Visual gene knockout system and application thereof

Abstract

The invention provides a visual gene knockout system and application thereof. The visual gene knockout system comprises a recombinant suicide plasmid vector, and the recombinant suicide plasmid vector comprises: (1) an upstream homologous arm sequence and a downstream homologous arm sequence of a gene to be knocked out; and (2) an expression cassette, the expression cassette comprises a promoter element and a fluorescent protein gene, and the promoter element is a constitutive promoter. According to the invention, a fluorescent protein expression cassette is introduced into a suicide plasmid mediated homologous recombination gene knockout system, so that a strain of which the target gene is subjected to expected knockout recombination can generate a clear fluorescence signal, and a screening result can be directly judged through naked eye observation or fluorescence detection equipment; the defect that judgment is carried out only by means of molecular detection is overcome.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a visual gene knockout system and its applications. Background Technology

[0002] Polyhydroxyalkanoates (PHA) are a class of natural polyester materials synthesized and stored intracellularly by microorganisms under specific conditions. They possess good biocompatibility and are fully biodegradable. Their mechanical and thermal properties are similar to some petroleum-based plastics (such as polypropylene), making them one of the most promising biodegradable plastics. Therefore, efficient and low-cost production of PHA is crucial for promoting the industrialization of bio-based materials. Currently, PHA is mainly produced through microbial fermentation. Among the various reported PHA-producing bacteria, *Hookworm Copper-Gropping Bacterium* (…) Cupriavidus necator H16 is one of the most thoroughly studied and widely applied model strains. This strain not only efficiently synthesizes PHA using various organic carbon sources such as sugars, lipids, and organic acids, but also possesses a unique autotrophic growth ability, using hydrogen, carbon dioxide, and oxygen as substrates to fix carbon dioxide and synthesize cellular material and PHA through the Calvin cycle. These characteristics give H16 hookworm copper-eating bacteria significant advantages in reducing raw material costs, decreasing carbon emissions, and aligning with the "carbon neutrality" development strategy. To deeply elucidate the synthesis and regulation mechanisms of PHA, and to improve PHA yield, regulate monomer composition, or reduce production costs through metabolic engineering, precise and efficient gene editing of H16 hookworm copper-eating bacteria is an essential research method. Among these methods, gene knockout, as a fundamental technology for studying gene function, weakening competing metabolic pathways, and reconstructing metabolic networks, plays a crucial role in the genetic modification of this strain.

[0003] Currently, the most widely used and relatively mature gene knockout method for H16 hookworm *Agrobacterium tumefaciens* is suicide plasmid-mediated homologous recombination. This method typically uses a suicide plasmid that cannot replicate autonomously in the host bacterium as a vector. A recombinant fragment containing upstream and downstream homologous sequences of the target gene and resistance selection markers is constructed on the plasmid and introduced into *Agrobacterium tumefaciens* cells via conjugation transfer. Subsequently, relying on homologous recombination, the target gene is replaced or deleted by a resistance gene, thus achieving gene knockout. Finally, the obtained strain is usually identified by PCR amplification combined with electrophoresis analysis to confirm whether the target gene has been successfully knocked out. The above method is a conventional technique for gene knockout operations performed by those skilled in the art. However, existing suicide plasmid-mediated homologous recombination gene knockout methods still have the following shortcomings: (1) The screening process is complicated and time-consuming. From the start of conjugation transfer to obtaining a positive clone verified by PCR, it usually takes 10 to 14 days. The process requires repeated streak plating, strain culture and molecular biological operations, which is time-consuming and labor-intensive. (2) The identification methods are inefficient and have limited reliability. Currently, the main method of identification is based on PCR and electrophoresis results. However, due to the complex genome structure of Hookworm Copper-Loving Bacteria and the high sequence homology, non-specific bands or primer dimers are easily generated during PCR amplification, resulting in complex electrophoresis background and difficulty in interpreting the results. Further sequencing confirmation is often required, which increases experimental costs and the risk of errors. (3) Low screening throughput. The above methods are difficult to rapidly screen a large number of candidate colonies. Usually, only a small number of colonies can be randomly selected for PCR verification, which limits the efficiency and scale of gene knockout experiments.

[0004] Therefore, there is an urgent need to provide a screening method that can quickly and intuitively determine homologous recombination events in H16 hookworm copper-loving bacteria. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention proposes a visual gene knockout system and its applications.

[0006] This invention provides a visual gene knockout system, including a recombinant suicide plasmid vector, wherein the recombinant suicide plasmid vector comprises: (1) The upstream and downstream homologous arm sequences of the gene to be knocked out; (2) Expression cassette, which includes a promoter element and a fluorescent protein gene, wherein the promoter element is a constitutive promoter; the constitutive promoter can achieve continuous and stable transcription in hookworm copper-loving bacteria.

[0007] In some embodiments, the nucleotide sequence of the promoter element is shown in SEQ ID No. 3.

[0008] In some embodiments, the fluorescent protein gene is sf Any one of the GFP gene, mCherry gene, and BFP gene; preferably... sf GFP gene.

[0009] In some embodiments, the recombinant suicide plasmid vector uses pK18mobsacB as its backbone.

[0010] In some embodiments, the lengths of the upstream and downstream homologous arm sequences of the gene to be knocked out are 800-1500 bp.

[0011] This invention also provides a visual gene knockout screening method for hookworm copper-loving bacteria, comprising the following steps: (1) Connect the upstream homologous arm sequence of the gene to be knocked out, the promoter element, the fluorescent protein gene, and the downstream homologous arm sequence of the gene to be knocked out in sequence, and introduce them into the backbone to obtain the recombinant plasmid; (2) Transform the recombinant plasmid described in step (1) into Escherichia coli to obtain the donor strain; (3) Combine the donor strain described in step (2) with hookworm copper-loving bacteria to screen for fluorescent target gene knockout transformants.

[0012] This invention also provides the application of the described visualization gene knockout system in gene editing of *Hookworm Copper-Loving Bacteria*; preferably, the *Hookworm Copper-Loving Bacteria* is... Cupriavidus necator H16.

[0013] In some implementations, the gene editing is gene knockout.

[0014] In summary, compared with the prior art, the present invention achieves the following technical effects: (1) This invention introduces a fluorescent protein expression cassette into a suicide plasmid-mediated homologous recombination gene knockout system, enabling strains that have undergone the expected knockout recombination of the target gene to produce a clear fluorescent signal, thereby allowing the screening results to be directly determined by visual observation or fluorescence detection equipment; the identification time of positive clones is shortened from several hours (PCR, electrophoresis) in traditional methods to several minutes. It achieves "what you see is what you get" screening.

[0015] (2) This invention uses fluorescence to rapidly screen candidate strains, which can eliminate a large number of colonies that have not undergone the target recombination in the early stage, reducing repeated streak culture and PCR verification steps, thereby effectively shortening the overall experimental cycle from conjugation transfer to obtaining the target gene knockout strain. There is no need to perform cumbersome PCR experiments and gel electrophoresis; the core screening can be completed with the naked eye, reducing the dependence on professional equipment and reagents.

[0016] (3) Fluorescent expression and gene editing are strictly coupled, avoiding band misjudgment caused by non-specific amplification and primer dimers in PCR. The results are simple and clear to interpret, with extremely high accuracy.

[0017] (4) This invention is based on the existing mature suicide plasmid homologous recombination strategy. It does not change the basic genetic principle of gene knockout. It can be directly combined with the knockout vector system and experimental procedure commonly used in hookworm copper-loving bacteria. It has good versatility and operability.

[0018] (5) The visualization gene knockout system of the present invention is applicable to the knockout study of different functional genes in hookworm copper-loving bacteria, and can provide a universal and efficient technical tool for the analysis of PHA synthesis regulation mechanism and metabolic engineering modification.

[0019] (6) The present invention can perform a rapid one-time scan of hundreds or thousands of colonies during the plate culture stage, and directly identify a few positive clones from a large number of transformants, achieving a truly high-throughput initial screening. In contrast, the traditional method that relies on picking colonies one by one and performing PCR identification cannot reach the above level in terms of throughput and efficiency. Attached Figure Description

[0020] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a visual flowchart of the gene knockout process of the present invention.

[0022] Figure 2 For the present invention pK18-Δ phaP ::P j5[C2] - sf GFP plasmid map.

[0023] Figure 3 This is a flowchart illustrating the bacterial conjugation process of the present invention.

[0024] Figure 4 In this invention, screening was performed on salt-free LB medium supplemented with fructose. The presence of green fluorescent colonies indicated successful knockout of positive strains, while white colonies indicated unsuccessful knockout of negative strains.

[0025] Figure 5 For the PCR identification results of this invention, respectively using the locations located in sf GFP, plasmid- phaP1 plasmid- sf GFP and phaP1 The verification primers were used for PCR amplification; colonies 1, 4, 5, and 6 were positive colonies that had been successfully knocked out, while colonies 2, 3, and 7 were negative colonies that had not been knocked out. Detailed Implementation

[0026] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0027] Reference Figure 1The process phaP1 Visualizing gene knockout: The specific steps are as follows: 1. Vector plasmid construction (1) Amplification of homologous arms and fluorescent protein fragments phaP1 Upper homologous arm sequence: as shown in SEQ ID No. 1.

[0028] phaP1 Lower homologous arm sequence: as shown in SEQ ID No. 2.

[0029] P j5[C2] Promoter sequence: as shown in SEQ ID No. 3.

[0030] Superfolded green fluorescent protein ( sf GFP gene sequence: as shown in SEQ ID No. 4.

[0031] P j5[C2] - sf GFP-terminator sequence: as shown in SEQ ID No. 5.

[0032] Primer design: Amplification phaP1 Upper homologous arm (UHA) primers: Top primer F1: as shown in SEQ ID No. 6.

[0033] Lower primer R1: as shown in SEQ ID No. 7.

[0034] Amplification phaP1 Down homologous arm (DHA) primers: Top primer F2: as shown in SEQ ID No. 8.

[0035] Lower primer R2: as shown in SEQ ID No. 9.

[0036] Amplification P j5[C2] - sf GFP primers: Top primer F4: as shown in SEQ ID No. 10.

[0037] Lower primer R4: as shown in SEQ ID No. 11.

[0038] The PCR amplification reaction system is shown in Table 1.

[0039] Table 1. PCR reaction system (KOD DNA Polymerase)

[0040] The PCR reaction program settings are shown in Table 2.

[0041] Table 2 PCR reaction procedure (KOD DNA Polymerase)

[0042] PCR product recovery: Briefly centrifuge the PCR products, add them to the agarose gel wells, and visualize the electrophoresis results under UV light. Cut off the gel block containing the target fragment and recover the fragment using a rapid agarose gel DNA recovery kit. The specific steps are as follows: (1) Weigh the gel block and transfer it to a 1.5 mL centrifuge tube. Calculate that 100 mg of gel block is equivalent to 100 μL volume, and add 1 to 2 volumes of Buffer GDP. Incubate in a water bath at 50 to 55°C for 10 to 15 min to allow the gel block to dissolve completely. During the water bath, invert the tube 3 times to accelerate the dissolution process.

[0043] (2) Briefly centrifuge to collect droplets on the tube wall. Place the HiPure DNA Mini Column into a 2 mL centrifuge tube and transfer ≤700 μL of the sol solution into the column. 12000 × g Centrifuge for 30-60 seconds.

[0044] (3) (For sol solutions exceeding 700 μL) Discard the filtrate, reattach the column to the 2 mL centrifuge tube, and transfer the remaining sol solution to the column. 12000 × g Centrifuge for 30-60 seconds.

[0045] (4) Discard the filtrate and place the column back into the 2 mL centrifuge tube. Add 150 μL of Buffer GDP to the column. Let stand for 1 min. 12000 × g Centrifuge for 30-60 seconds.

[0046] (5) Discard the filtrate and reattach the column to the 2 mL centrifuge tube. Add 600 μL of Buffer DW2 (diluted with anhydrous ethanol) to the column. 12000 × g Centrifuge for 30-60 seconds.

[0047] (6) Discard the filtrate and reattach the column to the 2 mL centrifuge tube. Add 300 μL of Buffer DW2 (diluted with anhydrous ethanol) to the column. 12000 × g Centrifuge for 2 minutes.

[0048] (7) Place the column into a 1.5 mL centrifuge tube and add 15–30 μL of Elution Buffer to the center of the column membrane. Incubate for 2 min. 12000 × g Centrifuge for 1 min. Discard the column and preserve the DNA. 20℃.

[0049] Enzyme digestion of plasmid backbone: The circular plasmid pk18mobsacB was linearized using a restriction endonuclease, resulting in... sf The GFP fragment can be inserted into a specific location on the vector. The reaction conditions are: enzyme digestion at 37°C for at least 3 hours. The enzyme digestion reaction system is shown in Table 3.

[0050] Table 3 Enzyme digestion system

[0051] The purified PCR product and linearized vector DNA were ligated using infusion enzyme at 50°C for 15 min. The ligation system is shown in Table 4. Table 4 Enzyme ligation system

[0052] To ensure that, under the same volume conditions, the concentration ratio of homologous arms:GFP:vector is 1:1:1:2, the concentration ratio of target fragment to linearized vector fragment is preferably 1:1, and the final reaction volume is 5 μL.

[0053] Recombinant plasmid (pK18-Δ) phaP ::P j5[C2] - sf Transformation of GFP (plasmid map as shown) Figure 2 (as shown) (1) Place competent cells (E. coli DH5α) on ice to thaw for 10 min; (2) The product (pK18-Δ) obtained in the previous step by in-fusion enzyme ligation phaP ::P j5[C2] - sf Add GFP to 40 μL of thawed competent cells, gently tumble to mix, incubate on ice for 30 min, heat shock at 42°C for 90 s in a metal bath, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C and 200 rpm for 1 hour. After centrifugation, transfer to LB solid agar plates containing the appropriate antibiotic and incubate at 37°C. (3) After 12-16 hours, once single colonies have grown on the plate, select 6-8 colonies that emit green fluorescence for colony PCR, then run the gel to identify and screen positive colonies. The PCR system is shown in Table 5, and the PCR procedure is shown in Table 6.

[0054] (4) Add the identified positive colonies to LB (containing the corresponding resistance) liquid medium and incubate at 37°C in a shaker for 12-16 hours. After reaching the logarithmic growth phase, take 1 mL of the bacterial solution, mix it thoroughly with 50% glycerol, and then... Store at 80°C. The remaining bacterial culture will be used for plasmid extraction and sequencing. The plasmid extraction procedure followed the instructions provided by the TIANGEN rapid plasmid mini-prep kit.

[0055] Table 5. Colony PCR system (2×TransStart® FastPfu Fly PCR SuperMix)

[0056] Table 6 Colony PCR Program (2×TransStart® FastPfu Fly PCR SuperMix)

[0057] The constructed plasmid was transformed into E. coli S17-1. The specific steps are as follows: (1) Preparation of competent Escherichia coli S17-1 cells: a. From In glycerol bacteria stored at 80°C, streak the inoculation loop onto LB agar plates (without antibiotics) and incubate upside down at 37°C for 12-16 hours.

[0058] b. Pick a single colony and inoculate it into 5 mL of LB liquid medium. Incubate overnight at 37°C with shaking at 200 rpm.

[0059] c. Transfer the overnight culture to 50 mL of fresh LB medium at a ratio of 1:100, and incubate at 37°C with shaking at 200 rpm. When the OD600 of the bacterial culture reaches 60%,... 00 Stop culturing when the pH reaches 0.35~0.45.

[0060] d. Aliquot the bacterial culture into pre-chilled centrifuge tubes, incubate in an ice-water bath for 10 min, then incubate at 2700 × 10⁻⁶. g Centrifuge at 4℃ for 10 min to collect bacterial cells, discard the supernatant, and retain the precipitate.

[0061] e. Resuspend in 30 mL of ice bath 80 mM, 20 mM MgCl2-CaCl2.

[0062] f. Ice water bath for 10 min, 2700 × g Centrifuge at 4℃ for 10 min to collect bacterial cells, discard the supernatant, and retain the precipitate.

[0063] g. Gently suspend the sample in 2 mL of ice bath 0.1 M CaCl2.

[0064] h. Mix 200 μL of bacterial culture with 200 μL of 50% glycerol in an ice bath, and store at [location missing]. 80℃.

[0065] (2) Transformation of Escherichia coli S17-1: a. The plasmid (pK18-Δ) constructed in the previous step... phaP ::P j5[C2] - sf Add GFP to 400 μL of thawed E. coli S17-1 competent cells, gently tumble to mix, and incubate on ice for 30 min.

[0066] b. Place in a metal bath at 42℃ for 90 s for heat shock, add 800 μL of non-resistant LB liquid medium, and incubate at 37℃ and 200 rpm for 1 hour for recovery.

[0067] c. After removal, centrifugation is performed, followed by transfer to LB solid plate medium containing the appropriate antibiotics, and incubation is carried out in a 37°C incubator. d. After 12-16 hours, once single colonies have grown on the plate, select 6-8 colonies that emit green fluorescence for colony PCR, then run a gel to identify and screen for positive colonies.

[0068] (3) Joining (e.g.) Figure 3 (As shown), the specific steps are as follows: a. Donor strain culture: From the *E. coli* S17-1 / pK18 strain constructed in the previous step... Δ phaP ::P j5[C2] sf Single clones were selected from the GFP strain and inoculated into 10 mL of LB medium containing the corresponding antibiotic (kanamycin, 10 μg / mL), and cultured overnight at 37°C with shaking at 200 rpm.

[0069] b. Recipient strain culture: Select a single clone of H16 hookworm copper-loving bacteria and inoculate it into 10 mL of tryptone soy broth (TSB) containing the corresponding antibiotic (gentamicin, 10 μg / mL), and culture overnight at 30°C with shaking at 200 rpm.

[0070] c. Take 1 mL of overnight cultured E. coli S17 1 / pK18 Δ phaP ::P j5[C2] sf Transfer the GFP bacterial culture to a 1.5 mL centrifuge tube and centrifuge at 12,000 × 10⁻⁶. g Centrifuge for 1 min to collect bacterial cells and discard the supernatant. Gently resuspend the bacterial cells in 1 mL of fresh LB medium and wash once, then centrifuge again and discard the supernatant to remove residual antibiotics. Repeat this washing step twice. Finally, resuspend the bacterial pellet in 200 μL of fresh LB medium.

[0071] d. Transfer 1 mL of overnight cultured hookworm copper-loving bacterium H16 to a 1.5 mL centrifuge tube and centrifuge at 12,000 × 10⁻⁶. g Centrifuge for 1 min to collect bacterial cells and discard the supernatant. Gently resuspend the bacterial cells in 1 mL of fresh TSB medium and wash once. Centrifuge again and discard the supernatant to remove residual antibiotics. Repeat this washing step twice. Finally, resuspend the bacterial pellet in 200 μL of fresh TSB medium.

[0072] e. Take 100 μL of each bacterial culture and mix them together. Add the mixed bacterial culture to the center of TSB agar medium, dry it, and then place it in a 30°C incubator for 6-8 hours.

[0073] f. Collect all bacteria grown on TSB agar medium into centrifuge tubes and resuspend them in 5 mL of TSB medium.

[0074] g. Take 50-100 μL of resuspended bacterial solution and spread it evenly on Simmons citrate agar (SCA) plates containing kanamycin (200 mg / L). Incubate at 30°C for 2-3 days and screen for colonies that have undergone the first homologous recombination (single exchange).

[0075] h. Pick a single colony that turns SCA medium blue and inoculate it into TSB medium. Incubate at 30°C with shaking at 200 rpm for 12 hours. Repeat this subculture step three times to promote the second homologous recombination (double crossover).

[0076] i. Take a small amount of bacterial culture and adjust the OD. 600 The solution was diluted to 0.05 and inoculated into LB medium without NaCl but with added sucrose, and cultured at 30°C for 2 days.

[0077] j. Verification: such as Figure 4 As shown, the colony emits a bright green fluorescence that is clearly visible to the naked eye, indicating that the colony is... phaP The gene was successfully replaced with a "promoter- sf GFP-positive engineered bacteria. Using P j5[C2] The colony fluorescence of the promoter is strong. If the colony does not emit green fluorescence at all, it means that the editing has failed and the colony has been restored to a wild-type negative colony.

[0078] To verify the accuracy of the visual screening, several fluorescent and non-fluorescent colonies selected using the above method were randomly chosen. Using their bacterial suspensions as templates, the images were then analyzed using [the method described above]. sf GFP, plasmid- phaP1 plasmid- sf GFP and phaP1 The verification primers were used for PCR amplification. Figure 5 As shown, the positive engineered bacteria should amplify a band of approximately 2.2 kb (corresponding to UHA- sf The wild-type control bacteria amplified a band of approximately 2.8 kb (containing complete GFP-DHA), while the wild-type control bacteria amplified a band of approximately 2.8 kb (containing complete GFP-DHA). phaP (Gene). Sequencing results further confirmed the precise editing boundaries, with a positive concordance rate of 100%.

[0079] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0080] sequence list SEQ ID No.1 GGCGCGCGTGATATTGTGCGGCCAGGCTTACGGTCTGCGCGTGGACCGCAACCGTGTCCTCGATCTGGTTGCCGTAGCCGCCCGCCATCGCCACCGCCACCGGCAACTGGCGTGCATGCGCGGCATCGAACACCAGCCGGTCGCGCCGTGCCAGGCCCGCCAAGGTCAGCCTGAGCCGCCCGAGGCGATCGCCCTCATGCGGATCGGCGCCGGCCAGGTAGATGATCAGCTCGGGATCGAAGCGGCTGAACAGCGTGTCCAGCGCCGCCTGCAGCGCCTGCGCATAGGTATCGTCGTCGCAGCCGTCCGGCAGGCCGACGTCCAGGTCGCTGGCCTCTTTGCGGAACGGATAGTTCTTCTCGCCATGCAGCGACAACGTGAACACGGACGGATCGCCTTGCAGGATCGACGCGGTGCCGTTGCCCTGGTGCACATCCAGGTCGACCACGGCCACGCGGCGCACGGCGCCATCGCGCTGCAGCACGCGCGCCGCAATCGCGGCATCGTTGAACACGCAGAAGCCGCCGCCCTTGTCGGCATACGCATGGTGGGTGCCGCCCGCCAGGTTCACGGCAATGCCTTCGCGCAGCGCCGTCCGGCAGGCCTCGATGGTGGCGCCTGCGGAGCGCCGCGAGCGTTCCACCATGGCCTCGGACCACGGGAAGCCGATCTCGCGCTGGCGCGCCGCGTCGAGCGTGCCGGCTGACGCGGCCTGCACGTACCCGGGCGTGTGCGCCAGCAACAAGGCATCGTCGCCCGCGCGCGGCGCCTCAACCAGGCGCAGCCCCGGCACCTGCGCCGCGACGGCATCGCGCAGCATGCTGTACTTGCGCATCGGGAAACGGTGCCCGGGTGGCAGTGGCAGCACAAAATGGTCGGCATAGAAAGCGAGCATGGAAGTGGCCTGGGCGGTTCTGTTCACGTCTTTGTTAGTTCCCGGCGCGGCCATCCGTGCGGGCGCGGGCAATCCGCGATGGTAGCACCCCTGCATGGCCCTCGC。 SEQ ID No.2 TAACTGCCTGCGTTGAAGATGGACCGGCTGCGGCCGGTCCGTTGGCAAAGCATATCGACGCCTGGCGTTTGCGGTGTGTTTTGCCAACGATGAAGGTAGTGCCCTGACTGAGTTGCATCGGTGCTGCCTTGTCCGCCGATGTCTCCTCGGTACCGCGGTCTCCTTGTCCAAAGGTATCGTTAAACCCGACCTCTACAGGTCGGGCTTTTTTTTTGCTCTTCACCTTTCCATCAGGTTGGTCCCGGTGAACAGCGGCCGTGGGCCCCGAGCATGCATGCCGGCCTATTCTCCGATGCGCACAGGAATTCGCCGCCGCCCGAACTGACGCTCAAAATTCCCGAAACGTCCCGCAATCTGTGCAAAGCAGTCCGGGCAAGTTCCCGTGGGAGTCAGGCGATAGCTTTCGATCGCGTGCCAGTCGCGCACGATGAGCTGCGCGCGGCAAGCGGGGCAATGGGTGGTGGCACCGGCGGTGTCGTGCACGTTGCCGGTGTAGACGTAATGCAGTCCCTCCGCCAGCGCGTGCTTGCGGGCGCGCGCAAGGGTGGAACATGGTGTCGGCGGCACGTCGCGCATCTTGTAGTCCGGATGGAATGCGGTGAAGTGCAGCGGCACGTCGGGACCAAGCTCCCTGGCGATCCACCGGGCCTCGGCGCGAATCTCGTCATCGCTGTCGTTCTTGCCGGGAATGAGCAGCGTCGTGATCTCGAGCCAGACATCGGTTTCGTGCTTCAGGTACTGGAGCGTCTCCAGTACCGGCTGCAGGTGCGCCCCGGTGAAGGCAACATAGAACGCGTCGCTGAAGCCTTTCAGGTCGACGTTTGCCGCATCCATCCTGGCGTAGAAATCACGCCGCGCCTCGGCGCCCATATATCCTGCGGTCACCGCCACCGTCCTGATGCCCAGTTGGTGGCAGGCATCGGCTACGTCCATGGCGTACTCGGCGAAGATCACCGGGTCGTTGTAGGTGAAGGCCA SEQ ID No.3 AGCGGATATAAAAACCGTTATTGACACAGGTGGAAATTTAGAATATACTGTTAGTAAACCTAATGGATCGACCTTAGATCTTTTAAGAAGGAGATATACAT SEQ ID No.4 ATGCGTAAAGGCGAAGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTGGCGAGGGTGAAGGTGACGCAACTAATGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGACTCTGGTAACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGCTATGTGCAGGAACGCACGATTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACCCTGGTAAACCGCATTGAGCTGAAAGGCATTGACTTTAAAGAAGACGGCAATATCCTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAATGTTTACATCACCGCCGATAAACAAAAAAATGGCATTAAAGCGAATTTTAAAATTCGCCACAACGTGGAGGATGGCAGCGTGCAGCTGGCTGATCACTACCAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTGCTGCCAGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCGAACGAGAAACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAGCGGGCATCACGCATGGTATGGATGAACTGTACAAATGA SEQ ID No.5 AGCGGATATAAAAACCGTTATTGACACAGGTGGAAATTTAGAATATACTGTTAGTAAACCTAATGGATCGACCTTAGATCTTTTAAGAAGGAGATATACATATGCGTAAAGGCGAAGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTGGCGAGGGTGAAGGTGACGCAACTAATGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGACTCTGGTAACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGCTATGTGCAGGAACGCACGATTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACCCTGGTAAACCGCATTGAGCTGAAAGGCATTGACTTTAAAGAAGACGGCAATATCCTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAATGTTTACATCACCGCCGATAAACAAAAAAATGGCATTAAAGCGAATTTTAAAATTCGCCACAACGTGGAGGATGGCAGCGTGCAGCTGGCTGATCACTACCAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTGCTGCCAGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCGAACGAGAAACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAGCGGGCATCACGCATGGTATGGATGAACTGTACAAATGATGATAAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCG SEQ ID No.6 CATGCCTGCAGGTCGACTCTAGAGGCGCGCGTGATATTGTGCGGCCAGGCTTA SEQ ID No.7 GCGAGGGCCATGCAGGGGTGCTACCAT SEQ ID No.8 TAACTGCCTGCGTTGAAGATGGA SEQ ID No.9 TACCCGGGGATCCTCTAGATGGCCTTCACCTACAACGACCCGGTGATCTT SEQ ID No.10 CACCCCTGCATGGCCCTCGCAGCGGATATAAAAACCGTTATTGACA SEQ ID No.11 TTCAACGCAGGCAGTTACGCAGAAAGGCCCACCCGAAGGTGA

Claims

1. A visual gene knockout system, characterized in that, Includes a recombinant suicide plasmid vector, wherein the recombinant suicide plasmid vector comprises: (1) The upstream and downstream homologous arm sequences of the gene to be knocked out; (2) Expression cassette, which includes a promoter element and a fluorescent protein gene, wherein the promoter element is a constitutive promoter.

2. The visualized gene knockout system according to claim 1, characterized in that, The nucleotide sequence of the promoter element is shown in SEQ ID No.

3.

3. The visualized gene knockout system according to claim 1, characterized in that, The fluorescent protein gene is sf Any one of the GFP gene, mCherry gene, and BFP gene.

4. The visualized gene knockout system according to claim 1, characterized in that, The recombinant suicide plasmid vector uses pK18mobsacB as its backbone.

5. The visualized gene knockout system according to claim 1, characterized in that, The upstream and downstream homologous arm sequences of the gene to be knocked out are 800-1500 bp in length.

6. A visual gene knockout screening method for hookworm copper-loving bacteria, characterized in that, Includes the following steps: (1) Connect the upstream homologous arm sequence of the gene to be knocked out, the promoter element, the fluorescent protein gene, and the downstream homologous arm sequence of the gene to be knocked out in sequence, and introduce them into the backbone to obtain the recombinant plasmid; (2) Transform the recombinant plasmid described in step (1) into Escherichia coli to obtain the donor strain; (3) Combine the donor strain described in step (2) with hookworm copper-loving bacteria to screen for fluorescent target gene knockout transformants.

7. The application of the visualization gene knockout system according to any one of claims 1 to 5 in gene editing of hookworm copper-eating bacteria.

8. The application according to claim 7, characterized in that, The gene editing referred to is gene knockout.

Images