CRISPR transposon gene integration system and application thereof

Abstract

The invention provides a CRISPR (clustered regularly interspaced short palindromic repeats) transposon gene integration system. The CRISPR transposon gene integration system comprises a vector pQCasTns containing transposase and Cas protein, and a vector pDoner containing a functional sequence, the pQCasTns comprises an operon and a T7 terminator which are connected in sequence; the pDoner comprises a functional sequence recognized by transposase and a crRNA sequence expression module of a targeted genome. The CRISPR transposon system provided by the invention solves a series of problems existing in genome editing of halomonas, and can realize multi-target knockout, high-efficiency deletion of long fragments and high-efficiency integration of exogenous genes.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology. Specifically, it relates to a CRISPR transposon system derived from Vibrio cholerae, and to a technique for efficiently integrating exogenous genes by optimizing the expression of enzymes in this system through promoter engineering. Background Technology

[0002] *Halomonas* is a halophilic, non-pattern Gram-negative bacterium. Due to its unique growth environment—optimal salt concentration of 40-60 g / L and optimal pH of 8.5-9.0—many other microorganisms cannot grow, thus enabling open, non-sterile continuous fermentation, which significantly reduces industrial production costs. As an excellent industrial chassis bacterium, *Halomonas* must undergo genome reprogramming to acquire a series of phenotypes favorable for the production of specific products. Currently, the tools available for genome knockout or integration in *Halomonas* are limited and have various drawbacks, including: 1) Homologous recombination systems mediated by suicide plasmids have low integration efficiency; 2) CRISPR-Cas9-mediated gene editing cannot knock out long fragments and, due to its dependence on homologous arms, cannot achieve multi-target integration and knockout; 3) Base editing systems can achieve multi-target knockout, but are prone to reversion mutations and cannot integrate exogenous genes; 4) The CRISPRi system achieves targeted gene inactivation by inhibiting DNA transcription with gRNA, but cannot achieve genome integration and deletion; 5) sRNA repression systems reduce protein expression by inhibiting mRNA translation with sRNA, but also cannot achieve genome integration and deletion. These limitations of gene editing tools make engineering modification of *Halomonas* difficult and time-consuming. Therefore, constructing an efficient and multifunctional gene editing system in *Halomonas* is the main problem this invention aims to solve. Summary of the Invention

[0003] The purpose of this invention is to overcome a series of problems existing in the prior art when editing the genome of Halomonas, including but not limited to the inability to perform simultaneous multi-target knockout, low efficiency in deleting long fragments, and low efficiency in integrating foreign genes, and to provide a technical method that can efficiently introduce foreign genes into Halomonas.

[0004] This invention provides a CRISPR transposon genome integration system (CRISPR-Tn system) that can achieve efficient integration of long genome fragments in Halomonas bacteria, integrate exogenous genes at more than 3 target sites, and a coupling site-specific recombinase system FLP-FRT to achieve deletion of genome fragments exceeding 119kb.

[0005] This invention first provides a CRISPR transposon gene integration system, which comprises:

[0006] The vector pQCasTns contains transposase and Cas protein, and the vector pDoner contains functional sequences;

[0007] The pQCasTns comprises an operator and a T7 terminator connected in sequence, and the operator has the following structure:

[0008] J23119-TnsA-TnsB-TnsC-TniQ-Cas8-Cas7-Cas6;

[0009] Among them, J23119 is the J23119 promoter, TnsA-TnsB-TnsC is the TnsA, TnsB, TnsC transposase complex derived from Vibrio cholerae, and TniQ and Cas8-Cas7-Cas6 are the Cas6, Cas7 and Cas8 protein complexes.

[0010] The pDoner contains a sequence of functions;

[0011] The functional sequence is a gene cargo sequence insertion site and / or a crRNA expression cassette insertion site;

[0012] When used to integrate long exogenous gene fragments greater than 10kb, the gene cargo sequence is an exogenous gene sequence, and the long exogenous gene fragment is not less than 12kb; and / or,

[0013] When used to knock out a genomic target gene, a downstream clone of the pQCasTns vector is an FLP protein initiated by the Mmp1 promoter, and the functional sequence of the pDoner comprises a first FRT sequence, a target gene, and a second FRT sequence linked in sequence; preferably, the first FRT sequence and the second FRT sequence are in opposite directions; the nucleotide sequence of the FRT is SEQ ID NO: 30; and / or,

[0014] When used to integrate a foreign gene at one or more targets, the crRNA expression cassette comprises a promoter and a foreign gene sequence spaced apart by a spacer sequence, which is SEQ ID NO:38.

[0015] In one embodiment of the present invention, pDoner may optionally include a resistance gene sequence, an OriT binding transfer element, an ori replicon, a pRO1600 oriV replicon, and a pRO1600 rep replication protein encoding gene; preferably, the resistance gene sequence is a spectinomycin resistance gene, or / and a kanamycin resistance gene, or / and a erythromycin resistance gene;

[0016] In one embodiment of the invention, the operon comprises a gene with nucleotide sequences SEQ ID NO:1-SEQ ID NO:14.

[0017] In one embodiment of the present invention, the nucleotide sequence of the FLP protein encoding gene is SEQ ID NO:27.

[0018] In one embodiment of the present invention, the upstream of the gene cargo sequence has an upstream recognition site with nucleotide sequence SEQ ID NO:23 and the downstream of the gene cargo sequence has a downstream recognition site with nucleotide sequence SEQ ID NO:24.

[0019] In one embodiment of the invention, the genomic target gene is not less than 119kb.

[0020] In one embodiment of the invention, the spacer sequence is SEQ ID NO:38

[0021] In one embodiment of the invention, the nucleotide sequence of the crRNA expression cassette is as shown in SEQ ID NO:22.

[0022] In one embodiment of the invention, the gene cargo in the pDoner is replaced with the target gene sequence using Gibsonassembly technology.

[0023] In one embodiment of the present invention, the pDoner is a crRNA sequence replaced using goldengate technology to express crRNA corresponding to different targets.

[0024] This invention also provides the application of the above-described system in gene editing of *Haloxylon ammodendron*; preferably, the gene editing is selected from one or more of the following: large genome deletion, simultaneous knockout of multiple genome targets, integration of exogenous genes at multiple targets, and integration of long exogenous genes; preferably, the large genome deletion is not less than 119 kb; preferably, the integration of exogenous genes at multiple targets is the simultaneous integration of exogenous genes at 2, 3, 4, 5, or 6 targets; preferably, the length of the exogenous long gene integration is not less than 12 kb; preferably, the *Haloxylon ammodendron* strain is the strain with accession number CGMCC No. 4353.

[0025] The beneficial effects of the above-described technical solution of the present invention are as follows:

[0026] The CRISPR transposon system provided by this invention solves a series of problems in editing the genome of Halomonas, enabling simultaneous multi-target knockout, deletion of ultra-long genome fragments, and efficient integration of large exogenous gene fragments. Attached Figure Description

[0027] Figure 1These are the images of the pQCasTns plasmid (a) and the pDoner plasmid (b);

[0028] Figure 2 These are the maps of pQCasTns-FLP plasmid (a) and pDoner-FRT plasmid (b);

[0029] Figure 3 This is a characterization diagram of the knockout efficiency of 10 randomly selected gene targets;

[0030] Figure 4 It is a graph representing the efficiency of integrating exogenous gene fragments of different lengths;

[0031] Figure 5 This is a schematic diagram of CRISPR-Tn coupled FLP deletion of the TD genome of Halomonas.

[0032] Figure 6 The images show the PCR results (left) and efficiency statistics (right) for the deletion of very long genomic fragments. Detailed Implementation

[0033] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0034] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0035] In this invention, Halomonas bluephagenesis TD1.0 (or simply TD1.0) refers to the Halomonas species with accession number CGMCC No. 4353, which has been disclosed in CN201010578858.8.

[0036] In this invention, "target gene" refers to the gene segment in the genome to be knocked out, also known as "target gene". Unless otherwise specified, the two have the same meaning and can be used interchangeably.

[0037] The inventors have been engaged in research on strain modification of *Halomonas* for many years. During gene editing of *Halomonas*, they discovered that the gene editing methods for this bacterium were limited and inefficient. To address this issue, the inventors discovered that a CRISPR transposon system derived from *Vibrio cholerae* could successfully function in *Halomonas*. Through ingenious construction, the inventors obtained a CRISPR transposon system capable of efficiently integrating exogenous genes into *Halomonas*.

[0038] This CRISPR transposon system consists of two plasmids, pQCasTns and pDoner (…). Figure 1 The pQCasTns vector contains the TnsABC transposase complex, TniQ, and Cas678 protein complex derived from Vibrio cholerae. It forms an operon sequence via a J23119 promoter, arranged as J23119-TnsA-TnsB-TnsC-TniQ-Cas8-Cas7-Cas6. The pDoner vector contains a gene cargo and a crRNA array. The Cas678 protein complex recognizes the crRNA and sequentially recruits TniQ and TnsABC; TnsABC recognizes the gene cargo and integrates it approximately 50 bp downstream of the crRNA. This system does not cause DNA double bond breaks, resulting in low cytotoxicity, and the integration is independent of homologous arms, making it suitable for constructing whole-genome libraries or performing multi-target integration.

[0039] According to a preferred embodiment of the present invention, in the pQCasTns plasmid, the TnsABC transposase complex, TniQ, and Cas678 are expressed as a gene cluster, the nucleotide sequence of TnsA is shown in SEQ ID NO:1, and the amino acid sequence of TnsA is shown in SEQ ID NO:2.

[0040] In the pQCasTns vector, the nucleotide sequence of TnsB is shown in SEQ ID NO:3, and the amino acid sequence of TnsB is shown in SEQ ID NO:4.

[0041] In the pQCasTns vector, the nucleotide sequence of TnsC is shown in SEQ ID NO:5, and the amino acid sequence of TnsC is shown in SEQ ID NO:6.

[0042] In the pQCasTns vector, the nucleotide sequence of TniQ is shown in SEQ ID NO:7, and the amino acid sequence of TniQ is shown in SEQ ID NO:8.

[0043] In the pQCasTns vector, the nucleotide sequence of Cas8 is shown in SEQ ID NO:9, and the amino acid sequence of Cas8 is shown in SEQ ID NO:10.

[0044] In the pQCasTns vector, the nucleotide sequence of Cas7 is shown in SEQ ID NO:11, and the amino acid sequence of Cas7 is shown in SEQ ID NO:12.

[0045] In the pQCasTns vector, the nucleotide sequence of Cas6 is shown in SEQ ID NO:13, and the amino acid sequence of Cas6 is shown in SEQ ID NO:14.

[0046] Preferably, the above-mentioned gene cluster is expressed by a constitutive promoter J23119, and its nucleotide sequence is preferably shown in SEQ ID NO:15.

[0047] Preferably, the terminator of the above-mentioned gene cluster is used to terminate its transcription process, and the terminator is the T7 terminator, the nucleotide sequence of which is shown in SEQ ID NO:16.

[0048] Preferably, the replicon OriV is used for normal plasmid replication, and its nucleotide sequence is shown in SEQ ID NO:17.

[0049] Preferably, the replicon oriT is used for conjugation transformation, and its nucleotide sequence is shown in SEQ ID NO:18.

[0050] For practical applications, such as screening positive transformants of the vector pQCasTns, the preferred vector pQCasTns may also include the resistance gene A.

[0051] In this invention, there are no particular restrictions on the specific source and sequence of the resistance gene A, as long as it enables the vector to be resistant to a specific antibiotic.

[0052] According to a preferred embodiment of the present invention, the resistance gene A is a chloramphenicol resistance gene. Preferably, the chloramphenicol resistance gene is derived from the pSEVA321 plasmid, and its nucleotide sequence is as shown in SEQ ID NO:19.

[0053] Preferably, the vector pQCasTns further includes a replication protein trfA, the nucleotide sequence of which is shown in SEQ ID NO:20.

[0054] According to a preferred embodiment of the present invention, the pDoner vector includes a gene cargo, a crRNA expression cassette, an resistance gene b for resistance selection, a binding transfer element oriT, and a replicon oriV.

[0055] Preferably, the expression cassette encoding crRNA contains a promoter B for expressing crRNA, a crRNA sequence, a scaffold sequence, and a terminator.

[0056] More preferably, the promoter B is J23119, whose nucleotide sequence is shown in SEQ ID NO: 15.

[0057] More preferably, the terminator is a λt0 terminator derived from the pSEVA341 vector, the nucleotide sequence of which is shown in SEQ ID NO:21.

[0058] Those skilled in the art can use any method known in the art to design crRNA sequences according to the characteristics of the target gene, and then ligate the crRNA to the pDoner plasmid using goldengate technology. For the design of multiple crRNAs, researchers can also use goldengate for ligation, or construct plasmids through direct synthesis.

[0059] Furthermore, the ligation of crRNA using the goldengate method depends on the action of the endonuclease bsa1. Therefore, the expression cassette encoding crRNA in the pDoner plasmid contains two bsa1 endonuclease recognition sites on the left and right sides and is loaded by two spacer sequences (SEQ ID NO:38). The nucleotide sequence of the crRNA expression cassette is shown in SEQ ID NO:22.

[0060] Preferably, the pDoner vector expresses n (n≥1) crRNAs. In this invention, there is no particular limitation on the number (types) of pDoner vectors in the gene editing system; it can be the same as or different from the number of crRNAs expressed. For example, the gene editing system provided by this invention may contain only one pDoner vector, which can express n crRNAs. Alternatively, the gene editing system provided by this invention may contain n different vectors, each used to express n different crRNAs. Or, the gene editing system provided by this invention may contain n different vectors, each used to express m (m≥1) different crRNAs. The crRNAs in this invention are 32 nt in length, and the PAM sequence is cc.

[0061] For practical applications, such as screening positive transformants of the vector pDoner, the preferred vector pDoner may also include the resistance gene b.

[0062] In this invention, there are no particular restrictions on the specific source and sequence of the resistance gene b, as long as it enables the vector to be resistant to a specific antibiotic.

[0063] According to a preferred embodiment of the present invention, the resistance gene B is a spectinomycin resistance gene. Preferably, the spectinomycin resistance gene is derived from the pSEVA341 plasmid, whose nucleotide sequence is as shown in SEQ ID NO:39, or / and the kanamycin resistance gene, whose nucleotide sequence is as shown in SEQ ID NO:40.

[0064] This invention provides a method for microbial genome integration, wherein the method involves transferring the two vectors, preferably the pQCasTns vector and the pDoner vector carrying crRNA of the corresponding target gene, into microbial cells to integrate the gene cargo.

[0065] The gene editing system provided by this invention can be used for genome editing of various microorganisms. According to a preferred embodiment of this invention, the microorganism is selected from the genus *Halomonas*. Preferably, it is *Halomonas bluephagenesis*. More preferably, it is *Halomonas* CGMCC No. 4353 (i.e., *Halomonas TD01*).

[0066] According to a preferred embodiment of the present invention, when the microorganism being gene-edited is a strain of the genus *Haloxylon*, the method of transferring the gene-editing system into the microbial cell can be selected from conjugation transformation and / or electroporation.

[0067] In the method provided by this invention, all plasmids contained in the gene editing system provided by this invention can be transferred into the cell to be edited together, or they can be transferred into it step by step.

[0068] To improve knockout efficiency, according to a preferred embodiment of the present invention, the method includes:

[0069] (1) The pQCasTns vector was transferred into microbial cells to obtain recombinant bacteria (positive transformant I);

[0070] (2) Design the corresponding crRNA expression vector pDoner based on the target gene and transfer it into the recombinant bacteria obtained in step (1), so that the crRNA guides the transposases TnsABC, TniQ and Cas678 to integrate the genome. Thus, a gene-edited strain (positive transformant II) integrating the target gene cargo is obtained.

[0071] The positive transformant II obtained in preferred step (2) is used to verify its genotype using the corresponding PCR primers. Correspondingly, based on the number of crRNAs expressed by the crRNA vector, the positive transformant obtained above should be integrated at the corresponding target site. Preferably, at least three positive clones with target integration can be obtained.

[0072] Furthermore, when integrating long-fragment gene cargo, the gene cargo in the pDoner plasmid is replaced with the corresponding sequence. The gene cargo is loaded by two specific recognition sites, the nucleotide sequence of the left arm of which is shown in SEQ ID NO:23.

[0073] The nucleotide sequence of the right arm of the specific recognition site is shown in SEQ ID NO:24.

[0074] In one embodiment of the present invention, the gene cargo is replaced with the sfGFP gene, which is used to integrate into the target gene in the genome of *Halomonas* to disrupt the structure of the target gene, thereby achieving gene inactivation. The nucleotide sequence of the sfGFP protein is shown in SEQ ID NO:25.

[0075] The sfGFP gene described above has a nucleotide length of 788 bp. If integration of a longer gene is desired, the sfGFP sequence should be replaced with a longer gene cargo. Preferably, the longest gene cargo in this invention is 12653 bp, and its nucleotide sequence is shown in SEQ ID NO:26.

[0076] The gene cargo described above is a gene fragment selected by the present invention to verify the function of the CRISPR-Tn system. Its size and sequence should not be considered as the only feasible size and sequence. Any other size or sequence can also be used for genome integration.

[0077] The present invention also provides a method for deleting long genome fragments in Halomonas.

[0078] The two plasmids pQCasTns and pDoner of the CRISPR-Tn system are preferably coupled with the site-specific recombinase system FLP-FRT to achieve ultra-long genome deletion. The genome deletion depends on the interaction between the FLP protein and the specific recognition site of the FRT, thereby causing gene deletion between the two FRTs. Specifically, if the FRTs are in opposite directions, gene inversion occurs; if the FRTs are in the same direction, gene deletion occurs.

[0079] The preferred method involves conjugating pQCasTns with an FLP protein, specifically by coupling an FLP protein downstream of the Cas6 protein to be initiated by the inducible promoter mmp1, thereby obtaining the vector pQCasTns-FLP. Figure 2 The FLP protein, whose nucleotide sequence is shown in SEQ ID NO:27 and whose amino acid sequence is shown in SEQ ID NO:28.

[0080] The nucleotide sequence of the promoter Mmp1 is shown in SEQ ID NO:29.

[0081] Therefore, the DNA cargo contained in pDoner-FRT is loaded with two FRT sequences in opposite directions (SEQ ID NO:30) to avoid uncertainty in the orientation of the FRT during integration.

[0082] The present invention will be described in detail below through examples. It should be understood that the following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Plasmid construction was performed entirely in accordance with *Molecular Cloning: A Laboratory Manual* or the corresponding reagent instructions. Primer design, sequence comparison, restriction enzyme site analysis, and plasmid mapping were all performed using Snapgene software. Plasmids were constructed using the Gibson ligation method. Primer synthesis and DNA sequencing were performed by Qingke Biotechnology Co., Ltd. The polymerase used for amplifying the vector and fragments was PrimeSTAR Max DNA polymerase (TaKaRa brand) purchased from Beijing Liuhetong Economic and Trade Co., Ltd. The gel extraction kit used was the Promega brand agarose gel extraction kit. The polymerase used for colony PCR was 2x TaqMaster Mix DNA polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The corresponding operating procedures were strictly performed according to the product instructions.

[0083] Materials and Methods

[0084] 1. Culture medium formulation in the examples:

[0085] 60LB medium: 60 g / L sodium chloride, 5 g / L yeast extract (purchased from OXID, UK, catalog number LP0021), 10 g / L tryptone (purchased from OXID, UK, catalog number LP0042). The remainder is water. Autoclave. In actual culture, antibiotics of a certain concentration can be added to the above medium to maintain plasmid stability. Commonly used antibiotics include: spectinomycin stock solution (100 mg / ml); chloramphenicol stock solution (25 mg / ml).

[0086] If a solid culture medium is required, add 1.5% agar to the liquid culture medium described above, sterilize, cool to 60°C, add an appropriate amount of antibiotic as needed, mix well, and pour into plates.

[0087] 2. The bonding and conversion method in the embodiments:

[0088] 1) The constructed plasmid was transformed into Escherichia coli S17-1 by electroporation, plated on the corresponding antibiotic plate, and single clones were picked and cultured overnight in LB medium with shaking.

[0089] 2) Transfer 1% of the inoculum to a glass tube containing 2 ml of LB medium, and transfer 1% of the Halomonas bacteria to a glass tube containing 2 ml of 60 LB medium. Incubate until OD600 = 0.6~0.8.

[0090] 3) Take 1.0 ml of culture medium from Escherichia coli S17-1 and Halomonas TD1.0, centrifuge at 2500 g for 2 minutes, and discard the supernatant;

[0091] 4) To ensure the normal growth of both *E. coli* and *Halomonas* when mixed together, each was resuspended in 50 μl of antibiotic-free 20 LB medium (i.e., the NaCl content in the aforementioned 60 LB medium was 20 g / L, with other components remaining unchanged). The suspensions were then mixed at a 1:1 volume ratio and added dropwise to 20 LB antibiotic-free solid plates. After culturing for 6 hours, the plates were spread onto 60 LB solid medium containing the corresponding antibiotics. Single colonies were identified by colony PCR after growth.

[0092] Example 1: Construction of Gibson assembly plasmid

[0093] 1) Based on the principle of Gibson recombination, primers with 20 bp homologous arms are designed first. Snapgene can be used to directly read the primer sequence containing homologous arms at the interface of the ligation fragment. The annealing temperature of each pair of primers should not differ by more than 5 ℃.

[0094] 2) Perform a routine PCR reaction, and then cut and recover the gel according to the instructions of the gel recovery kit to obtain fragments with homologous arms.

[0095] 3) Determine the concentration of the recovered fragments using Nanodrop. Calculate the concentration of each fragment according to the formula pmols = (weight in ng) x 1,000 / (base pairs x 650 daltons). Add the appropriate amount of fragment according to the experimental guidelines described in the NEB HIFI kit. The reaction system is 10 μL. Be sure to mix thoroughly with a pipette. Do not use vortexing or centrifugation. Perform the operation on ice.

[0096] 4) After reacting at 50°C for 1 hour using a PCR instrument, the recombinant product was transformed into E. coli S17-1 competent cells through chemical transformation. Because the recombinant reaction is highly efficient, the recombinant product was diluted 3-5 times (slowly pipetting and mixing), and 2 μL was taken to transform competent cells.

[0097] 5) After transformation and revival, E. coli S17-1 were plated onto LB agar plates with the corresponding resistance. After single colonies grew, single colonies were picked for sequencing.

[0098] Example 2: Construction of crRNA plasmid using goldengate

[0099] 1) Based on the principle of goldengate recombination, oligo primers for crRNA are first designed. Two primers are designed for each crRNA, and they are ligated together by annealing to form a short double-stranded DNA molecule with sticky ends. These sticky ends can match the sticky ends after BsaI digestion. For example, to inactivate the phaC gene (gene number HPTD01_3821) in TD1.0, the crRNA-1 sequence designed in this invention is shown in SEQ ID NO:31:

[0100] gcgcaatcgctgatgagtaaccctaacctgct (SEQ ID NO:31)

[0101] The corresponding annealing primers are SEQ ID NO:32 and SEQ ID NO:33:

[0102] Primer 1: ataacgcgcaatcgctgatgagtaaccctaacctgctg (SEQ ID NO: 32)

[0103] Primer 2: ttcacagcaggttagggttactcatcagcgattgcgcg (SEQ ID NO: 33)

[0104] The above sequence is just one example in this embodiment and is not limited to being effective only for this sequence. Different crRNAs can be designed to knock out different gene targets.

[0105] Take 4 μL of primer 1 and primer 2 into PCR tubes, add 1 μL of T4 PNK and 1 μL of T4 DNA ligase buffer (both purchased from NEB), and anneal according to the following procedure:

[0106]

[0107] After annealing the primers and diluting them 100-fold, take 1 μL and add 1 μL of T4 DNA ligase buffer, 0.5 μL of T4 ligase, 0.5 μL of BsaI endonuclease (all purchased from NEB), and 100 ng of the above pDoner vector plasmid in sequence. Then, perform ligation according to the following procedure:

[0108]

[0109] The ligation product was chemically transformed into E. coli S17-1 competent cells and plated on corresponding antibiotic resistance plates for screening. Successful construction was confirmed by sequencing, and the plasmid was named pDoner-crRNA1.

[0110] Example 3: Target gene knockout (or insertion inactivation)

[0111] The pQCasTns plasmid and pDoner-crRNA1 were sequentially transformed into TD1.0 via conjugation and screened on 60LB chloramphenicol + spectinomycin plates. After single colonies grew, all colonies were washed off with fresh culture medium and collected into 1.5mL centrifuge tubes. 100 μL was used for genome extraction. Finally, the genome was quantitatively analyzed by qPCR, using the ispH gene as an internal control, and the integration efficiency was calculated. The primers for verifying the target gene are as follows:

[0112]

[0113] The formula is: Efficiency = 2^(C) t 内参 -C t样品 The integration efficiency was calculated, with the Ct value representing the number of amplification cycles under a certain signal threshold. Through three independent repeated experiments, the integration efficiency (or knockout efficiency) of this target was found to be 92.82%, with an integration efficiency of 44.82% in the LR direction and 48.00% in the RL direction.

[0114] In other embodiments, 10 target sites were randomly selected for integration characterization, as shown in step 5. Ultimately, only one target site failed to integrate, while the remaining sites integrated with nearly 100% efficiency, as shown in the results. Figure 3 As shown, this demonstrates the universality of this method for target gene knockout in Halomonas TD1.0.

[0115] Example 4: Simultaneous knockout of 3 target genes in a single experiment

[0116] Based on the characteristics of the CRISPR-Tn system, crRNA arrays can be designed to simultaneously integrate exogenous genes at multiple target sites. This embodiment provides a specific method for triple gene knockout, but is not limited to triple gene knockout. The three gene target sites are referred to as gene A, gene B, and gene C.

[0117] First, a DNA fragment with a triple crRNA array was constructed using gene synthesis or primer construction. Here, the target fragment was synthesized from BGI Genomics using gene synthesis, and its sequence is shown in SEQ ID NO:34. The underlined sequences are the crRNA sequences corresponding to genes A, B, and C.

[0118] gtcgacgtggagatataccatgggtgaactgccgagtaggtagctgataaca tcataccgacgctttg atcaactctaacaag gtgaactgccgagtaggtagctgataac ttacggatcttgatacgctactaaacaacctg gtgaactgccgagtaggtagctgataac acgtgcctgttaatttctataaatcctaaagt gtgaactgccgagtaggtagctgataacggatccgaattcgagcggtc (SEQ ID NO: 34)

[0119] The crRNA sequences are separated by a fixed spacer sequence, SEQ ID NO:38.

[0120] Further, using the Gibson assembly plasmid construction method (as shown in step 3), the triple crRNA and the pDoner plasmid backbone were ligated to construct the pDoner-3X plasmid. Then, the pQCasTns plasmid and the pDoner-3X plasmid were sequentially transformed into TD1.0 and plated on 60 LB chloramphenicol-spectruminin double antibody plates. After single colonies grew, the integration efficiency was characterized (as shown in step 5). The primers used for qPCR verification are shown in the table below:

[0121]

[0122] Through three independent replicate experiments, the overall integration efficiencies for the three gene targets were obtained as follows: gene A 10.20%, gene B 10.55%, and gene C 33.30% (due to experimental error, integration efficiencies greater than 1 may occur). These results demonstrate that it is possible, but not limited to, to simultaneously knock out three genes in *Haloxylon ammodendron* TD using the CRISPR-Tn system in a single experiment.

[0123] Example 5: Integrating Extremely Long Segments

[0124] The specific experimental steps are as follows: First, construct the crRNA plasmid pDoner-crRNA2 according to the method described in step 4. Its target site is the G4 site of Halomonas, and the sequence is shown in SEQ ID NO:35:

[0125] gagcacatcgatcattcacctagctagatgag (SEQ ID NO:35)

[0126] Then, following the method described in step 3, the sfGFP sequence (SEQ ID NO:25) in the pDoner-crRNA2 plasmid was replaced with a sequence of the target length, preferably 12653 bp (SEQ ID NO:26), to obtain the plasmid pDoner-crRNA2-12653. Finally, the pQCasTns and pDoner-crRNA2-12653 plasmids were sequentially transformed into TD1.0 via conjugation, and the integration efficiency was characterized according to the efficiency verification method described in step 5. The qPCR primers are as follows:

[0127]

[0128] Through three independent replicate experiments, the integration efficiency of the 12653 bp exogenous fragment at this site was found to be 34.18%.

[0129] In other embodiments, exogenous genes of different lengths, namely 0.8 kb, 1.9 kb, 4.1 kb, and 6.1 kb, were characterized, and the results are as follows: Figure 4 As shown above, the results indicate that the CRISPR-Tn system has high efficiency in integrating exogenous long fragments into Halomonas bacteria and can be used as a universal long fragment integration tool for constructing specialized industrial chassis bacteria.

[0130] Example 6: Coupling site-specific recombinase FLP for deleting long genomic fragments.

[0131] As mentioned above, CRISPR-Tn-based genome deletion methods rely on the action of the site-specific recombinase FLP. Specifically, when the FLP protein is expressed, the sequence between two FRT sites on the genome changes. Specifically: when the FRT sequences are in the same orientation, the DNA sequence between the FRTs is inverted; conversely, if the two FRT sequences are in opposite orientations, the DNA sequence between the FRTs is deleted. Figure 5 The diagram is shown below. The specific experimental steps are as follows:

[0132] First, the plasmid pQCasTns-FLP, which overexpresses FLP, was constructed. This involved cloning a plasmid downstream of pQCasTns that expresses FLP via the inducible promoter P. Mmp1 The initiated FLP sequence is shown in SEQ ID NO:27. The construction method is the same as in step 3. Then, the sfGFP fragment in the pDoner plasmid is replaced with the FRT sequence (SEQ ID NO:30) to obtain the plasmid pDoner-FRT. Finally, a dual crRNA array is constructed into pDoner-FRT using the goldengate method to form the plasmid pDoner-FRT-crRNA3 / 4.

[0133] In this embodiment, a fragment of approximately 119 kb was deleted from the genome of *Haloxylon ammodendron*. crRNA3 and crRNA4 were targeted flanking the sequence to be deleted, respectively. The sequences are shown in SEQ ID NO:36 and SEQ ID NO:37.

[0134] crRNA3: attcaggatcacatgaacctgctcaaggagtg (SEQ ID NO:36)

[0135] crRNA4:tcaggacttggcatgctgattgccttgatgct (SEQ ID NO:37)

[0136] Further, the pQCasTns-FLP and pDoner-FRT-crRNA3 / 4 plasmids were sequentially transformed into TD1.0 and plated on 60 LB chloramphenicol-spectruminant antibody plates. After single colonies grew, all single colonies were washed off and transferred at a ratio of 1% to 60 LB chloramphenicol-spectruminant liquid medium. After incubation at 37°C for 2 hours, 100 μM IPTG was added to induce FLP expression, and the culture was continued for 16 hours. A small amount of bacterial culture was taken, diluted, and plated on 60 LB chloramphenicol-spectruminant antibody plates. The culture was incubated at 37°C for at least 24 hours until single colonies grew, and then 24 single colonies were randomly selected for PCR verification. Primers are as follows:

[0137] 119KOF:ccgacggttactttaggcatc (SEQ ID NO:50)

[0138] 119KOR: tacgctggctgtagcgtttg (SEQ ID NO:51)

[0139] If the knockout is successful, the target band cannot be amplified; if the knockout is not successful, a 1202 bp band will be amplified. Statistically, the efficiency of deleting a 119 kb genomic fragment is 33.3%.

[0140] In other embodiments, genomic fragments of different lengths, 22kb, 33kb, and 54kb, were knocked out, as shown in the figures. Figure 6 As shown.

[0141] This method can knock out large DNA fragments of 22-119kb in Halomonas, but the knockout efficiency decreases as the fragment length increases.

[0142] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A CRISPR transposon gene integration system, comprising: The vector pQCasTns contains transposase and Cas protein, and the vector pDoner contains functional sequences; The pQCasTns comprises an operator and a T7 terminator connected in sequence, and the operator has the following structure: J23119-TnsA-TnsB-TnsC-TniQ-Cas8-Cas7-Cas6; in, J23119 is the J23119 promoter, TnsA-TnsB-TnsC is the TnsA, TnsB, TnsC transposase complex derived from Vibrio cholerae, and TniQ, Cas8-Cas7-Cas6 is the Cas6, Cas7, Cas8 protein complex. The functional sequence is a gene cargo sequence insertion site and / or a crRNA expression cassette insertion site; When used to integrate long-fragment exogenous genes, the gene cargo sequence is an exogenous gene sequence, and the long-fragment exogenous gene is greater than 10kb; and / or, When used to delete large genomic fragments, the pQCasTns vector clones an FLP protein initiated by the Mmp1 promoter downstream of the gene, and the functional sequence of the pDoner comprises a first FRT sequence, a target gene, and a second FRT sequence linked sequentially; preferably, the first FRT sequence and the second FRT sequence are in opposite directions; the nucleotide sequence of the FRT is SEQ ID NO: 30; and / or, When used to integrate a foreign gene at one or more targets, the crRNA expression cassette comprises a promoter and a foreign gene targeting sequence spaced apart by a spacer sequence, which is SEQ ID NO:

38.

2. The system as claimed in claim 1, wherein, The operon contains a gene with nucleotide sequences SEQ ID NO:1-SEQ ID NO:

14.

3. The system as described in claim 1 or 2, wherein, The nucleotide sequence of the FLP protein encoding gene is SEQ ID NO:

27.

4. The system as described in any one of claims 1-3, wherein, The gene cargo sequence has an upstream recognition site with the nucleotide sequence SEQ ID NO:23 upstream and a downstream recognition site with the nucleotide sequence SEQ ID NO:24 downstream.

5. The system as described in any one of claims 1-4, wherein, The spacer sequence is SEQ ID NO38.

6. The system as described in any one of claims 1-5, wherein, The nucleotide sequence of the crRNA expression cassette is shown in SEQ ID NO:

22.

7. The system as claimed in any one of claims 1-6, wherein, The gene cargo in the pDoner is replaced with the target gene sequence using Gibson assembly technology.

8. The system according to any one of claims 1-7, wherein, The pDoner uses goldengate technology to replace the crRNA sequence to express crRNA corresponding to different targets.

9. The application of the system according to any one of claims 1-8 in gene editing of *Haloxylon ammodendron*; preferably, the gene editing is selected from one or more of large genomic fragment deletion, multi-target genomic gene knockout, multi-target exogenous gene integration, and long fragment exogenous gene integration; preferably, the large genomic fragment deletion is not less than 119kb; preferably, the multi-target exogenous gene integration is the simultaneous integration of exogenous genes from 2, 3, 4, 5, or 6 targets; preferably, the gene length of the exogenous long fragment gene integration is not less than 12kb; preferably, the *Haloxylon ammodendron* strain is the strain with accession number CGMCC No. 4353.

Images