Application of sfCHS2 gene in prevention and control of spodoptera frugiperda and regulation and control of peritrophic membrane of spodoptera frugiperda
By knocking out the sfCHS2 gene of fall armyworm using the CRISPR/Cas9 system, the problems of pest resistance and environmental pollution caused by chemical control have been solved, achieving precise and efficient control of fall armyworm.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- YAZHOUWAN NATIONAL LABORATORY
- Filing Date
- 2026-02-13
- Publication Date
- 2026-05-12
AI Technical Summary
Existing chemical control methods for fall armyworm have led to increased pest resistance, pesticide residues, and environmental pollution, while precise and efficient control technologies are lacking.
The sfCHS2 gene of fall armyworm was knocked out using the CRISPR/Cas9 system, resulting in the disappearance of the peritrophic membrane. The sfCHS2 gene was then used as an RNA pesticide target for control.
Effective control of fall armyworm reduces the fitness cost of pests, reduces pesticide use, and reduces environmental pollution.
Smart Images

Figure CN122012546A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a... sfCHS2 Application of genes in the control of fall armyworm and in regulating the periphery of fall armyworm. Background Technology
[0002] fall armyworm ( Spodoptera frugiperda This species belongs to the genus *Noctuidae* of the family Noctuidae in the order Lepidoptera, and is commonly known as the autumn armyworm. Native to tropical and subtropical regions of the Americas, this species poses a serious threat to agricultural production due to its wide host range, strong adaptability, remarkable migratory ability, high reproductive capacity, and ability to rapidly develop pesticide resistance.
[0003] Currently, the main method for controlling fall armyworm is chemical control. However, high-intensity spraying of pesticides easily leads to increased pest resistance, pesticide residues, and environmental pollution. Developing new gene targets will enable the research and development of more precise and efficient pest control technologies.
[0004] In view of this, the present invention is hereby proposed. Summary of the Invention
[0005] The first objective of this invention is to provide sfCHS2 Application of the (fall armyworm chitin synthase 2) gene in the control of fall armyworm.
[0006] The second objective of this invention is to provide a sfCHS2 Application of genes in regulating the periphery of fall armyworm.
[0007] To achieve the above objectives, the following technical solution is adopted: In a first aspect, the present invention provides a sfCHS2 The application of genes in the control of fall armyworm, the aforementioned sfCHS2 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; Knock out the fall armyworm sfCHS2 Genes can be used to control the fall armyworm.
[0008] As a further technical solution, the CRISPR / Cas9 system is used to knock out [the virus]. sfCHS2 Gene.
[0009] As a further technical solution, the target sequence of the sgRNA of the CRISPR / Cas9 system is as shown in SEQ ID NO.2.
[0010] As a further technical solution, the sequence of the sgRNA is shown in SEQ ID NO.3.
[0011] As a further technical solution, the aforementioned sfCHS2After gene knockout, obtain sfCHS2 Fall armyworm with deletion of exon 6 TAAAGAAGACTCGTTACTACACA nucleotide sequence.
[0012] Secondly, the present invention provides sfCHS2 The application of genes in regulating the periphery of the fall armyworm, the aforementioned sfCHS2 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; Knock out the fall armyworm sfCHS2 Genetic deficiency: The fall armyworm lacks a peritrophic membrane.
[0013] As a further technical solution, the CRISPR / Cas9 system is used to knock out [the virus]. sfCHS2 Gene.
[0014] As a further technical solution, the target sequence of the sgRNA of the CRISPR / Cas9 system is as shown in SEQ ID NO.2.
[0015] As a further technical solution, the sequence of the sgRNA is shown in SEQ ID NO.3.
[0016] As a further technical solution, the aforementioned sfCHS2 After gene knockout, obtain sfCHS2 Fall armyworm with deletion of exon 6 TAAAGAAGACTCGTTACTACACA (SEQ ID NO.4) nucleic acid sequence.
[0017] Compared with the prior art, the present invention has the following beneficial effects: The inventor discovered through research that sfCHS2 The gene is involved in the synthesis of chitin in the periesophageal membrane of the intestine; knocking it out... sfCHS2 The gene mutation causes the fall armyworm's feeding membrane to disappear and results in a high fitness cost when feeding on corn leaves. sfCHS2 Genes are a very important target for control and can be used as target genes for RNA pesticides, by knocking them out. sfCHS2 Genes can be used to control the fall armyworm. Attached Figure Description
[0018] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0019] Figure 1CRISPR / Cas9 pair SfCHS2 Screening process for SfCHS2-KO homozygous strains after gene knockout; Figure 2 CRISPR / Cas9-mediated fall armyworm sfCHS2 Gene knockout; SfCHS2 The mutation occurs in exon 6. The bold body represents the sgRNA target sequence, and the black underlined bases represent the adjacent motifs (PAM sites) of the original spacer sequence. Compared with the wild-type (WT) sequence, the black short horizontal lines represent base deletions, and the numbers in parentheses are the number of bases deleted. Figure 3 Cross-sectional sections of the midgut of wild-type fall armyworm Sf-WT and knockout strain SfCHS2-KO after feeding non-GMO maize leaves; MG: midgut; PM: perifeeding membrane; Figure 4 Survival curves of first instar larvae (A) and sixth instar larvae (B) of wild-type fall armyworm Sf-WT and knockout strain SfCHS2-KO after feeding on non-GMO maize leaves; all first instar larvae of the knockout strain died after 4 days, while most of the wild-type larvae survived; all sixth instar larvae of the knockout strain died after 17 days and could not pupate, while all surviving wild-type larvae pupated on the 8th day. Detailed Implementation
[0020] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0021] In a first aspect, the present invention provides a sfCHS2 The application of genes in the control of fall armyworm, the aforementioned sfCHS2 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; Knock out the fall armyworm sfCHS2 Genes can be used to control the fall armyworm.
[0022]
[0023] The inventor discovered through research that sfCHS2 The gene is involved in the synthesis of chitin in the periesophageal membrane of the intestine; knocking it out... sfCHS2 The gene mutation causes the fall armyworm's feeding membrane to disappear and results in a high fitness cost when feeding on corn leaves. sfCHS2 Genes are a very important target for control and can be used as target genes for RNA pesticides, by knocking them out. sfCHS2 Genes can be used to control the fall armyworm.
[0024] In some alternative implementations, the CRISPR / Cas9 system is used for knockout. sfCHS2 Gene.
[0025] In some alternative implementations, the target sequence of the sgRNA of the CRISPR / Cas9 system is as shown in SEQ ID NO. 2: AGACTCGTTACTACACACAGAGG (SEQ ID NO. 2).
[0026] The AGG at the end of the sequence is the PAM site.
[0027] In some alternative embodiments, the sequence of the sgRNA is shown in SEQ ID NO.3.
[0028] AGACTCGTTACTACACACAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO. 3).
[0029] In some alternative embodiments, knocking out the sfCHS2 gene yields a fall armyworm with the sfCHS2 gene exon 6 TAAAGAAGACTCGTTACTACACA (SEQ ID NO.4) nucleic acid sequence deleted.
[0030] Secondly, the present invention provides sfCHS2 The application of genes in regulating the periphery of the fall armyworm, the aforementioned sfCHS2 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; Knock out the fall armyworm sfCHS2 Genetic deficiency: The fall armyworm lacks a peritrophic membrane.
[0031] The inventor discovered through research that sfCHS2 The gene is involved in the synthesis of chitin in the periesophageal membrane of the intestine; knocking it out... sfCHS2Genetic modification causes the loss of the feeding membrane in the fall armyworm; therefore, through... sfCHS2 Genes can be used to regulate the periphery of the fall armyworm.
[0032] In some alternative implementations, the CRISPR / Cas9 system is used for knockout. sfCHS2 Gene.
[0033] In some alternative implementations, the target sequence of the sgRNA of the CRISPR / Cas9 system is as shown in SEQ ID NO. 2.
[0034] In some alternative embodiments, the sequence of the sgRNA is shown in SEQ ID NO.3.
[0035] In some alternative implementations, the sfCHS2 After gene knockout, obtain sfCHS2 Fall armyworm with deletion of exon 6 TAAAGAAGACTCGTTACTACACA (SEQ ID NO.4) nucleic acid sequence.
[0036] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0037] Example 1 This method utilizes CRISPR / Cas9 technology to target the fall armyworm. SfCHS2 The gene was knocked out, and the sgRNA sequence is shown in SEQ ID NO.3. After multiple generations of paired selection, [the gene was obtained]. SfCHS2 The screening process for the knockout homozygous strain SfCHS2-KO is as follows: Figure 1 As shown. Sequencing revealed that the knockout strain SfCHS2-KO had a 23-base deletion at exon 6 (sequence shown in SEQ ID NO.4), resulting in a frameshift mutation. Figure 2 ).
[0038] The mutant strain was able to complete the generation cycle normally when fed a diet. We dissected and stained the midgut of sixth-instar larvae of the wild-type Sf-WT and the knockout strain SfCHS2-KO. The results are as follows: Figure 3 As shown. The results indicate that knocking out SfCHS2 In the fall armyworm gene, the peritrophic membrane of the larvae disappears.
[0039] In addition, we conducted feeding experiments on newly hatched first-instar larvae and sixth-instar larvae fed with feed on non-GMO maize leaves, using wild-type Sf-WT as a control. For newly hatched larvae, there were 6 replicates per treatment, with 20 larvae per replicate. For sixth-instar larvae, there were 3 replicates per treatment, with 20 larvae per replicate. Survival was observed and recorded daily, and the potential survival rate in the field was detected and analyzed. The results are as follows: Figure 4 As shown in the figure. The results showed that all first-instar larvae of the knockout strain died after 4 days, while most of the wild-type larvae survived. The sixth-instar (final instar) larvae of the knockout strain developed slowly after being fed corn leaves, and all of them died after 17 days and failed to pupate, while most of the wild-type control larvae survived and all of them pupated on the 8th day.
[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. sfCHS2 The application of genes in the control of fall armyworm is characterized by, The sfCHS2 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; Knock out the fall armyworm sfCHS2 Genes can be used to control the fall armyworm.
2. The application according to claim 1, characterized in that, Knockout using CRISPR / Cas9 system sfCHS2 Gene.
3. The application according to claim 2, characterized in that, The target sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.
2.
4. The application according to claim 3, characterized in that, The sequence of the sgRNA is shown in SEQ ID NO.
3.
5. The application according to claim 4, characterized in that, The sfCHS2 After gene knockout, obtain sfCHS2 Fall armyworm with deletion of exon 6 TAAAGAAGACTCGTTACTACACA nucleotide sequence.
6. sfCHS2 The application of genes in regulating the periphery of the fall armyworm is characterized by, The sfCHS2 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; Knock out the fall armyworm sfCHS2 Genetic deficiency: The fall armyworm lacks a peritrophic membrane.
7. The application according to claim 6, characterized in that, Knockout using CRISPR / Cas9 system sfCHS2 Gene.
8. The application according to claim 7, characterized in that, The target sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.
2.
9. The application according to claim 8, characterized in that, The sequence of the sgRNA is shown in SEQ ID NO.
3.
10. The application according to claim 9, characterized in that, The sfCHS2 After gene knockout, obtain sfCHS2 Fall armyworm with deletion of exon 6 TAAAGAAGACTCGTTACTACACA nucleotide sequence.