Gene for improving yield of S-adenosylmethionine (SAM) of pichia pastoris and application of gene
By overexpressing the PAS_chr3_0066, PAS_chr1-1_0233, and PAS_chr1-1_0389 genes in Pichia pastoris, the problem of insufficient energy supply was solved, and the yield of SAM was significantly increased. This provides new gene targets and modification strategies for the biosynthesis of SAM, and promotes the industrial application of SAM.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- EAST CHINA UNIV OF SCI & TECH
- Filing Date
- 2026-04-10
- Publication Date
- 2026-05-12
AI Technical Summary
In existing technologies, insufficient energy supply in the synthesis of S-adenosylmethionine (SAM) by Pichia pastoris has become a key bottleneck restricting efficient synthesis. Current research has focused on known energy metabolism-related targets and has failed to fully explore potential recessive regulatory genes, thus limiting the improvement of SAM synthesis capacity.
Transcriptomic analysis identified three genes: PAS_chr3_0066, PAS_chr1-1_0233, and PAS_chr1-1_0389. Overexpression vectors and strains were constructed to overexpress these genes and improve SAM production.
The yield of SAM from Pichia pastoris was significantly improved. The SAM yield of strains overexpressing PAS_chr3_0066, PAS_chr1-1_0233 and PAS_chr1-1_0389 increased by 39.60%, 50.65% and 56.71% respectively, effectively alleviating the problem of insufficient energy and promoting the industrial application of SAM.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial metabolic engineering technology, specifically relating to a gene that increases the production of S-adenosylmethionine (SAM) in Pichia pastoris and its application. Background Technology
[0002] S-Adenosyl-L-methionine (SAM) is an important methyl donor in organisms, widely involved in key metabolic processes such as transmethylation, transsulfation, and polyamine synthesis. It plays a positive role in liver protection, anti-depression, and bone and joint health, and therefore has broad market prospects in the fields of medicine and health food.
[0003] Currently, industrial production of SAM mainly relies on microbial fermentation, using Pichia pastoris (… Pichia pastoris As an excellent eukaryotic expression host, it has advantages such as high-density fermentation potential, strong and tightly regulated promoters (such as pAOX1), stable integration of exogenous genes, and a complete post-translational modification system, and is considered one of the most promising hosts for industrial production.
[0004] However, SAM synthesis in Pichia pastoris depends on the condensation reaction of L-Met and ATP catalyzed by SAM synthase. Even with sufficient supply of SAM synthase and L-Met, energy supply becomes a key bottleneck limiting efficient SAM synthesis. Therefore, alleviating energy limitations in Pichia pastoris to achieve highly efficient SAM synthesis is a crucial problem that urgently needs to be solved.
[0005] To overcome the aforementioned bottlenecks, existing research has largely focused on metabolic engineering of known energy metabolism-related targets, while neglecting genes indirectly linked to energy metabolism but potentially playing a crucial regulatory role in SAM synthesis. This has limited the possibility of systematically improving SAM synthesis capacity. Therefore, this study utilizes systems biology methods such as transcriptomics to systematically analyze gene expression changes during Pichia pastoris fermentation, aiming to uncover potential recessive regulatory genes related to SAM synthesis and energy metabolism, and ultimately providing new gene targets and breakthrough directions for metabolic engineering of SAM biosynthesis. Summary of the Invention
[0006] This invention aims to solve the problem of insufficient energy supply in the production of S-adenosylmethionine (SAM) by Pichia pastoris, and provides a key gene that can effectively increase the SAM yield of Pichia pastoris and its application.
[0007] To achieve the above objectives, this invention provides a Pichia pastoris gene for increasing S-adenosylmethionine production in Pichia pastoris. The accession numbers of this Pichia pastoris gene are as follows: PAS_chr3_0066, PAS_chr1-1_0233, PAS_ chr1-1_0389One or more of the following.
[0008] This invention also provides a gene overexpression vector for increasing the production of S-adenosylmethionine in Pichia pastoris, which can overexpress the Pichia pastoris gene separately in Pichia pastoris. PAS_chr3_0066, PAS_chr1-1_023, PAS_ chr1-1_0389 One or more of the following.
[0009] This invention also provides a gene-overexpressing strain of Pichia pastoris that can be used to increase the production of S-adenosylmethionine, and this overexpressing strain can overexpress the gene. PAS_chr3_0066, PAS_chr1-1_0233, PAS_chr1-1_0389 One or more of the following.
[0010] Preferably, the overexpressing strain is selected from Pichia pastoris, and more preferably from Pichia pastoris G12' / AOX-acs2.
[0011] The overexpression strains provided by this invention can be used in the production of S-adenosylmethionine.
[0012] Preferably, this overexpression strain can be used to increase the yield of S-adenosylmethionine in the industrial production of Pichia pastoris.
[0013] The Pichia pastoris gene provided by this invention has the following advantages: 1. It provides a new gene target: This invention, through transcriptomics analysis, is the first to screen and verify a novel gene target. PAS_chr3_0066, PAS_chr1-1_0233 and PAS_chr1-1_0389 The key regulatory roles of these three genes in SAM synthesis in Pichia pastoris provide a new strategy for metabolic engineering. 2. Significantly increased SAM yield: By overexpressing the above genes, Pichia pastoris strains with significantly increased SAM yield were successfully constructed. Compared with the control strain, the SAM accumulation level of the overexpressed strain was effectively improved. PAS_chr3_0066 strains, overexpression PAS_chr1-1_0233 strains and overexpression PAS_chr1-1_0389 The strains increased SAM yield by 39.60%, 50.65%, and 56.71% respectively compared to the original Pichia pastoris strain (G12' / AOX-acs2), demonstrating the effectiveness of the technical solution.
[0014] The overexpression provided by this invention PAS_chr3_0066, PAS_chr1-1_0233, PAS_chr1-1_0389 The gene-modified strain effectively alleviated the problem of insufficient energy in the production of SAM by Pichia pastoris strain, and the SAM yield was significantly increased, which is of great significance for promoting the industrial application of SAM. Attached Figure Description
[0015] Figure 1 This is a plasmid map of the original vector pUSA1 in this invention.
[0016] Figure 2The figure shows the transcriptomic differentially expressed genes and enrichment analysis results of the Pichia pastoris G12' / AOX-acs2 strain in this invention between the experimental group with sodium citrate and the control group without sodium citrate.
[0017] Figure 3 These are the colony PCR electrophoresis results of the three recombinant Pichia pastoris strains in this invention.
[0018] Figure 4 The DCW variation curves of the three recombinant Pichia pastoris and the control group in shake flask fermentation are shown.
[0019] Figure 5 This is a comparison of SAM yield between three recombinant Pichia pastoris strains and the control group in shake-flask fermentation according to the present invention. Detailed Implementation
[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in detail below with reference to specific embodiments. The specific embodiments described herein are merely some examples of this invention, intended to demonstrate the effectiveness of overexpressing related genes in increasing SAM production in Pichia pastoris, and are not intended to limit the invention entirely. All other derivative solutions obtained by those skilled in the art based on the metabolic engineering strategies disclosed in this invention without inventive effort are within the scope of protection claimed in this invention.
[0021] The reagents and culture media involved in this invention are as follows:
[0022] 1. Strains and vectors: Pichia pastoris G12' / AOX-acs2 (This strain is derived from Pichia pastoris strain GS115, and was transformed into a DNA-shuffling recombinant strain). MAT The gene (encoding methionine adenosine transferase) was used to obtain GS115 / DS16. Subsequently, using GS115 / DS16 as the starting strain, the gene was downregulated via the weak promoter pG12. CYS4 The gene (encoding cystathionine β synthase) was overexpressed after resistance recovery. acs2 The gene (encoding acetyl-CoA synthase) was obtained from strain G12' / AOX-acs2; Escherichia coli DH5α was purchased from Sangon Biotech (Shanghai) Co., Ltd.; the plasmid map of the original vector pUSA1 is shown below. Figure 1 As shown.
[0023] 2. Enzymes, kits, and other biochemical reagents used in genetic engineering: restriction endonucleases Not I. Xba Ⅰ Xho I and Avr II was purchased from Takara, PTM1 reagent from Coolaber, and plasmid extraction kit from AXYGEN.
[0024] 3. YPD medium: glucose 20g / L, yeast extract 10g / L, peptone 20g / L.
[0025] YPG medium: glycerol 20 g / L, yeast extract 10 g / L, peptone 20 g / L.
[0026] BSM medium: CaSO4 0.46 g / L, PTM1 12 mL / L, K2SO4 9.1 g / L, MgSO4·7H2O 7.5 g / L, (NH4)2SO4 7 g / L, 0.2 M K2HPO4 / KH2PO4 buffer (pH = 5.5).
[0027] Unless otherwise stated, the molecular biology experimental methods involved in the embodiments of this invention are performed in accordance with *Molecular Cloning: A Laboratory Manual* or the specific instructions of the purchased reagent kits. All biochemical reagents, primer synthesis, and sequencing involved in the experiments are derived from commercially available qualified products and are strictly performed according to their standard operating procedures.
[0028] Experiment Example 1: Transcriptomics Analysis and Target Gene Screening
[0029] Pichia pastoris G12' / AOX-acs2 was cultured in a 5 L fermenter with methanol induction. After 24 h of methanol induction, an appropriate amount of sodium citrate was continuously added to the experimental group (T), while no sodium citrate was added to the control group (C). Fermentation continued for 96 h. Samples were collected every 12 h during the experiment.
[0030] The cultured bacterial culture was centrifuged at 6000 rpm for 5–10 min at 4°C, the supernatant was discarded, and the bacterial cells were collected. Subsequent transcriptome sequencing analysis was performed by Shanghai Zhongke New Life Biotechnology Co., Ltd. The sequencing process included total RNA extraction, cDNA preparation, cDNA library construction, and high-throughput sequencing, performed according to standard experimental procedures and relevant kit instructions. After sequencing, raw sequencing data were obtained, and quality control and bioinformatics analysis were conducted on the data.
[0031] The study found that there were significant differences in gene transcription levels between the control and experimental groups in the later stage of fermentation. Therefore, samples induced by methanol for 96 h were selected for differentially expressed gene analysis. Significantly differentially expressed genes were obtained using |log2FC|≥1 and FDR<0.05 as screening criteria, and GO functional enrichment analysis and KEGG metabolic pathway enrichment analysis were performed on them. Figure 2The enrichment results were analyzed to screen for genes related to S-adenosylmethionine (SAM) biosynthesis and cellular energy metabolism. A comprehensive evaluation was conducted, combining factors such as differential expression significance, metabolic pathway association, and the functional characteristics of the encoded enzymes, to ultimately determine the relevant genes. PAS_chr3_0066, PAS_chr1-1_0233 and PAS_chr1-1_0389 This is the target gene for subsequent expression modification.
[0032] Experimental Example 2: Construction of Gene Overexpression Vector
[0033] 1. Selection of target gene
[0034] Based on previous transcriptomic analysis, three genes that may play a key role in the SAM synthesis pathway were screened from Pichia pastoris G12' / AOX-acs2. Their gene accession numbers are as follows: PAS_chr3_0066、PAS_chr1-1_ 0233、PAS_chr1-1_0389 .
[0035] Its nucleotide sequence is as follows:
[0036] SEQ ID NO.1 ( PAS_chr3_0066 ): ATGCCTGTCGTTAGCTCCCTCATTTCGTCCAACATCAAGAAGTCACCTCAGGACAAAGTAGTTACTGTCGCTGGAGGGTGTTTCTGGGGATTGGAGTACATTTACAAAATGCATTTTAAGGACAGAATCGTTGACACGCA AGTAGGCTTTGCCAACGGAAATCTGGCCAATCCAACTTACAAGGAGGTTTGTCAGGGTCTGACTTACCACGCTGAGGTATTGCAGATCGCCTACAATCCAGAAGTTATTTCATACAAGGAGCTGATTGACTTTTTTTCCTA GTTCACGATCCAACGCAAGATGACGGCCAAGGACCTGACATTGGTACTCAATACAGATCTGCTGTTTTCTACCTGGATGAAGAGGAGAAAGAGATTGCAGAGCAATCTTTGGCGGAAACACAGAAGAAGTGGTTCCCTCATC ACGAGATCGTCACTCAAGTTGAAAAATTGACTAGCTACTGGGATGCTGAAGATTACCACCAAGAATAACCTCATCAAGAATGCTGATGGTTACCACTGCCCCACTCATGTTCTCAGAACGGAACCCAAGGCCATCTCTGTTTAA
[0037] SEQ ID NO.2( PAS_chr1-1_0233
[0038] SEQ ID NO.3( PAS_chr1-1_0389
[0039] 2. PCR amplification of the target gene
[0040] Using Pichia pastoris G12' / AOX-acs2 genomic DNA as a template, specific primers containing homologous arms of the pUSA1 vector were designed (primer sequences are shown in Table 1) to amplify... PAS_chr3_0066 ( MXR1 ), PAS_chr1-1_0389 ( IDP1 ), PAS_ chr1-1_0233 ( ARG4 The complete CDS region of the gene was obtained. Amplification conditions were: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 5 s, 58℃ annealing for 10 s, 72℃ extension for 1 min, for a total of 32 cycles; final extension at 72℃ for 2 min. PCR products were detected by 3% agarose gel electrophoresis, and the target gene fragments were obtained after gel extraction and purification, with concentrations all above 100 ng / μL.
[0041] Table 1 Primers used for amplifying the target fragment
[0042] Serial ID number Primer name Primer sequence (5'→3') SEQ ID NO.4 MXR1-F ATTATTCGAACCGCGGGCGGCCGCATGCCTGTCGTTAGCTCCCTCATTTCGTC SEQ ID NO.5 MXR1-R TTCTGAGATGAGTTTTTGTTCTAGATTAAACAGAGATGGCCTTGGGTTCCGTTCTG SEQ ID NO.6 IDP1-F ATTATTCGAACCGCGGGCGGCCGCATGTTGACCCTACTCTCAGCTAAGAGCTTAG SEQ ID NO.7 IDP1-R TTCTGAGATGAGTTTTTGTTCTAGACTAAATGTTCAGCTTAGACTGAAGTTTCGAAGC SEQ ID NO.8 ARG4-F ATTATTCGAACCGCGGGCGGCCGCATGTCGAATCAAGAAGAAGGACTTAAACTGTGG SEQ ID NO.9 ARG4-R TTCTGAGATGAGTTTTTGTTCTAGATCAAGACTCTAGCTTTCATTCAGTGCATCC
[0043] 3. Linearization of the carrier
[0044] Take the pUSA1 plasmid (containing the AOX1 promoter, hygromycin resistance gene, and U1-up / U1-dn homologous arms) preserved in the laboratory, and use restriction endonucleases... Not I and Xba I. Double digestion at 37℃ for 4 h to remove SAR1 Gene fragments. The enzyme digestion products were recovered by agarose gel electrophoresis to obtain linearized vector fragments, which were then purified for later use.
[0045] 4. Preparation and amplification of recombinant plasmids
[0046] Specific primers were designed so that the three amplified genes each carried homologous arms (fragments identical to those at both ends of the linearized original plasmid). These were then ligated using Gibson ligation to obtain three recombinant plasmids. The recombinant plasmids were introduced into competent *E. coli* cells using a heat shock method and plated, awaiting the growth of single colonies on the plates.
[0047] 5. Identification of recombinant plasmids
[0048] Single colonies were selected for colony PCR verification, and positive clones were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target gene sequence in the NCBI database; complete consistency indicated successful construction of the recombinant plasmid. The three recombinant plasmids with correct sequencing were named pUSA1-MXR1, pUSA1-IDP1, and pUSA1-ARG4, respectively, and the plasmids were extracted for later use.
[0049] Experiment Example 3: Construction of Recombinant Pichia pastoris Strain
[0050] 1. Linearization of recombinant plasmids
[0051] The three recombinant plasmids pUSA1-MXR1, pUSA1-IDP1, and pUSA1-ARG4 constructed in Experiment Example 2 were linearized to expose the U1-up fragment homologous to the Pichia pastoris genome. PAS_chr1-4_0695 ) and U1-down ( PAS_chr1-4_0164 For pUSA1-MXR1, pUSA1-IDP1, and pUSA1-ARG4, use... Xho I and Avr II. Double digestion. The digestion system consisted of 50 μg plasmid, with 20 U of restriction endonuclease added to each end, and digestion was performed at 37°C for 4 h. The digestion products were purified to obtain linearized fragments with U1-up / U1-dn homologous arms at both ends for subsequent use.
[0052] 2. Preparation and electroporation of Pichia pastoris competent cells
[0053] Single colonies of the parental strain *Pichia pastoris* G12' / AOX-acs2 were inoculated into YPD liquid medium and cultured to the logarithmic growth phase. The cells were then collected to prepare competent cells. A linearized plasmid was added to the competent cells, mixed thoroughly, and then introduced into *Pichia pastoris* via electroporation. The electroporation parameters were set to 1.5 kV and a pulse duration of approximately 5 ms. After electroporation, the bacterial culture was plated on YPD plates containing 200 μg / mL hygromycin and incubated at 30°C for 3–5 days. Positive transformants were then screened.
[0054] 3. PCR verification of positive transformants
[0055] Single colonies grown on the plates were picked, and colony PCR was performed using primers U1up-F / U1up-R and U1dn-F / U1dn-R, respectively, to verify whether the target genes at the U1-up and U1-dn ends were correctly integrated into the genome. Primer sequences are shown in Table 2. PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; final extension at 72℃ for 5 min. PCR products were detected by 3% agarose gel electrophoresis. The U1-up end should amplify a band of approximately 1.0–1.5 kb, and the U1-dn end should amplify a band of approximately 1.0 kb. Figure 3The positive strains were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target gene sequence to confirm the absence of mutations and the correct integration direction. The positive transformants with correct sequencing were named G12' / acs2-MXR1, G12' / acs2-IDP1, and G12' / acs2-ARG4, respectively, and stored at -80℃ for subsequent shake-flask fermentation verification.
[0056] Table 2 Primer sequences used for verification
[0057] Serial ID number Primer name Primer sequence (5'→3') SEQ ID NO.10 U1up-F CCTGGAACAAGGGCCAATTCATGGTAATT SEQ ID NO.11 U1up-R CCACACTCAGAAAGCCCTCATCTGGAG SEQ ID NO.12 U1dn-F GTTATGTCACGCTTACATTCACGCCC SEQ ID NO.13 U1dn-R AGTGAAGAGACTTCTTCCACACTGGCTG
[0058] Experiment Example 4: Verification by Shake Flask Fermentation
[0059] The three gene-overexpressing strains obtained in Experiment 3 and the initial strain (G12' / AOX-acs2) were activated and inoculated onto YPD solid plates for single-colony culture. After activation, primary seed culture was performed, with single colonies picked and transferred to 3 ml of YPD liquid medium, and cultured at 30°C and 220 rpm with shaking for 16-18 h. For secondary seed culture, 1 mL of the primary seed culture was transferred to 100 ml of YPG liquid medium and cultured at 30°C and 220 rpm for 20 h. The OD of the secondary fermentation broth was measured. 600 Replace the fermentation broth medium with fresh BSM medium and ensure the bacterial culture OD... 600 The culture was carried out at 20-30℃ and 220 rpm. Induction was defined as the time when 1% (v / v) methanol was added, followed by the addition of 1% anhydrous methanol every 12 h, and then 630 μL of 40 g / L L-Met every 24 h. OD was measured every 24 h. 600 The value is sampled.
[0060] Experiment 5: Detection and Analysis of SAM Expression Levels
[0061] Take 1 mL of fermentation broth and centrifuge at 12000 rpm for 10 min at 4℃. Collect the supernatant and precipitate after centrifugation. The supernatant is used for the detection of extracellular SAM. Filter the supernatant through a 0.22 μm aqueous filter membrane and transfer it to a liquid chromatography vial. The precipitate is used for the determination of intracellular SAM. Wash the precipitate with deionized water, and then resuspend it in 1 mL of freshly prepared 10% trichloroacetic acid solution. Extract the resuspended solution at 4℃ for 2 h. After extraction, centrifuge at 12000 rpm for 8 min at 4℃, collect the supernatant, filter it through a 0.22 μm aqueous filter membrane, and transfer it to a liquid chromatography vial.
[0062] SAM was detected by high performance liquid chromatography using a BioBasic SCX strong cation exchange column. Mobile phase: Phase A was 5 mM ammonium formate solution (pH 4.0); Phase B was 500 mM ammonium formate solution (pH 4.0); flow rate was 1 mL / min; column temperature was 25℃; detection wavelength was 254 nm.
[0063] The results showed that the cell dry weight (DCW) of each overexpression strain was basically the same as that of the control strain. Figure 4 This indicates that overexpression of the three genes did not affect the growth of the strain. However, regarding SAM production, the SAM concentration of the overexpressing strain differed from the control strain starting 24 h after methanol induction, and the difference gradually increased with prolonged fermentation time. Figure 5 The SAM concentrations of different engineered strains were compared after 96 h of methanol fermentation. The SAM production of the G12' / acs2-MXR1, G12' / acs2-IDP1, and G12' / acs2-ARG4 overexpression strains was higher than that of the control strain G12' / AOX-acs2, indicating that overexpression of the above genes can increase the accumulation of SAM in Pichia pastoris cells to a certain extent. Among them, the SAM concentration of the G12' / acs2-ARG4 overexpression strain increased the most significantly, by 56.71% compared with the control strain, while the SAM production of the G12' / acs2-MXR1 and G12' / acs2-IDP1 strains increased by 39.60% and 50.65% respectively compared with the control strain (Table 3).
[0064] Therefore, by constructing separately PAS_chr3_0066, PAS_chr1-1_0233, PAS_chr1-1_0389 The overexpression of the gene by engineered strains can effectively regulate the biosynthetic level of SAM in Pichia pastoris and promote the increase of SAM production, providing a technical basis for the efficient biosynthesis of SAM using Pichia pastoris as a microbial chassis, and has good application value.
[0065] Table 3. Determination of SAM production by engineered strains at 96 h
[0066] strains SAM content (g / L) growth rate Control group (G12' / AOX-acs2) 1.467 - G12' / acs2-MXR1 2.048 +39.60% G12' / acs2-IDP1 2.210 +50.65% G12' / acs2-ARG4 2.299 +56.71%
[0067] Although the technical solution of the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the above embodiments are only for illustrating the present invention and should not be regarded as limiting the scope of protection of the present invention. Various modifications, equivalent substitutions, or improvements made by those skilled in the art based on the technical teachings of the present invention without departing from the spirit and substance of the present invention should fall within the scope of protection of the present invention. The scope of protection of the present invention should be determined by the content defined in the appended claims.
Claims
1. A gene for increasing the production of S-adenosylmethionine (SAM) in Pichia pastoris, characterized in that, The gene is one or more of the following genes: PAS_chr3_0066 , PAS_chr1-1_0233 and PAS_chr1-1_0389 Its nucleotide sequences are as shown in SEQ ID NO.1 to 3.
2. The gene according to claim 1, characterized in that, The gene is derived from Pichia pastoris ( Pichia pastoris The genes encode methionine sulfoxide reductase (MSR), isocitrate dehydrogenase (IDP), and arginine succinate lyase (ASL), respectively.
3. The use of the gene described in claim 1 or 2 in the preparation of recombinant Pichia pastoris for the production of S-adenosylmethionine.
4. A recombinant expression vector for increasing the yield of S-adenosylmethionine in Pichia pastoris, characterized in that, The vector contains one or more of the genes described in claim 1.
5. An engineered bacterial strain, characterized in that, The engineered strain is Pichia pastoris transformed with the recombinant expression vector of claim 4.
6. The engineered strain according to claim 5, characterized in that, The Pichia pastoris was obtained by further genetic modification of the Pichia pastoris G12' / AOX-acs2 strain.