti Acquisition of genes

[0101] Hyperthermophilic bacteria in NCBI Aquifex aeolicusUsing d-lactate dehydrogenase NP_213499 from VF5 as a template, a protein WP_013906894, which has a 38% similarity to NP_213499, was obtained and is likely a d-lactate dehydrogenase. Its sequence is shown in SEQ ID No. 1. Further investigation revealed that this protein is present in *Dethiobacillus thermophilus* (…). Thermodesulfatator indicus In DSM 15286, the corresponding nucleotide sequence is a complete open reading frame, as shown in SEQ ID No. 2, with a length of 978 bp, encoding a protein composed of amino acid residues as shown in SEQ ID No. 1. This protein is named Ldh. Ti According to E. coli E. coli After codon optimization, the K12 codon was synthesized using PCR with primers shown in Table 1, where the primers served as templates for each other, to obtain the optimized nucleotide sequence, as shown in SEQ ID No. 3. The resulting gene (SEQ ID No. 3) was then inserted into the pMD18-T vector to obtain pMD18-T-ldh. Ti The plasmid was prepared and its nucleotide sequence was determined. Those skilled in the art will recognize that the gene shown in SEQ ID No. 3 can also be directly synthesized through gene synthesis.

[0102] Table 1. Used for PCR synthesis of d-lactate dehydrogenase (Ldh) Ti primer sequences

[0103] The underlined part represents the enzyme cleavage site.

[0104] 2. Construction of recombinant prokaryotic expression vectors

[0105] The pMD18-T-ldh obtained above Ti The plasmid was amplified by PCR using primers 1 and 40 as shown in Table 1. The obtained target gene fragment was then used... BamH I and Hind After double digestion with enzyme III, it was ligated into the expression vector pETDuet-1 (Novagen), which had undergone the same double digestion treatment, to express Ldh. Ti Gene ligation products transformed into E. coli E. coli BL21(DE3) (Novagen), after PCR and DNA sequencing identification, will contain the correct Ldh Ti The plasmid in the positive clone of the gene was named pETDuet-ldh Ti It can be used for the expression of d-lactate dehydrogenase.

[0106] 3. Prokaryotic expression and purification of d-lactate dehydrogenase

[0107] 1) d-lactate dehydrogenase Ldh Ti prokaryotic expression

[0108] The above-obtained prokaryotic expression vector pETDuet-ldh Ti E. coli E. coli BL21(DE3) was cultured at 37°C until OD was reached. 600nm After the concentration was 0.6-0.8, IPTG was added to a final concentration of 1 mM for induction. The cells were cultured in a shaker at 16°C for 16 h or in a shaker at 30°C for 8 h. The cells were then collected by centrifugation, resuspended in 50 mM phosphate buffer (PBS; pH 7.4), and the cells were sonicated to disrupt the cell structure. The supernatant was collected and analyzed by SDS-PAGE electrophoresis.

[0109] The results are as follows Figure 2 As shown in the figure, the prokaryotic expression vector pETDuet-ldh carrying the target gene can be seen. Ti E. coli E. coli High levels of expression were obtained in BL21(DE3), and the molecular weight of the single subunit of the expressed recombinant protein was approximately 37 kDa, consistent with the expected results.

[0110] 2) d-lactic acid dehydrogenase Ldh Ti Purification

[0111] The protein expressed in step 1) was purified using a His-tag. The details are as follows: The prokaryotic expression product obtained in step 1), as detected by SDS-PAGE, was purified by affinity chromatography. The supernatant after sonication was passed through a chromatography column packed with Ni-NTA gel. Proteins containing the His-tag bound to the Ni-NTA gel. Non-specifically bound proteins were then washed with washing buffer (25 mM Tris-HCl buffer, 500 mM NaCl, 50 mM imidazole, all final concentrations in solution, pH 8.0). Finally, the target protein was eluted with elution buffer (25 mM Tris-HCl buffer, 500 mM NaCl, 220 mM imidazole, all final concentrations in solution, pH 8.0) to obtain the purified target protein. Then, a molecular sieve gel column was used, and the buffer was changed to 50 mM phosphate buffer (pH 7.0) to obtain the finally purified target protein, d-lactate dehydrogenase Ldh. Ti .

[0112] The final purified target protein d-lactate dehydrogenase Ldh TiSDS-PAGE electrophoresis was performed, and the results were as follows: Figure 2 As shown in lane 3, the target band is single and approximately 37 kDa in size, indicating that the obtained target protein is relatively pure.

[0113] Example 2: The target protein d-lactate dehydrogenase Ldh obtained in Example 1 Ti Enzymatic characterization

[0114] The following substrates were used to identify the enzymatic properties of the target protein obtained in Example 1: pyruvate, d-lactic acid, l-lactic acid, glyceric acid, phenylpyruvate, glyoxylic acid, and oxaloacetic acid. The reaction system consisted of 50 mM phosphate buffer (pH 7.0) and 0.2 mM NADH or NAD. + As a coenzyme, an appropriate amount of d-lactate dehydrogenase Ldh Ti Different concentrations of substrate were reacted at 37°C. Enzyme activity was measured by determining the oxidation of NADH or NAD+ at 340 nm UV light. + The reduction of NADH or NAD, one unit of enzyme activity is defined as the oxidation or reduction of 1 μmol / min of NADH or NAD. + The required amount of enzyme.

[0115] The results showed that the target protein obtained in Example 1 could catalyze pyruvate, glyoxylate, oxaloacetate, d-lactic acid, and phenylpyruvate, but had no activity towards L-lactic acid and glyceric acid (Table 2). In particular, the d-lactic acid dehydrogenase Ldh... Ti It exhibits the highest catalytic efficiency for pyruvate and can specifically catalyze d-lactic acid. Therefore, the above results indicate that the target protein obtained in Example 1 is indeed the d-lactic acid dehydrogenase Ldh. Ti .

[0116] Table 2 d-lactic acid dehydrogenase Ldh Ti The substrate spectrum range of catalysis.

[0117]

[0118] –: This indicates that the enzyme has no activity against the substrate.

[0119] Among them, the d-lactic acid dehydrogenase Ldh obtained in Example 1 Ti The optimal reaction pH and optimal reaction temperature were determined through the following two experiments: 1) d-lactate dehydrogenase Ldh Ti Determination of the optimal reaction pH The enzyme activity was determined by measuring changes in NADH at a 340 nm UV wavelength. One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 μmol of NADH per minute. At 37°C, using 20 mM pyruvate as the substrate and 0.2 mM NADH as the coenzyme, the changes in enzyme activity of the d-lactate dehydrogenase were measured from pH 3.0 to 11.0. Buffer systems included: 50 mM citrate-sodium citrate buffer (pH 3.0–7.0); 50 mM phosphate buffer (pH 7.0–9.0); and 50 mM sodium carbonate-sodium bicarbonate buffer (pH 9.0–11.0). The experiment was repeated three times. The results are as follows: Figure 3 As shown, the optimal pH for this enzyme is 6.0. Figure 3 The relative activity of an enzyme is determined by measuring the enzyme activity under different pH conditions. The highest value at pH 6.0 is 100%, and the enzyme activity values ​​at other pH values ​​are calculated accordingly to obtain the relative enzyme activity.

[0120] 2) d-lactic acid dehydrogenase Ldh Ti Determination of the optimal reaction temperature

[0121] Enzyme activity was measured by observing changes in NADH levels under 340 nm UV light. One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 μmol of NADH per minute. The optimal reaction temperature for d-lactate dehydrogenase was determined under the following conditions: 20 mM pyruvate as substrate, 0.2 mM NADH as coenzyme, and 50 mM phosphate buffer (pH 7.0). Enzyme activity was measured from 30°C to 100°C, and the experiment was repeated three times. The results are as follows: Figure 4 As shown, the optimal reaction temperature for this enzyme is 70°C. Figure 4 The relative activity of an enzyme is determined by measuring the enzyme activity under different temperature conditions. The highest value at 70°C is 100%, and the enzyme activity values ​​at other temperatures are converted accordingly to obtain the relative enzyme activity.

[0122] Example 3: Preparation of heat-resistant Bacillus licheniformis strains

[0123] 1. Constructing various knockout plasmids as described in this invention.

[0124] 1) Construction of l-lactate dehydrogenase gene knockout plasmid: Using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms of the l-lactate dehydrogenase gene were amplified by PCR using primer pairs ldh-up-F / ldh-up-R and ldh-Dn-F / ldh-Dn-R, respectively. BamH I / Xho I and Xho I / Nco I digested the upstream and downstream homologous arms separately with enzymes, and simultaneously used... BamHI / Nco The plasmid pKVM1 was double-digested with enzyme I. The resulting vector and fragment were ligated using T4 DNA ligase and then transformed into E. coli. E. coli After DNA sequencing confirmed the positive clone plasmid S17-1 was correct, it was named pKVMΔ. ldh Plasmid construction, as Figure 5 As shown in Figure A. The pKVM1 plasmid can be obtained from the literature "Size unlimited markerless deletions by a transconjugative plasmid-system in...". Bacillus licheniformis (Rachinger, M. etal., Journal of biotechnology, 2013, 167(4), 365-369) was constructed.

[0125] 2) Construction of gene knockout plasmids for acetolactate synthase (alsS) and acetolactate decarboxylase (alsD) in the 2,3-butanediol metabolic pathway: The primer sequences used are shown in Table 3.

[0126] (1) Using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms were amplified by PCR using primer pairs Als1-up-F / Als1-up-R and Als-Dn-F / Als1-Dn-R, respectively. At the same time, d-lactate dehydrogenase Ldh was amplified by PCR using primer pair Als-ldh-F / Als-ldh-R. Ti The genes were then fused using recombinant PCR with primers Als1-up-F and Als1-Dn-R. The recombinant PCR product and pKVM1 were then processed separately using enzymes... BamH I / Nco I performed double enzyme digestion, and the product after ligation with T4 DNA ligase was transformed into E. coli. E. coli S17-1, after being verified as correct by DNA sequencing, was named pKVMN1 ( Figure 5 B). The upstream homologous arm of this plasmid is completely preserved at its end. alsS The starter subregion (P) als ), and with ldh Ti The start codon "ATG" is directly linked. The genome sequence of ATCC 14580 is available from NCBI. P... als The sequence is shown in SEQ ID No. 69.

[0127] (2) Using P c Starter ldhTi Construction of the knockout plasmid: Using plasmid pMMPc as a template, PCR amplification was performed with primers Als2-Pc-F and Als2-Pc-R to obtain P c The promoter gene. Among them, the pMMPc plasmid can be constructed from the pMMB66EH plasmid according to the method in the literature Newconstitutive vectors: useful genetic engineering tools for biocatalysis (Xu,Y., Tao, F., Ma, C., & Xu, P., Applied and environmental microbiology, 2013,79(8), 2836-2840); using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms were amplified by PCR using primer pairs Als2-up-F / Als2-up-R and Als-Dn-F / Als2-Dn-R, respectively. At the same time, d-lactate dehydrogenase Ldh was amplified by PCR using primer pair Als2-ldh-F / Als-ldh-R. Ti The genes were then fused using recombinant PCR with primers Als2-up-F and Als2-Dn-R. The recombinant PCR product and pKVM1 were then processed separately using enzymes... BamH I / Xma I performed double enzyme digestion, and the product after ligation with T4 DNA ligase was transformed into E. coli. E. coli S17-1, after being verified as correct by DNA sequencing, was named pKVMN2 ( Figure 5 C). Among them, P c The sequence is shown in SEQ ID No. 70.

[0128] (3) Use P 43 Starter ldh Ti Construction of knockout plasmids for expression: using Bacillus subtilis ( B. subtilis Using genomic DNA as a template, PCR amplification was performed using primers Als4-P43-F and Als4-P43-R to obtain P. 43 The gene of the promoter, in which P 43Information about the promoter can be found in the literature "Isobutanol production at elevated temperatures in thermophilic Geobacillus thermoglucosidasius" (Lin, PP, Rabe, KS, Takasumi, JL, Kadisch, M., Arnold, FH, & Liao, JC, Metabolicengineering, 2014, 24, 1-8). Using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms were amplified by PCR using primer pairs Als2-up-F / Als4-up-R and Als-Dn-F / Als2-Dn-R, respectively. Simultaneously, d-lactate dehydrogenase Ldh was amplified by PCR using primer pair Als2-ldh-F / Als-ldh-R. Ti The genes were then fused using recombinant PCR with primers Als2-up-F and Als2-Dn-R. The recombinant PCR product and pKVM1 were then processed separately using enzymes... BamH I / Xma I performed double enzyme digestion, and the product after ligation with T4 DNA ligase was transformed into E. coli. E. coli S17-1, after being verified as correct by DNA sequencing, was named pKVMN4 ( Figure 5 D). Among them, P 43 The sequence is shown in SEQ ID No. 71.

[0129] (4) Use P ldh Starter ldh Ti Construction of expression knockout plasmid: P ldh This is the promoter of L-lactate dehydrogenase from Bacillus licheniformis ATCC 14580. Using ATCC 14580 genomic DNA as a template, PCR amplification was performed using primers Als6-Pldh-F and Als6-Pldh-R to obtain P... ldh Promoter genes; upstream and downstream homologous arms were amplified by PCR using primer pairs Als2-up-F / Als6-up-R and Als-Dn-F / Als2-Dn-R, respectively; simultaneously, d-lactate dehydrogenase Ldh was amplified by PCR using primer pair Als2-ldh-F / Als-ldh-R. Ti The genes were then fused using recombinant PCR with primers Als2-up-F and Als2-Dn-R. The recombinant PCR product and pKVM1 were then processed separately using enzymes... BamH I / XmaI performed double enzyme digestion, and the product after ligation with T4 DNA ligase was transformed into E. coli. E. coli S17-1, after being verified as correct by DNA sequencing, was named pKVMN6 ( Figure 5 E). Among them, P ldh The sequence is shown in SEQ ID No. 72.

[0130] (5) Replacement ldh Ti Construction of a knockout plasmid for moderate-temperature d-lactate dehydrogenase: Using ATCC 14580 genomic DNA as a template, upstream and downstream homologous arms were amplified by PCR using primer pairs Als1-up-F / AlsA-up-R and Als-Dn-F / Als1-Dn-R, respectively; E. coli E. coli Using K12 genomic DNA as a template, the d-lactate dehydrogenase LdhA gene was amplified by PCR using primers AlsA-ldhA-F / AlsA-ldhA-R. Then, the three gene fragments were fused using recombinant PCR with primers Als1-up-F and Als1-Dn-R. The recombinant PCR product and pKVM1 were then processed separately using enzymes... BamH I / Nco I performed double enzyme digestion, and the product after ligation with T4 DNA ligase was transformed into E. coli. E. coli S17-1, after being verified as correct by DNA sequencing, was named pKVMA1 ( Figure 5 F).

[0131] Table 3 Primers used for vector construction

[0132] Note: "-F" represents the forward primer; "-R" represents the reverse primer; underline indicates the enzyme cleavage site.

[0133] 3) Construction of a knockout plasmid for the pyruvate-formate lyase (PflA) gene in the formate pathway

[0134] Using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms of the pyruvate formate lyase gene were amplified by PCR using primer pairs pflA1-F / pflA1-R and pflA2-F / pflA2-R, respectively. EcoR I / Xho I and Xho I / BamH The upstream and downstream homologous arms were digested with enzymes I, and the plasmid pKVM1 was also digested with BamHI / NcoI. The digested vector and fragments were ligated with T4 DNA ligase and then transformed into E. coli. E. coliAfter DNA sequencing confirmed the positive clone plasmid S17-1 was correct, it was named pKVMΔ. pfl A.

[0135] The primer sequences are as follows (5' - 3'): pflA1-F: CCG GAATTC ATGGAACAATGGAAAGGT pflA1-R: TCG CTCGAG TGGAAATGTCAAACCCATAG pflA2-F: CCG CTCGAG GACGATGGCCACTGGGATC pflA2-R: ATC GGATCC CTACATCGATTCATGGAAGG 4) Construction of a knockout plasmid for the alcohol dehydrogenase (AdhB) gene in the ethanol pathway Using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms of the pyruvate formate lyase gene were amplified by PCR using primer pairs adhB-up-F / adhB-up-R and adhB-dn-F / adhB-dn-R, respectively. BamH I / Xho I and Xho I / Nco I digested the upstream and downstream homologous arms separately with enzymes, and simultaneously used... BamH I / Nco The plasmid pKVM1 was double-digested with enzyme I. The resulting vector and fragment were ligated using T4 DNA ligase and then transformed into E. coli. E. coli After DNA sequencing confirmed the positive clone plasmid S17-1 was correct, it was named pKVMΔ. adh B.

[0136] The primer sequences are as follows (5' - 3'): adhB-up-F: TACGGGATCCGAACGGGAATCGGCAAAGGGATT adhB-up-R: TCCGCTCGAGCGATGATAAAGGCTGCCGAGCTA adhB-dn-F: ACCGCTCGAGTCGTCACACTCCCATTATCG adhB-dn-R: CATGCCATGGCGTCGTATTTGCCGTCAGCT 5) Construction of a knockout plasmid for the acetate kinase (Ack) gene in the acetate pathway Using ATCC 14580 genomic DNA as a template, the upstream and downstream homologous arms of the pyruvate formate lyase gene were amplified by PCR using primer pairs ack-up-F / ack-up-R and ack-dn-F / ack-dn-R, respectively. BamH I / Xho I and Xho I / Nco I digested the upstream and downstream homologous arms separately with enzymes, and simultaneously used... BamH I / Nco The plasmid pKVM1 was double-digested with enzyme I. The resulting vector and fragment were ligated using T4 DNA ligase and then transformed into E. coli. E. coli After DNA sequencing confirmed the positive clone plasmid S17-1 was correct, it was named pKVMΔ. ack .

[0137] The primer sequences are as follows (5' - 3'): ack-up-F: TACG GGATCC GAAGGCTTTCCGGCCTTACT ack-up-R: TCCG CTCGAG CATCGTCATTCCGACGAATG ack-dn-F: ACCG CTCGAG GAGCTTCCAGCATTGATTGC ack-dn-R: CATG CCATGG ATGCGGTCATCTGCGATCTT 2. The constructed vector was used to modify thermoresistant Bacillus licheniformis. 1) Steps for gene knockout in heat-resistant Bacillus licheniformis: (1) Escherichia coli containing knockout plasmids E. coli S17-1 and Bacillus licheniformis MW3 were cultured in LB medium until OD200. 600nm ≈1.2, centrifuge at 6000 rpm for 5 min, wash twice with 0.9% physiological saline, mix the two bacteria, resuspend and centrifuge, then resuspend with LB medium and drop onto LB plates, incubate overnight at 30°C, collect cells with pre-warmed (30°C) LB, spread on LB solid plates (erythromycin and polymyxin B), and incubate at 30°C; (2) Pick transformants onto LB medium (erythromycin), incubate at 30°C, then serially dilute to LB plates (erythromycin and X-Gal), incubate overnight at 42°C, blue colonies indicate correct transformants; (3) Pick transformants to LB medium, culture at 30°C without antibiotics and transfer for two generations, dilute and plate to LB plates (X-Gal), pick white transformants and perform molecular verification.

[0138] 2) Preparation process of thermostable Bacillus licheniformis knockout strain

[0139] The host bacteria selected for genetic manipulation were those from which the restriction modification system was knocked out ( ΔhsdR1 , ΔhsdR2 The MW3 mutant strain of *Bacillus licheniformis* exhibits more efficient transformation of exogenous DNA, while its growth and protein secretion capabilities remain identical to the wild-type ATCC 14580, unaffected by knockout. Preparation of the *Bacillus licheniformis* MW3 knockout strain: (1) Preparation of host strain BL2 with the L-lactic acid dehydrogenase (Ldh) gene knocked out: Using the above genetic manipulation method, strain MW3 and strain containing the knockout plasmid pKVMΔ were prepared. ldh E. coli E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0140] (2) The L-lactate dehydrogenase (Ldh) gene and the acetol-3-butanediol pathway acetolate synthase (alsS) and acetolate decarboxylase (alsD) genes were knocked out, while the promoter P was retained. als Preparation of host strain BN11: Using the above genetic manipulation method, strain BL2 and Escherichia coli containing the knockout plasmid pKVMN1 were prepared. E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0141] (3) The L-lactate dehydrogenase (Ldh) gene and the 2,3-butanediol pathway acetolate synthase (alsS) and acetolate decarboxylase (alsD) genes were knocked out, and P was replaced. als For P c Preparation of host strain BN22 for the promoter: Using the above genetic manipulation methods, strain BL2 and Escherichia coli containing the knockout plasmid pKVMN2 were prepared. E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0142] (4) The L-lactate dehydrogenase (Ldh) gene and the 2,3-butanediol pathway acetolate synthase (alsS) and acetolate decarboxylase (alsD) genes were knocked out, and P was replaced.als For P 43 Preparation of host strain BN44 for the promoter: Using the above genetic manipulation method, strain BL2 and Escherichia coli S17-1 containing the knockout plasmid pKVMN4 were combined with each parent. Then, transformants were obtained by single and double crossover, respectively. The genome was extracted, and positive strains were selected by PCR identification for further experiments.

[0143] (5) The L-lactate dehydrogenase (Ldh) gene and the 2,3-butanediol pathway acetolate synthase (alsS) and acetolate decarboxylase (alsD) genes were knocked out, and P was replaced. als For P ldh Preparation of host strain BN66 for the promoter: Using the above genetic manipulation method, strain BL2 and Escherichia coli S17-1 containing the knockout plasmid pKVMN6 were combined with each parent. Then, transformants were obtained by single and double crossover, respectively. The genome was extracted, and positive strains were selected by PCR identification for further experiments.

[0144] (6) Replace the thermophilic d-lactate dehydrogenase Ldh in BN11 Ti Preparation of the thermophilic host strain BA11 for d-lactate dehydrogenase LdhA: Using the above genetic manipulation method, strain BN11 and Escherichia coli containing the knockout plasmid pKVMA1 were prepared. E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0145] (7) Preparation of host strain BN12 with the pyruvate formate lyase (PflA) gene knocked out, starting from strain BN11: Using the above genetic manipulation method, strain BN11 and the host strain containing the knockout plasmid pKVMΔ were prepared. pfl Escherichia coli A E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0146] (8) Preparation of host strain BN13 with the alcohol dehydrogenase (AdhB) gene knocked out, starting from strain BN12: Using the above genetic manipulation method, strain BN11 and the host strain containing the knockout plasmid pKVMΔ were prepared. adh B Escherichia coli E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0147] (9) Preparation of host strain BN14 with the acetylkinase (Ack) gene knocked out, starting from strain BN13: Using the above genetic manipulation methods, strain BN11 and the host strain containing the knockout plasmid pKVMΔ were prepared. ack E. coli E. coli S17-1 was subjected to parental fusion, and then transformants were obtained through single and double crossovers, respectively. The genome was then extracted, identified by PCR, and positive strains were selected for further experiments.

[0148] Example 4: Original strain, ldh Knockout strains and strains containing different promoters and ldh Ti Fermentation status of the gene strain

[0149] This embodiment was carried out in a 5 L fully automated fermenter, and the composition of each culture medium used is as follows: Each liter of slant culture medium contains: 30-50 g glucose, 5-10 g yeast extract, 2-8 g peptone, 30 g calcium carbonate, 15-25 g agar powder, and the remainder is water. The pH of the slant culture medium is 7.0. It is sterilized at 115°C for 15 min.

[0150] The seed culture medium contains per liter: 40-120 g glucose, 5-10 g yeast extract, 2-8 g peptone, 50 g calcium carbonate, and the remainder is water. The pH of the seed culture medium is 6.0-8.0. Sterilize at 115°C for 15 min.

[0151] The fermentation medium contains: 120 g glucose, 5-10 g yeast extract, 2-8 g peptone, and the remainder is water per liter; the pH of the fermentation medium is 6.5-7.5. It is sterilized at 115°C for 15 min.

[0152] The method for producing d-lactic acid by fermentation as described in this embodiment includes the following steps: (1) Slant culture: The strain was inoculated onto a slant culture medium and cultured at 50°C for 24 h; (2) Seed culture: The strain cultured in step (1) was inoculated with two loops into a 40 mL Erlenmeyer flask containing 40 mL of seed culture medium under aseptic conditions, and cultured statically at 50°C for 24 h to obtain seed culture solution 1; 10 mL of seed culture solution 1 was inoculated into a 500 mL Erlenmeyer flask containing 100 mL of seed culture medium under aseptic conditions, and cultured statically at 50°C for 24 h to obtain seed culture solution 2; (3) Fermentation culture: 300 mL of seed culture 2 prepared in step (2) was introduced into a fermenter containing 2.7 L of fermentation culture medium under aseptic conditions, and cultured at 50°C and 70 rpm. Samples were taken every 3 h, and fermentation was ended after 12 h.

[0153] After fermentation, the supernatant of the fermentation broth was analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugars, and the sugar-acid conversion rate was calculated (Table 4). The conversion rate (%) was calculated as: lactic acid yield (g / L) / glucose consumption (g / L) × 100%. HPLC analysis of d-lactic acid and l-lactic acid showed that the optical purity of d-lactic acid produced by BN11 reached 99.9%. Figure 6 ).

[0154] Table 4. Glucose consumption and product generation of different strains.

[0155]

[0156] –: This indicates that the amount of product is less than 0.01 g / L.

[0157] Since the starting strain Bacillus licheniformis ATCC 14580 used in this embodiment naturally produces 2,3-butanediol in high quantities, it indicates that the activity of this pathway is very strong. Pals is the promoter of acetolactate synthase (alsS), the first gene in the 2,3-butanediol synthesis gene cluster. Therefore, this may be the reason why the genetically engineered strain BN11 (using this promoter) exhibits good transformation efficiency.

[0158] Example 5: Fermentation after the optimal strain in Example 4 blocked the formation of byproducts.

[0159] This example was conducted in a 5 L fully automated fermenter, using strains BN11, BN12 (blocking the byproduct formic acid), BN13 (blocking the byproducts formic acid and ethanol), and BN14 (blocking the byproducts formic acid, ethanol, and acetic acid). The compositions of the culture media used are as follows: The slant culture medium, seed culture medium, and fermentation culture medium are the same as in Example 4.

[0160] The method for producing d-lactic acid by fermentation is the same as in Example 4.

[0161] After fermentation, the supernatant of the fermentation broth was analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugars, and the sugar-acid conversion rate was calculated (Table 5). The conversion rate (%) was calculated as: lactic acid yield (g / L) / glucose consumption (g / L) × 100%. HPLC analysis of d-lactic acid and l-lactic acid showed that the optical purity of d-lactic acid produced by BN11 reached 99.9%.

[0162] Table 5. Glucose consumption and product formation of different strains that block byproduct formation.

[0163]

[0164] –: This indicates that the amount of product is less than 0.01 g / L.

[0165] The results showed that blocking the formation of 2,3-butanediol and L-lactic acid, and further blocking other byproducts, could improve the conversion rate of glucose to d-lactic acid. Moreover, the more byproducts blocked, the higher the conversion rate of d-lactic acid.

[0166] Example 6: Optimization of fermentation conditions for the optimal strain in Example 4

[0167] This embodiment was carried out in a 5 L fully automated fermenter, using strain BN11, and the composition of each culture medium used is as follows: The slant culture medium and seed culture medium are the same as in Example 4.

[0168] Each liter of fermentation medium contains: 1) When determining the optimal fermentation pH, the medium composition is: 90 g glucose, 5-10 g yeast extract, 2-8 g peptone, and the remainder is water, with pH adjusted to 6.0, 6.5, 7.0, 7.5, and 8.0 respectively; 2) To determine the ability of the strain to produce d-lactic acid in mediums with different glucose concentrations, the medium composition is: 5-10 g yeast extract, 2-8 g peptone, and glucose amounts of 60 g, 87 g, 122 g, 148 g, 180 g, and 202 g, with the remainder being water.

[0169] The method for producing d-lactic acid by fermentation as described in this embodiment includes the following steps: (1) Slant culture: Same as in Example 4; (2) Seed culture: Same as in Example 4; (3) Fermentation culture: 300 mL of seed culture 2 prepared in step (2) was inoculated into a fermenter containing 2.7 L of fermentation culture medium under different conditions under aseptic conditions, and cultured at 50°C and 70 rpm. Samples were taken every 3 h, and fermentation was ended after 12 h.

[0170] After fermentation, the supernatant of the fermentation broth was taken and analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugar, and the sugar-acid conversion rate was calculated.

[0171] Experimental results showed that the optimal fermentation pH for strain BN11 at 50°C was 7.0. At this pH, the glucose consumption rate was the fastest, the sugar-acid conversion rate was the highest, and the byproducts were the fewest (Table 6). Figure 7It can be seen that when the glucose concentration does not exceed 180 g / L, the rate of glucose consumption and d-lactic acid production of strain BN11 is not significantly inhibited; when the glucose concentration is higher than this value, such as 202 g / L, glucose consumption is significantly inhibited, and the d-lactic acid production rate also decreases accordingly.

[0172] Table 6. Effect of pH on d-lactic acid production by strain BN11.

[0173]

[0174] –: This indicates that the amount of product is less than 0.01 g / L.

[0175] Example 7: Production of d-lactic acid using the optimal strain from Example 4 through batch fermentation and fed-batch (sugar) fermentation.

[0176] This embodiment was carried out in a 5 L fully automated fermenter, using strain BN11, and the composition of each culture medium used is as follows: The slant culture medium and seed culture medium are the same as in Example 4.

[0177] The fermentation medium contains the following per liter: 1) For batch fermentation to produce d-lactic acid, the medium consists of: 180 g glucose, 5-10 g yeast extract, 2-8 g peptone, and the remainder is water; 2) For fed-batch (sugar) fermentation to produce d-lactic acid, the medium consists of: 40-70 g glucose, 5-10 g yeast extract, 2-8 g peptone, and the remainder is water.

[0178] The method for producing d-lactic acid by fermentation as described in this embodiment includes the following steps: (1) Slant culture: Same as in Example 4; (2) Seed culture: Same as in Example 4; (3) Fermentation culture: 300 mL of the seed culture broth 2 prepared in step (2) was aseptically inoculated into a fermenter containing 2.7 L of batch fermentation and fed-batch (sugar) fermentation media respectively. The mixture was cultured at 50°C and 70 rpm with stirring. Samples were taken every 2-5 hours to determine the residual sugar content in the fermentation broth. In batch fermentation, fermentation was stopped when the glucose was completely consumed or the consumption rate approached 0. In fed-batch (sugar) fermentation, glucose was added when the glucose concentration dropped to 10-20 g / L to bring the glucose concentration to 50-70 g / L. Sugar was added 2-5 times in total. Fermentation was stopped when the glucose consumption rate approached 0.

[0179] After fermentation, the supernatant of the fermentation broth was taken and analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugar, and the sugar-acid conversion rate and production rate were calculated.

[0180] from Figure 8 As shown in A, when the experimental strain BN11 was fermented in batches at 50°C, the glucose was completely consumed after 40 hours, and the fermentation ended. The concentration of d-lactic acid produced was 167.7 g / L, the concentration of byproducts ethanol was 5.8 g / L, the concentration of formic acid was 1.1 g / L, and the concentration of acetic acid was 3.6 g / L. The sugar-acid conversion rate and production rate were 93.0% and 4.2 g / [L·h], respectively.

[0181] from Figure 8 According to B, when strain BN11 underwent fed-batch (sugar) fermentation at 50°C, glucose was added four times, and fermentation ended after 70 hours. In the first 38 hours, 173.2 g / L of d-lactic acid was produced, with a production rate of 4.6 g / [L·h]. From 38 to 70 hours, the d-lactic acid concentration increased from 173.2 g / L to 226.6 g / L, with a production rate of 1.7 g / [L·h]. After fermentation, a total of 242.1 g / L of glucose was consumed, with an average production rate of 3.2 g / [L·h], and a sugar-to-acid conversion rate of 93.6%. The final concentration of the byproduct formic acid was 0.56 g / L, and the final concentrations of acetic acid and ethanol were 5.5 g / L and 4.3 g / L, respectively.

[0182] Example 8: Replacing the thermophilic Ldh Ti For the production of d-lactic acid by batch fermentation and fed-batch (sugar) fermentation of strains of mesophilic d-lactic acid dehydrogenase (LdhA).

[0183] This embodiment was carried out in a 5 L fully automated fermenter, using strain BA11, and the composition of each culture medium used is as follows: The slant culture medium and seed culture medium are the same as in Example 4.

[0184] The fermentation medium contains the same amount per liter as in Example 7.

[0185] The method for producing d-lactic acid by fermentation as described in this embodiment includes the following steps: (1) Slant culture: Same as in Example 4; (2) Seed culture: Same as in Example 4; (3) Fermentation culture: Same as in Example 7.

[0186] After fermentation, the supernatant of the fermentation broth was taken and analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugar, and the sugar-acid conversion rate and production rate were calculated.

[0187] from Figure 9As shown in Figure A, when the experimental strain BA11 was fermented in batches at 50°C, fermentation ended after 40 h, with a residual sugar content of 57.1 g / L. The final produced d-lactic acid concentration was 100.8 g / L, and the byproducts ethanol concentration was 9.5 g / L, formic acid concentration was 3.9 g / L, and acetic acid concentration was 4.5 g / L. The sugar-acid conversion rate and production rate were 82.4% and 2.5 g / [L·h], respectively.

[0188] from Figure 9 According to B, when strain BA11 underwent fed-batch (sugar) fermentation at 50°C, glucose was added three times, and fermentation was terminated after 70 h. A total of 196.9 g / L of glucose was consumed, producing 168.6 g / L of d-lactic acid, with an average production rate of 2.4 g / [L·h] and a sugar-acid conversion rate of 85.6%. The final concentrations of the byproducts formic acid and ethanol were 1.0 g / L, and the final concentration of acetic acid was 5.5 g / L.

[0189] Example 9: The optimal strain from Example 4 uses xylose for fed-batch fermentation to produce d-lactic acid.

[0190] This embodiment was carried out in a 5 L fully automated fermenter, using strain BN11, and the composition of each culture medium used is as follows: Each liter of slant culture medium contains: 30-50 g xylose, 5-10 g yeast extract, 2-8 g peptone, 30 g calcium carbonate, 15-25 g agar powder, and the remainder is water. The pH of the slant culture medium is 7.0. It is sterilized at 115°C for 15 min.

[0191] The seed culture medium contains per liter: 40-70 g xylose, 5-10 g yeast extract, 2-8 g peptone, 50 g calcium carbonate, and the remainder is water. The pH of the seed culture medium is 6.0-8.0. Sterilize at 115°C for 15 min.

[0192] The fermentation medium contains: 40-60 g xylose, 5-10 g yeast extract, 2-8 g peptone, and the remainder is water per liter; the pH of the fermentation medium is 6.5-7.5. Sterilize at 115°C for 15 min.

[0193] The method for producing d-lactic acid by fermentation as described in this embodiment includes the following steps: (1) Slant culture: Same as in Example 4; (2) Seed culture: Same as in Example 4; (3) Fermentation culture: 300 mL of the seed culture obtained in step (2) was aseptically inoculated into a 2.7 L fermentation culture medium and cultured at 50°C and 70 rpm with stirring. Samples were taken every 2-5 hours to determine the residual sugar content in the fermentation broth. When the xylose concentration dropped to 10-20 g / L, xylose was added continuously to bring the xylose concentration to 40-60 g / L. This process was repeated 2-5 times. Fermentation was terminated when the xylose consumption rate during fermentation approached 0.

[0194] After fermentation, the supernatant of the fermentation broth was taken and analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugar, and the sugar-acid conversion rate and production rate were calculated.

[0195] from Figure 10 It was found that strain BN11 used xylose as a carbon source and underwent fed-batch fermentation at 50°C, with xylose added only once, and fermentation ended after 70 h. A total of 114.7 g / L of xylose was consumed, producing 72.1 g / L of d-lactic acid, with an average production rate of approximately 1.0 g / [L·h]. The final concentration of the byproduct formic acid was 23.0 g / L, and the final concentrations of acetic acid and ethanol were 7.2 g / L and 8 g / L, respectively.

[0196] Example 10: The optimal strain from Example 4 was used for fed-batch (sugar) fermentation to produce d-lactic acid using an inexpensive culture medium.

[0197] This embodiment was carried out in a 5 L fully automated fermenter, using strain BN11, and the composition of each culture medium used is as follows: The slant culture medium and seed culture medium are the same as in Example 4.

[0198] The fermentation medium contains per liter: 40-70 g glucose, 1-5 g yeast extract, 0.25-1.0 g / L potassium dihydrogen phosphate, 0.25-1.0 g / L dipotassium hydrogen phosphate, 1.5-10.0 g / L ammonium sulfate, 1.2-5.0 g / L diammonium hydrogen phosphate, 0.15-0.8 g / L zinc sulfate, 1-10 g / L corn steep liquor powder, and the balance being water. Sterilize at 115°C for 15 min.

[0199] The method for producing d-lactic acid by fermentation as described in this embodiment includes the following steps: (1) Slant culture: Same as in Example 4; (2) Seed culture: Same as in Example 4; (3) Fermentation culture: 600 mL of the seed culture broth 2 prepared in step (2) was aseptically inoculated into a container of 2.4 L of inexpensive fermentation medium and cultured at 50°C and 70 rpm with stirring. Samples were taken every 2-5 hours to determine the residual sugar content in the fermentation broth. When the glucose concentration dropped to 10-20 g / L, glucose was added continuously to bring the glucose concentration to 50-70 g / L. This process was repeated 2-5 times. Fermentation was terminated when the glucose consumption rate during fermentation approached 0.

[0200] After fermentation, the supernatant of the fermentation broth was taken and analyzed by HPLC to determine the concentrations of d-lactic acid, byproducts, and total reducing sugar, and the sugar-acid conversion rate and production rate were calculated.

[0201] from Figure 11 It was found that when strain BN11 underwent fed-batch (sugar) fermentation at 50°C using an inexpensive culture medium, glucose was added four times, and fermentation was terminated after 90 h. A total of 190.9 g / L of glucose was consumed, producing 175.7 g / L of d-lactic acid, with an average production rate of 2.0 g / [L·h] and a sugar-acid conversion rate of 92.0%. The final concentration of the byproducts acetic acid was 7.5 g / L, and the final concentrations of formic acid and ethanol were 0.62 g / L and 1.6 g / L, respectively.

[0202] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A nucleotide sequence, wherein, The nucleotide sequence encodes d-lactic acid dehydrogenase, the d-lactic acid dehydrogenase comprising substitution, deletion, insertion or addition of one or more amino acid residues, wherein the d-lactic acid dehydrogenase comprises an amino acid sequence having at least 80% and less than 100% homology with the amino acid sequence shown in SEQ ID No. 1, and wherein the d-lactic acid dehydrogenase has d-lactic acid dehydrogenase activity.

2. The nucleotide sequence of claim 1, wherein, The nucleotide sequence has one of the following nucleotide sequences: 1) The nucleotide sequence shown in SEQ ID No. 2; 2) The nucleotide sequence shown in SEQ ID No. 3; 3) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3; 4) A nucleotide sequence that hybridizes with the complementary strand of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3 under highly stringent conditions.

3. A genetically engineered strain, wherein, The genetically engineered strain possesses d-lactate dehydrogenase, wherein the d-lactate dehydrogenase comprises substitution, deletion, insertion, or addition of one or more amino acid residues, wherein the d-lactate dehydrogenase comprises an amino acid sequence having at least 80% and less than 100% homology with the amino acid sequence shown in SEQ ID No. 1, and wherein the d-lactate dehydrogenase has d-lactate dehydrogenase activity.

4. The genetically engineered strain as described in claim 3, wherein, The nucleotide sequence encoding the d-lactate dehydrogenase has one of the following nucleotide sequences: 1) The nucleotide sequence shown in SEQ ID No. 2; 2) The nucleotide sequence shown in SEQ ID No. 3; 3) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3; 4) A nucleotide sequence that hybridizes with the complementary strand of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3 under highly stringent conditions.

5. The genetically engineered strain as described in claim 3, wherein, The pathway for the synthesis of 1-lactic acid from pyruvate and the pathway for the synthesis of 2,3-butanediol from pyruvate in the genetically engineered bacteria were blocked.

6. The genetically engineered strain as described in claim 5, wherein, The pathway for the synthesis of 1-lactic acid from pyruvate is blocked by the inactivation or deletion of the 1-lactic acid dehydrogenase gene; the pathway for the synthesis of 2,3-butanediol from pyruvate is blocked by the inactivation or deletion of one or both of the acetolactate synthase gene and the acetolactate decarboxylase gene.

7. The genetically engineered strain as described in claim 5, wherein, One or more of the pathways for the synthesis of formic acid from pyruvate, the synthesis of acetic acid from pyruvate, and the synthesis of ethanol from pyruvate in the genetically engineered bacteria are blocked.

8. The genetically engineered strain as described in claim 7, wherein, The pathway for the synthesis of formic acid from pyruvate is blocked by the inactivation or deletion of one or both of the pyruvate-formate lyase gene and the pyruvate-formate lyase activator gene; the pathway for the synthesis of acetic acid from pyruvate is blocked by the inactivation or deletion of one or both of the pyruvate dehydrogenase gene and the acetate kinase gene; the pathway for the synthesis of ethanol from pyruvate is blocked by the inactivation or deletion of one or both of the pyruvate dehydrogenase gene and the alcohol dehydrogenase gene.

9. The genetically engineered strain as described in claim 5, wherein, The original d-lactate dehydrogenase gene in the genetically engineered strain is inactivated or deleted.

10. The genetically engineered strain as described in claim 5, wherein, The starting bacteria of the genetically engineered strain are thermophilic bacteria.

Images