Application of OsmiR159-GAMYBL2-RGA1 signal channel in regulation and control of drought tolerance of rice
By utilizing the OsmiR159-GAMYBL2-RGA1 signaling pathway, OsmiR159 negatively regulates the expression of the OsGAMYBL2 gene. Combined with gene editing technology to downregulate the expression of OsmiR159 and RGA1, the unclear mechanism of drought resistance regulation in rice was resolved, and significant drought resistance enhancement and breeding strategies were achieved, leading to the development of new water-saving and drought-resistant rice varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI ACAD OF AGRI SCI
- Filing Date
- 2026-03-10
- Publication Date
- 2026-05-12
AI Technical Summary
In rice, the functions and regulatory mechanisms of the OsmiR159 and RGA1 signaling pathways in drought stress response remain unclear, limiting the potential for genetic improvement of drought resistance in rice.
Through the OsmiR159-GAMYBL2-RGA1 signaling pathway, OsmiR159 negatively regulates the expression of the OsGAMYBL2 gene, thereby relieving the inhibition of RGA1 and reducing the negative regulatory effect of RGA1 on drought resistance. Combined with gene editing technology, the expression of OsmiR159 and RGA1 is downregulated, thus improving the survival rate of rice under drought stress.
It significantly enhances the survival rate of rice under drought stress, provides clear genetic manipulation targets and molecular breeding strategies, achieves extremely significant drought resistance, and can be used for rapid screening and identification of drought resistance, and breeding of new water-saving and drought-resistant rice varieties.
Smart Images

Figure CN122012595A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant gene breeding technology, specifically involving the application of the OsmiR159-GAMYBL2-RGA1 signaling pathway in regulating drought resistance in rice. Background Technology
[0002] Drought is one of the most significant abiotic stresses constraining global agricultural production. With intensifying climate change, the frequency, duration, and intensity of droughts are increasing, posing a serious threat to food security. Rice, the staple food of nearly half the world's population, requires a large amount of water for its growth and development and is exceptionally sensitive to drought stress. Therefore, a thorough understanding of the molecular mechanisms of drought resistance in rice, and the subsequent development of new drought-resistant and water-saving rice varieties, is of great strategic significance for ensuring food security in my country and the world.
[0003] Plants have evolved complex mechanisms to cope with drought stress, including but not limited to: morphological adaptive changes, physiological and biochemical regulation, and stomatal movement regulation to reduce water transpiration. At the molecular level, drought stress triggers extensive transcriptomic, proteomic, and metabolomic reprogramming, involving a large number of transcription factors, kinases, and non-coding RNAs.
[0004] MicroRNAs are a class of endogenous non-coding small RNAs, approximately 21-24 nucleotides in length, that play crucial regulatory roles in plant growth, development, metabolism, and stress responses by mediating the cleavage or translational repression of target gene mRNAs. In drought responses, several miRNAs have been shown to participate in regulation; for example, the miR396 / GRF module, miR156 / SPL module, and miR393 have been reported to be associated with drought tolerance in crops such as Arabidopsis thaliana and maize. However, in rice, the specific functions and downstream regulatory networks of most drought-responsive miRNAs remain unclear, limiting their potential application in the genetic improvement of drought tolerance in rice.
[0005] Heterotrimeric G proteins are conserved molecular switches for signal transduction in eukaryotes. In rice, the gene RGA1 (also known as D1), which encodes the α subunit of the G protein, has been reported to participate in the regulation of various agronomic traits. Studies have shown that the RGA1 loss-of-function mutant (d1) exhibits enhanced drought tolerance during the vegetative growth stage. However, the upstream regulators of RGA1 and the precise molecular mechanisms by which it regulates drought tolerance are not fully elucidated, especially its association with miRNA regulatory networks.
[0006] OsmiR159 is a highly conserved miRNA family in plants, whose core function is to target and regulate GAMYB transcription factors, participating in plant development, hormone responses, and stress adaptation. In Arabidopsis, miR159 participates in the ABA signaling pathway and affects stomatal closure; however, whether OsmiR159 plays a role in drought tolerance in rice, how it plays this role, and whether it is associated with known drought-related pathways (such as G protein signaling) are currently unknown, representing a technological gap in this field.
[0007] Against this background, this application, through systematic genetic, molecular and physiological experiments, elucidates for the first time a novel drought-resistant regulatory pathway connecting miRNA, transcription factors and G protein signals. Based on this discovery, a practical molecular breeding strategy for drought-resistant rice has been developed, providing new theoretical basis and technical means for coping with drought stress and cultivating green super rice. Summary of the Invention
[0008] To fill the current research gap in the function and mechanism of rice drought resistance regulation, this application provides an application of the OsmiR159-GAMYBL2-RGA1 signaling pathway in regulating rice drought resistance. This achievement has extremely high economic benefits in terms of coping with drought stress and rice yield.
[0009] Firstly, this application provides an application of the OsmiR159-GAMYBL2-RGA1 signaling pathway in regulating drought resistance in rice, wherein the regulation is achieved through the following methods:
[0010] OsmiR159 negatively regulates the expression of the OsGAMYBL2 gene, relieving the inhibition of RGA1 gene transcription by the OsGAMYBL2 protein, thereby reducing the negative regulatory effect of drought tolerance mediated by the RGA1 gene.
[0011] Furthermore, the regulation aims to enhance the survival rate of rice under drought stress.
[0012] Furthermore, the OsGAMYBL2 protein inhibits RGA1 transcription by binding the MYB-binding motif in the RGA1 promoter through its R2R3 domain.
[0013] Secondly, this application provides a method for improving the drought resistance of rice by downregulating the expression of OsmiR159 in rice and / or downregulating the expression of the RGA1 gene in rice through any of the above-described regulatory methods, thereby improving the survival rate of rice under drought stress.
[0014] Furthermore, the downregulation of OsmiR159 expression is achieved by inhibiting the activity of OsmiR159 or reducing its accumulation level;
[0015] And / or downregulation of RGA1 expression is achieved by inhibiting the transcription or translation of the RGA1 gene.
[0016] Furthermore, the downregulation of OsmiR159 expression is achieved through short tandem target mimicry (STTM) technology or gene editing technology;
[0017] And / or the downregulation of RGA1 expression is achieved through gene editing technology or RNA interference technology.
[0018] Thirdly, this application provides a method for breeding drought-resistant rice, comprising the following steps:
[0019] a) Provide rice materials with downregulated OsmiR159 expression, and / or provide rice materials with downregulated RGA1 gene expression;
[0020] b) Hybridize the rice material provided in step a) with the target rice variety;
[0021] c) Screen for plants in their offspring that exhibit low expression of OsmiR159 and / or RGA1 and improved drought tolerance.
[0022] Furthermore, the rice material with downregulated OsmiR159 expression is the material obtained by any of the methods described above for improving the drought resistance of rice.
[0023] Furthermore, the rice material with downregulated RGA1 gene expression is the material obtained by any of the above methods for improving rice drought resistance.
[0024] Fourthly, this application protects a biological material for implementing the above-described methods for improving the drought resistance of rice or breeding drought-resistant rice, wherein the biological material is a recombinant vector containing an STTM sequence targeting OsmiR159, or a CRISPR vector containing an sgRNA sequence targeting the RGA1 gene, or a host cell containing the vector.
[0025] This application has the following beneficial effects:
[0026] 1. This application is the first to systematically elucidate and experimentally verify the complete molecular mechanism by which the novel signal transduction pathway “OsmiR159→OsGAMYBL2→RGA1” regulates drought resistance in rice, filling a knowledge gap in this field and organically linking the miRNA regulatory network with the G protein signaling pathway.
[0027] 2. This application clarifies that OsmiR159 and RGA1 are two highly efficient negative regulators of drought tolerance, providing two clear and reliable genetic targets for molecular breeding of drought-resistant rice. Compared with screening QTLs with unknown functions, the targets provided in this application have the advantages of clear mechanisms and predictable effects.
[0028] 3. The genetic manipulations of key nodes in this pathway described in this application can produce extremely significant drought resistance effects, as illustrated in the following examples:
[0029] The OsmiR159 downregulated line (STTM159) achieved a 100% survival rate after severe drought treatment, while the wild-type control (ZH11) had a 0% survival rate.
[0030] The RGA1 knockout line (RGA1KO) also showed a 100% survival rate;
[0031] Such a near-life-or-death phenotypic difference is extremely rare among reported drought-resistant genes, demonstrating the core role of this pathway in drought resistance regulation.
[0032] More importantly, genetic reversion experiments have demonstrated that overexpression of RGA1 (RGA1OE / S) in the STTM159 background can completely restore its drought-resistant phenotype to the wild-type sensitive level, confirming the genetic epistatic relationship of OsmiR159 functioning through RGA1 from both positive and negative perspectives, reflecting the strong logic and synergy within the pathway.
[0033] 4. This application provides two independent and effective technical pathways: “downregulation of OsmiR159” and “downregulation of RGA1”. Both methods are based on clear molecular mechanisms and have been experimentally proven to be effective, providing flexible options for breeding. The most suitable strategy can be selected according to different variety backgrounds and breeding objectives.
[0034] 5. This application not only has important theoretical value, but the drought-resistant molecular breeding method developed can be directly applied to rice variety improvement. It has significant practical application value for breeding new water-saving and drought-resistant rice varieties, coping with drought disasters, and ensuring food security. In addition, the key genes of this pathway can be used as molecular markers for rapid screening and identification of drought resistance in large-scale germplasm resources, thus accelerating the breeding process. Attached Figure Description
[0035] Figure 1 An analysis of the expression patterns of OsmiR159 family members and their target gene OsGAMYBL2 under drought stress;
[0036] Figure 2 Figure showing the drought resistance of transgenic plants with OsmiR159 downregulation (STTM159, STTM159N) and overexpression (miR159dOE);
[0037] Figure 3Figure showing the drought tolerance of plants with different genetic modifications to the OsGAMYBL2 gene (overexpression of GAMYBL2OE, RNA interference of GAMYBL2RNAi, and gene knockout of GAMYBL2KO);
[0038] Figure 4 A diagram illustrating molecular evidence for OsGAMYBL2 transcriptional repression of the RGA1 gene;
[0039] Figure 5 Figures illustrating the drought tolerance of RGA1 gene-edited knockout plants (RGA1KO) and overexpressing plants (RGA1OE);
[0040] Figure 6 The graph shows the expression levels of the RGA1 gene in plants that overexpress RGA1 (RGA1OE) and those that revert to expression in the STTM159 background (RGA1OE / S).
[0041] Figure 7 This diagram validates the genetic reversion effect of RGA1 overexpression (RGA1OE / S) on drought tolerance phenotype in the STTM159 background.
[0042] Figure 8 This is a plasmid map of the plant expression vector pCAMBIA1301-35S-NOS used in this application. Detailed Implementation
[0043] The following examples, 1-5, and comparative examples 1-4, are illustrated in conjunction with the appendix. Figure 1-8 This application is further elaborated upon, but not limited thereto, and the various sub-sources used are shown below:
[0044]
[0045] Performance testing
[0046] The transgenic rice plants obtained from each example were used as test subjects, and the drought resistance and related molecular mechanisms of rice were systematically evaluated according to the following experimental methods:
[0047] 1. Expression analysis of OsmiR159 and its target genes under drought stress
[0048] To investigate whether OsmiR159 participates in the drought response of rice, a drought treatment experiment was conducted using the japonica rice variety 'Zhonghua 11' (ZH11) as the material, as detailed below:
[0049] First, stop watering the rice seedlings that have been growing for 3 weeks. Then, collect aboveground samples at 0 hours (control), 6 hours, 12 hours and 24 hours after treatment and freeze them with liquid nitrogen.
[0050] Total RNA was extracted using the TRIzol method, and cDNA was synthesized by reverse transcription using the stem-loop method. The expression levels of six OsmiR159 precursor genes (OsMIR159a-f) were detected by real-time quantitative PCR (qRT-PCR). Simultaneously, cDNA was synthesized using a conventional reverse transcription kit, and the mRNA level of its target gene OsGAMYBL2 was detected.
[0051] The results showed that after drought treatment, the expression of most OsMIR159 gene members (such as a, b, d, e, and f) showed a significant downregulation trend, while the mRNA level of OsGAMYBL2 was significantly upregulated with prolonged drought treatment (e.g., ...). Figure 1 As shown in the figure, this result indicates that the OsmiR159 / OsGAMYBL2 module participates in the response of rice to drought stress, providing a basis for subsequent research in this invention.
[0052] 2. Drought Treatment Methods and Survival Rate Statistics
[0053] Sow the germinated rice seeds in blue plastic pots filled with soil, symmetrically, with 40 plants for each variety. Stop watering when the rice grows to 4 weeks old, and continue watering until the plant leaves visibly wilt.
[0054] Then, the plants were re-watered, and after 2 days, their growth was observed and photographed. The number of surviving plants was counted: survival rate (%) = (number of surviving plants / total number of plants) × 100%. Three biological replicates were set up for each treatment.
[0055] 3. Detection of gene expression by real-time quantitative PCR (qRT-PCR)
[0056] Rice leaves at 3-5 weeks of seedling stage or samples from different time points (0h, 1h, 3h, 6h, 12h) of drought treatment were collected, and total RNA was extracted using TRIzol reagent after quick freezing in liquid nitrogen.
[0057] Then, the TOYOBO ReverTraAce® qPCRRTMasterMixwithgDNAremover kit was used to reverse transcribe and synthesize cDNA.
[0058] The qRT-PCR reaction system consisted of: 4 µL cDNA (diluted to an appropriate concentration), 0.4 µL forward primer, 0.4 µL reverse primer, 5.2 µL LRNase-free water, and 10 µL LSYBR GreenMix.
[0059] The reaction was performed on an Eppendorf Realplex fluorescence quantitative instrument with the following program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s; 60℃ annealing for 20 s; 72℃ extension for 20 s; 40 cycles.
[0060] Three biological replicates were set up for each sample, and three technical replicates were set up for each biological replicate. The relative expression level of the target gene was calculated using the 2^−ΔΔCT method and normalized using rice internal reference genes (such as Actin).
[0061] 4. EMSA assay to verify protein-DNA binding
[0062] First, the R2R3 domain coding sequence of GAMYBL2 was cloned into a prokaryotic expression vector, and the recombinant protein was induced to express and purified. Then, a biotin-labeled RGA1 promoter fragment probe was synthesized.
[0063] The purified protein and probe were then incubated in binding buffer at room temperature for 30 min, separated by non-denaturing polyacrylamide gel electrophoresis, and the signal was detected by chemiluminescence after transfer to a membrane. A cold competitive control (with an excess of unlabeled probe) was set up to verify the binding specificity.
[0064] 5. Dual-LUC assay for detecting transcriptional regulatory activity
[0065] First, the RGA1 promoter sequence (approximately 2 kb upstream of the start codon ATG) was cloned into the PGREEN vector via homologous recombination to drive the expression of the firefly luciferase (LUC) reporter gene, serving as the reporter. The full-length coding sequence of GAMYBL2 was cloned into the PHB-GFP vector, serving as the effector.
[0066] The Reporter and Effector plasmids were then transformed into Agrobacterium GV3101 (containing the P19-Psoup helper plasmid), and the bacterial suspensions were mixed at a volume ratio of Effector:Reporter = 2:1 and injected into tobacco leaves. 48–72 h after injection, sodium fluorescein solution was injected into the infiltrated area of the leaf, and after 5 min in the dark, the area was observed and photographed using a Tanon 5200 fully automated chemiluminescence imaging system.
[0067] Simultaneously, samples were taken using a punch, cell lysis buffer was added and the mixture was ground, centrifuged and the supernatant was collected. LARII reagent was added sequentially in an ELISA reader to measure the fluorescence intensity of fireflies, and then Stop&Glo reagent was added to measure the fluorescence intensity of sea urchins (internal control). The LUC / REN ratio was calculated, and three biological replicates were set up for each treatment.
[0068] All experimental data are expressed as mean ± standard deviation (mean ± SD). Student's test was used to compare the two groups. P < 0.05 indicated a significant difference, and P < 0.01 indicated a highly significant difference. All statistical charts were generated using GraphPadPrism software.
[0069] Example 1
[0070] STTM159 transgenic rice (ZH11 background)
[0071] Materials obtained: STTM159 is a transgenic rice with OsmiR159 function repression. 'Zhonghua 11' (ZH11) was used as the recipient. A tandem target mimicry structure was designed based on the mature OsmiR159 sequence. The synthesized DNA fragment was cloned into the pCAMBIA1301-35S-NOS vector and transformed into ZH11 embryogenic callus via Agrobacterium-mediated transformation. Resistant plants were obtained by hygromycin screening. The T2 generation homozygous line was used in this example.
[0072] Molecular identification: qRT-PCR detection showed that compared with wild-type ZH11, the abundance of mature OsmiR159 in STTM159 plants decreased by more than 80%, and the mRNA level of its target gene OsGAMYBL2 was significantly upregulated by about 3 times, proving that STTM159 effectively inhibited the function of OsmiR159.
[0073] Drought resistance assessment: Drought treatment was conducted according to the experimental method, and the results are as follows: Figure 2 As shown in AC, after drought and rehydration, all wild-type ZH11 plants died (0% survival rate), while all STTM159 plants survived (100% survival rate), with a highly significant difference (P<0.01).
[0074] Conclusion: The STTM159 material obtained a significantly enhanced drought resistance phenotype by inhibiting OsmiR159 function, confirming that OsmiR159 negatively regulates drought resistance in rice.
[0075] Example 2
[0076] STTM159N genetically modified rice (Nipponbare background)
[0077] Materials obtained: STTM159N is a transgenic rice with OsmiR159 function repression using 'Nipponbare' (NIP) as the receptor. The construction method is the same as in Example 1. The T2 generation homozygous line was used in this example.
[0078] Molecular identification: qRT-PCR detection confirmed that the expression level of OsmiR159 in STTM159N plants was significantly lower than that in wild-type NIP, and the expression of OsGAMYBL2 was significantly upregulated;
[0079] Drought resistance assessment: Results of drought treatment are as follows Figure 2 As shown in DF: all wild-type NIP plants died (0% survival rate), while all STTM159N plants survived (100% survival rate), indicating that inhibiting OsmiR159 can significantly improve drought tolerance in different genetic backgrounds.
[0080] Conclusion: The STTM159N material further validates the broad-spectrum nature of OsmiR159's negative regulation of drought resistance.
[0081] Example 3
[0082] GAMYBL2OE overexpression in rice (ZH11 background)
[0083] Material acquisition: GAMYBL2OE is a transgenic rice that overexpresses OsGAMYBL2. The full-length coding sequence of OsGAMYBL2 was cloned into the pCAMBIA130135SNOS vector (35S promoter), transformed into ZH11, and overexpression lines were obtained. Then, T2 generation homozygous lines of two independent lines, GAMYBL2OE-6 and GAMYBL2OE-14, were selected.
[0084] Molecular identification: qRT-PCR detection showed that the expression levels of OsGAMYBL2 in GAMYBL2OE-6 and GAMYBL2OE-14 were increased by 12-fold and 15-fold, respectively, compared with wild type.
[0085] Drought resistance assessment: Results of drought treatment are as follows Figure 3 As shown in AF, the survival rates of the two GAMYBL2OE lines were 82% and 79%, respectively, which were significantly higher than those of the wild type (approximately 40%), with a highly significant difference (P<0.01).
[0086] Conclusion: The GAMYBL2OE material demonstrates that OsGAMYBL2 positively regulates drought resistance in rice and is a downstream functional executor of OsmiR159.
[0087] Example 4
[0088] RGA1KO gene-edited rice (ZH11 background)
[0089] Material Acquisition: RGA1KO is an RGA1 gene knockout rice obtained using CRISPR / Cas9 technology. An sgRNA targeting the RGA1 coding region (target sequence: ATGTGCTTTATGCAAGAGTA) was designed, constructed into the pYL-KU-U3-CCDB-tRNA vector, transformed into ZH11, and T0 generation sequencing was used to screen for homozygous mutant lines. In this example, a representative line, RGA1KO, was selected.
[0090] Molecular identification: Sequencing confirmed a 5bp deletion of RGA1KO at the target site, resulting in a frameshift mutation and a typical dwarfing plant phenotype. Figure 5 A), consistent with previously reported RGA1 mutants;
[0091] Drought resistance assessment: Results of drought treatment are as follows Figure 5As shown in AC, all wild-type ZH11 plants died (0% survival rate), while all RGA1KO plants survived (100% survival rate), with a highly significant difference (P<0.01).
[0092] Conclusion: The RGA1KO material demonstrates that RGA1 negatively regulates drought resistance in rice, and its loss of function can significantly enhance drought resistance.
[0093] Example 5
[0094] RGA1OE / S recovery line (STTM159 background)
[0095] Material acquisition: RGA1OE / S is a transgenic material that overexpresses RGA1 in the background of STTM159 plants. The RGA1 overexpression vector (pCAMBIA2301-RGA1, containing the G418 selection marker) was transformed into STTM159 plants to obtain co-transformed lines. RGA1OE / S-2 (T2 generation homozygous) was selected.
[0096] Molecular identification: qRT-PCR detection showed that the expression level of RGA1 in RGA1OE / S-2 recovered to near wild-type levels compared to STTM159. Figure 6 B);
[0097] Drought resistance assessment: Results of drought treatment are as follows Figure 7 As shown: the survival rate of wild-type ZH11 was approximately 5%, STTM159 was 100%, while the survival rate of RGA1OE / S-2 decreased to approximately 10%, similar to that of wild-type. The difference was extremely significant (P<0.01).
[0098] Conclusion: The RGA1OE / S material demonstrates at the genetic level that RGA1 is a key downstream gene of OsmiR159 in regulating drought tolerance, and verifies the "OsmiR159→OsGAMYBL2→RGA1" signaling pathway.
[0099] Comparative Example 1
[0100] miR159dOE overexpression rice (ZH11 background)
[0101] Materials obtained: miR159dOE is a transgenic rice that overexpresses OsmiR159d. The OsmiR159d precursor sequence was cloned, constructed into the pCAMBIA130135SNOS vector (35S promoter), transformed into ZH11, and overexpressing plants were obtained. Two independent lines, miR159dOE-1 and miR159dOE-2 (T2 generation homozygous), were selected.
[0102] Molecular identification: qRT-PCR detection showed that the abundance of mature OsmiR159 in the miR159dOE line was 5-8 times higher than that in the wild type, and the expression of OsGAMYBL2 was significantly downregulated.
[0103] Drought resistance assessment: Results of drought treatment are as follows Figure 2 As shown in GI, the survival rate of wild-type ZH11 was about 50%, while the survival rates of the two miR159dOE lines were significantly lower than that of wild-type (about 10%), indicating drought sensitivity (P<0.05).
[0104] Conclusion: The miR159dOE material, from the opposite perspective, confirms that OsmiR159 negatively regulates drought resistance in rice.
[0105] Comparative Example 2
[0106] GAMYBL2RNAi interference in rice (ZH11 background)
[0107] Materials obtained: GAMYBL2RNAi is a transgenic rice that silences the OsGAMYBL2 gene. An RNAi vector targeting OsGAMYBL2 was constructed, transformed into ZH11, and interference lines were obtained. The T2 generation homozygous lines were used for experiments.
[0108] Molecular identification: qRT-PCR detection showed that the expression level of OsGAMYBL2 in GAMYBL2RNAi plants was reduced by more than 70% compared with wild type;
[0109] Drought resistance assessment: Results of drought treatment are as follows Figure 3 As shown in GI, the survival rate of GAMYBL2RNAi plants was approximately 12%, significantly lower than that of wild type (approximately 40%), with a highly significant difference (P<0.01).
[0110] Conclusion: The GAMYBL2RNAi material confirms that OsGAMYBL2 positively regulates drought tolerance, and its loss of function leads to drought sensitivity.
[0111] Comparative Example 3
[0112] GAMYBL2KO gene-edited rice (ZH11 background)
[0113] Material acquisition: GAMYBL2KO is an OsGAMYBL2 gene knockout rice obtained using CRISPR / Cas9 technology. sgRNA targeting the first exon of OsGAMYBL2 was designed, transformed into ZH11, and homozygous mutant lines were screened. Two independent editing events, GAMYBL2KO-2 and GAMYBL2KO-3, were selected.
[0114] Molecular identification: Sequencing confirmed that GAMYBL2KO-2 had a 2bp deletion and GAMYBL2KO-3 had a 1bp insertion, both resulting in frameshift mutations;
[0115] Drought resistance assessment: Results of drought treatment are as follows Figure 3 As shown in JO, the survival rates of the two GAMYBL2KO lines were 8% and 11%, respectively, which were significantly lower than those of the wild type (approximately 40%), with a highly significant difference (P<0.01).
[0116] Conclusion: The GAMYBL2KO material, from the perspective of gene knockout, once again confirms that OsGAMYBL2 positively regulates drought tolerance.
[0117] Comparative Example 4
[0118] RGA1OE overexpression rice (ZH11 background)
[0119] Materials obtained: RGA1OE is a transgenic rice that overexpresses RGA1. The full-length cDNA of RGA1 was cloned into the pCAMBIA130135SNOS vector (driven by its own promoter), transformed into ZH11, and overexpression lines were obtained. Two independent lines, RGA1OE-3 and RGA1OE-8 (T2 generation homozygous), were selected.
[0120] Molecular identification: qRT-PCR analysis showed that the expression levels of RGA1 in RGA1OE-3 and RGA1OE-8 were increased by 4.2-fold and 6.8-fold, respectively, compared with the wild type. Figure 6 A);
[0121] Drought resistance assessment: Results of drought treatment are as follows Figure 5 As shown in DI, the survival rates of the two RGA1OE lines were 15% and 10%, respectively, which were significantly lower than those of the wild type (approximately 40%), with a highly significant difference (P<0.01).
[0122] Conclusion: The RGA1OE material, from the opposite perspective, confirms that RGA1 negatively regulates drought resistance in rice.
[0123] Application Example 1
[0124] A drought-resistant rice breeding method based on STTM159 technology mainly involves inhibiting OsmiR159 expression using STTM technology to cultivate drought-resistant rice varieties. The specific method is as follows:
[0125] 1. Vector construction: Based on the mature sequence of OsmiR159 (5′-UUCCACAGCUUUCUUGAACUG-3′), the STTM159 fragment was designed and synthesized, and cloned into the pCAMBIA1301-35S-NOS vector to obtain the recombinant plasmid pCAMBIA1301-35S-STTM159-NOS;
[0126] 2. Genetic transformation: Callus tissue of target rice varieties ('Zhonghua 11', 'Nipponbare', 'Wuyunjing 7', etc.) was transformed using Agrobacterium-mediated transformation. Resistant callus was obtained by screening with hygromycin and then differentiated into seedlings.
[0127] 3. Screening of transgenic plants: DNA was extracted from the leaves of T0 generation plants for PCR identification, and positive plants were transplanted to harvest T1 seeds;
[0128] 4. Molecular identification and drought resistance screening: T1 generation lines were planted, and the expression level of OsmiR159 was detected by qRT-PCR. Lines with significantly downregulated OsmiR159 were screened. At the same time, drought treatment was carried out, the survival rate was counted, and superior lines with a survival rate >90% were screened.
[0129] 5. Agronomic trait evaluation: The drought-resistant strains selected under normal water and fertilizer conditions were planted, and the main agronomic traits (plant height, number of tillers, thousand-grain weight, yield per plant, etc.) were examined, and strains with undesirable traits were removed.
[0130] 6. Breeding of superior varieties: Drought-resistant lines with excellent comprehensive traits are continuously self-pollinated to the T4 generation to obtain genetically stable new drought-resistant rice varieties.
[0131] Application Example 2
[0132] A method for breeding drought-resistant rice based on CRISPR / Cas9 editing of RGA1 mainly involves knocking out the RGA1 gene using CRISPR / Cas9 technology to cultivate drought-resistant rice varieties. The specific method is as follows:
[0133] 1. Target design and vector construction: sgRNA target sequence (5′-ATGTGCTTTATGCAAGAGTA-3′) was designed targeting the first exon region of the RGA1 gene (LOC_Os05g26890), the corresponding oligonucleotide was synthesized, and after annealing, it was ligated into the pYL-KU-U3-CCDB-tRNA vector to obtain a recombinant CRISPR / Cas9 editing vector;
[0134] 2. Genetic transformation and mutant screening: The editing vector was transformed into the target rice variety. DNA was extracted from the T0 generation plants, and PCR amplification and sequencing were performed on the target region to screen for plants carrying biallelic or homozygous mutations;
[0135] 3. Drought resistance identification: The T1 generation homozygous mutant lines were subjected to drought treatment, the survival rate was counted, and mutation events with a survival rate >90% were screened;
[0136] 4. Removal of transgenic components: T1 or T2 generation plants without Cas9 and sgRNA expression cassettes were screened by PCR detection to obtain RGA1 mutant materials without transgenic markers;
[0137] 5. Agronomic trait evaluation and backcross breeding: Agronomic traits of the obtained non-transgenic RGA1 mutants were investigated. If the plant height was reduced too much and affected the yield, improved lines with suitable plant height and strong drought resistance could be bred by backcrossing with superior parents and combining marker-assisted selection.
[0138] In summary, this invention reveals the molecular mechanism by which the OsmiR159-GAMYBL2-RGA1 signaling pathway regulates drought resistance in rice, and provides a method to enhance rice drought resistance by downregulating OsmiR159 or RGA1 expression and upregulating GAMYBL2 expression.
[0139] Those skilled in the art can reproduce the various transgenic materials and drought resistance test results involved in this invention based on the above description, and use the method to cultivate drought-resistant rice varieties. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but as long as they are within the scope of the claims of this application, they are protected by patent law.
Claims
1. The application of the OsmiR159-GAMYBL2-RGA1 signaling pathway in regulating drought resistance in rice, characterized by, The regulation is achieved through the following methods: OsmiR159 negatively regulates the expression of the OsGAMYBL2 gene, relieving the inhibition of RGA1 gene transcription by the OsGAMYBL2 protein, thereby reducing the negative regulatory effect of drought tolerance mediated by the RGA1 gene.
2. The application of the OsmiR159-GAMYBL2-RGA1 signaling pathway as described in claim 1 in regulating drought resistance in rice, characterized in that, The regulation aims to enhance the survival rate of rice under drought stress.
3. The application of the OsmiR159-GAMYBL2-RGA1 signaling pathway as described in claim 2 in regulating drought resistance in rice, characterized in that, The OsGAMYBL2 protein inhibits RGA1 transcription by binding to the MYB-binding motif in the RGA1 promoter through its R2R3 domain.
4. A method for improving the drought resistance of rice, characterized in that, By downregulating the expression of OsmiR159 in rice and / or downregulating the expression of the RGA1 gene in rice through any of the regulatory methods described in claims 1-3, the survival rate of rice under drought stress can be improved.
5. The method for improving drought resistance of rice as described in claim 4, characterized in that, The downregulation of OsmiR159 expression is achieved by inhibiting OsmiR159 activity or reducing its accumulation level. And / or downregulation of RGA1 expression is achieved by inhibiting the transcription or translation of the RGA1 gene.
6. The method for improving drought resistance of rice as described in claim 5, characterized in that, The downregulation of OsmiR159 expression was achieved through short tandem target mimicry (STTM) technology or gene editing technology. The STTM target sequence is 5′-UUCCACAGCUUUCUUGAACUG-3′; And / or the downregulation of RGA1 expression is achieved through gene editing technology or RNA interference technology.
7. A method for breeding drought-resistant rice, characterized in that, Includes the following steps: a) Provide rice materials with downregulated OsmiR159 expression, and / or provide rice materials with downregulated RGA1 gene expression; b) Hybridize the rice material provided in step a) with the target rice variety; c) Screen for plants in their offspring that exhibit low expression of OsmiR159 and / or RGA1 and improved drought tolerance.
8. The method for breeding drought-resistant rice as described in claim 7, characterized in that, The rice material with downregulated OsmiR159 expression is the material obtained by the method for improving the drought resistance of rice as described in any one of claims 4-6.
9. The method for breeding drought-resistant rice as described in claim 7, characterized in that, The rice material with downregulated RGA1 gene expression is the material obtained by the method for improving rice drought resistance as described in any one of claims 4-6.
10. A biological material for carrying out the method of any one of claims 4-6 and 7-9, said biological material being a recombinant vector containing an STTM sequence targeting OsmiR159, or a CRISPR vector containing an sgRNA sequence targeting the RGA1 gene, or a host cell containing said vector.