RPA-CRISPR / Cas-based rapid detection method for echinococcus shikonii

By using the RPA-CRISPR/Cas system, combining RPA amplification and CRISPR/Cas12a protein, sgRNA was designed to cut specific gene sites, solving the problems of speed, accuracy, and sensitivity in the detection of Echinococcus suis in Shiqu County. This method is suitable for on-site testing and primary healthcare institutions.

CN122012675APending Publication Date: 2026-05-12QINGHAI ACAD OF ANIMAL SCI & VETERINARY MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610175119.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-06
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing methods for detecting Echinococcus suis in Shiqu County have limitations in rapidly and accurately distinguishing eggs and achieving high-sensitivity detection on-site, especially due to uneven dispersion in the feces of the definitive host and significant interference from inhibitors in conventional PCR detection.

Method used

Using the RPA-CRISPR/Cas system, combined with RPA amplification and CRISPR/Cas12a protein, sgRNA was designed to cut specific gene sites, achieving rapid isothermal detection, and target visualization was achieved through fluorescent reporter probes.

Benefits of technology

It achieves highly specific and sensitive detection of Echinococcus shiquensis, enabling rapid and accurate differentiation of Echinococcus shiquensis from closely related species on-site, simplifying operations, and making it suitable for primary healthcare institutions and on-site quarantine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012675A_ABST
    Figure CN122012675A_ABST
Patent Text Reader

Abstract

The invention discloses an RPA-CRISPR / Cas-based rapid detection method for echinococcus shikonii, and belongs to the technical field of molecular diagnosis. The method comprises the following steps: extracting DNA of a sample to be detected; the specific primers are used for RPA isothermal amplification, a reaction system comprises a buffer solution, upstream and downstream primers, RPA enzyme, magnesium acetate and template DNA, and reaction is carried out at 39 DEG C for 20 minutes; and mixing the amplification product with LbCas12a protein, sgRNA and a fluorescence report probe, carrying out CRISPR / Cas reaction at 37 DEG C for 30 minutes, and judging the result through a real-time fluorescence signal. According to the method, constant-temperature rapid amplification is realized by utilizing RPA, high-sensitivity and high-specificity detection of the echinococcus shikonii can be realized under the field condition by combining high-specificity recognition and cleavage activity of CRISPR / Cas12a, the sensitivity reaches a single-digit copy number, and the method is simple and convenient to operate, does not need a complex instrument and is suitable for primary medical treatment and field quarantine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostic technology, specifically to a rapid detection method for Echinococcus shiquensis based on the combination of recombinase polymerase amplification (RPA) and clustered regularly spaced short palindromic repeats / CRISPR-related proteins (CRISPR / Cas), applicable to the clinical diagnosis, livestock quarantine and epidemiological investigation of Echinococcus shiquensis. Background Technology

[0002] Echinococcosis shiquicus is a parasitic disease caused by the larvae of *Echinococcus shiquicus*, endemic to my country. *Echinococcus shiquicus* was first discovered and identified on the Qinghai-Tibet Plateau, and its prevalence is currently limited to this region. The primary intermediate host is the plateau pika (*Plateau pika*). Ochotona curzoniae It mainly parasitizes organs such as the liver and lungs, and its definitive host is canines such as foxes.

[0003] Currently, the detection methods for Echinococcus suis infection in Shiqu County have significant shortcomings: egg detection mainly involves microscopic examination of the definitive host's feces after flotation and sedimentation. However, the expulsion of gravid protuberances by adult worms from the definitive host is irregular, and the eggs are unevenly dispersed in the host's feces, making them prone to missed detection. Furthermore, the eggs are morphologically very similar to those of other Echinococcus suis species, making them difficult to distinguish under an optical microscope. Conventional PCR detection relies on expensive equipment and complex temperature cycling operations, has a long detection cycle, and is significantly affected by inhibitors in the sample, failing to meet the needs of rapid field detection and epidemiological surveys in remote pastoral areas. Therefore, there is an urgent need to develop a rapid and accurate detection method suitable for field use to fill the gaps in existing detection technologies. Summary of the Invention

[0004] This invention addresses the shortcomings of existing methods for detecting Echinococcus suis in Shiqu County by providing a rapid detection method based on RPA-CRISPR / Cas. This method achieves high specificity, high sensitivity, and isothermal rapid detection of Echinococcus suis in Shiqu County, meeting the needs of clinical diagnosis and on-site quarantine.

[0005] The purpose of this invention is to provide a rapid detection method for Echinococcus shiquensis based on RPA-CRISPR / Cas, the method comprising the following steps: S1. Extract DNA from the sample to be tested; S2.RPA Amplification: Configure the RPA reaction system and amplify the products using the RPA method; S3. CRISPR / Cas system reaction detection: Take the above amplification product, add fluorescent reporter probe, Cas12a and sgRNA, perform CRISPR reaction detection, and read the detection signal.

[0006] The package includes the Cas12a protein (LbCas12a), the RPA primer combination F-5'-CATGCAGTGAGTTAGATGGTAAGCGTTGGTT-3', R-5'-AACCACAATAACAATTCTAGCCACACTACCT-3', and the sgRNA with the sequence UAAUUUCUACUAAGUGUAGAUAAAUACUCGUAAUUGAGUGUUGA. It also includes a fluorescent reporter probe with the sequence 5'-TTATT-3'. Finally, it includes RPA amplification reagents, containing RPA enzyme and magnesium acetate. The RPA amplification reaction system includes RPA buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the RPA amplification reaction conditions are: 39℃ for 20 min. The CRISPR / Cas system reaction system includes: 10×LbCas12a Reaction Buffer, LbCas12a, template, fluorescent reporter probe, and sgRNA; the CRISPR / Cas system reaction conditions are: 37℃ for 30 min.

[0007] The components of the RPA amplification reaction system were prepared in the following proportions: 29.5 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer, 2.4 μL 10 μM downstream primer, 3 μL DNA template, and RPA enzyme lyophilized powder.

[0008] The reaction system of the CRISPR / Cas system was prepared in the following proportions: 2 μL of RPA reaction product, 2 μL of 10×LbCas12a Reaction Buffer, 1 μL of 1 μM LbCas12a, 1 μL of 10 μM fluorescent reporter probe, and 1 μL of 1 μM sgRNA, with ddH2O added to a final volume of 20 μL. The reaction conditions were: qPCR program set to 37℃ for 30 min, with FAM channel fluorescence signal collected every 30 s using a real-time quantitative PCR instrument.

[0009] Recombinase polymerase amplification (RPA) technology, as an isothermal nucleic acid amplification technique, can amplify target genes within 15-30 minutes under isothermal conditions of 37-42℃, without the need for complex temperature control equipment. The CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR, Cas protein) system (especially Cas12a protein) possesses highly specific sequence recognition capabilities and "trans-cutting" activity, enabling non-specific cleavage of single-stranded DNA (ssDNA) after recognizing the target sequence. Combined with a fluorescent reporter probe, it allows for the visual detection of the target. The combined use of these two technologies achieves integrated detection of "isothermal amplification + specific cleavage + rapid reading," significantly improving the specificity, sensitivity, and convenience of the detection.

[0010] This invention targets Echinococcus shiquensis and develops a rapid detection method for the disease based on RPA technology combined with CRISPR and the CRISPR-related protein system—CRISPR / Cas12. By designing sgRNA (single-stranded guide RNA) sequences, the method guides the Cas12 bound to it to cleave specific gene sites, thereby further increasing the specificity and sensitivity of the detection on the basis of RPA. It has extremely high detection sensitivity, can be carried out under isothermal conditions, and does not require complex instruments and equipment.

[0011] This invention establishes a specific method for the combined RPA-CRISPR detection of *Echinococcus shiquensis*, possessing high sensitivity and strong specificity. It can rapidly and accurately distinguish *Echinococcus shiquensis* from its closely related species and other common parasites in the field, achieving highly specific, highly sensitive, and isothermal-controlled rapid detection of *Echinococcus shiquensis* infection. This method is simple to operate, has a short detection cycle, and requires no complex equipment, making it particularly suitable for primary healthcare institutions and on-site quarantine procedures. It can significantly improve the efficiency of early identification and diagnosis of *Echinococcus shiquensis* infection. The establishment of this technology provides a reliable technical means for the clinical diagnosis, epidemiological investigation, and rapid on-site screening of *Echinococcus shiquensis* infection, effectively meeting the urgent needs of clinical diagnosis and on-site quarantine. It has significant practical application value in promoting the improvement of parasitic disease control capabilities and ensuring public health security. Attached Figure Description

[0012] Figure 1 The diagram shows the sgRNA primer design sites in Example 1, with the yellow box indicating the sgRNA design site and the black ellipse indicating the PAM site.

[0013] Figure 2The results of the RPA-CRISPR system specificity verification for Echinococcus shiquensis in Example 1 are shown. A represents the fluorescence growth rate of the entire reaction, B represents the fluorescence growth curve of the entire reaction, and C represents a photograph taken by a blue light gel cutter after the reaction is completed.

[0014] Figure 3 The results of sensitivity detection of the Echinococcus shiquense RPA-CRISPR system in Example 1 are shown. A is the fluorescence intensity curve of different plasmid concentrations, and B is a photograph taken under a portable blue light gel cutter after the reaction is completed. Detailed Implementation

[0015] The present invention will be further described below with reference to this example, but this does not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. The reagents and instruments used in the following examples can all be purchased commercially. Example

[0016] I. Experimental Materials and Main Reagents 1. Experimental materials

[0017] 2. Main reagents RPA amplification kit: TwistAmp Basic Kit (TwistDX Inc., catalog number: TABAS03KIT); Cas12a protein: GenCRISPR LbCas12a Nuclease (Nanjing GenScript Biotech Co., Ltd., catalog number: Z03753-100); sgRNA and fluorescent reporter probe: synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.; DNA extraction kit: SPARKeasy whole blood / tissue / cell genomic DNA rapid extraction kit (Shandong Cisco Biotechnology Co., Ltd., catalog number: AA0901-A); PCR amplification kit: 2×Spark Taq PCR Master Mix (with dye) (Shandong Cisco Biotechnology Co., Ltd., catalog number: AF0102-B).

[0018] 3. Main Instruments Real-time PCR instrument; portable blue light gel cutter; constant temperature metal bath.

[0019] II. Nucleic Acid Extraction and Primer Design 1. DNA extraction Serum / plasma samples: DNA extraction using a column-based DNA extraction kit; Tissue samples (liver / lung cyst tissue, livestock muscle tissue): 100 mg of tissue was ground into powder in liquid nitrogen and then extracted using a column-based DNA extraction kit, following the instructions, with a final elution volume of 20-50 μL; Fecal samples: DNA was extracted using a fecal DNA extraction kit after removing inhibitors from the feces.

[0020] 2. Nucleic acid sequence preparation The DNA of Echinococcus shiquensis in Table 1 was amplified to obtain the partial ND4 sequence. The amplification primer sequences were ND4-F: 5'-CATGCAGTGAGTTAGATGGTAAGCGTTGGTT-3'; ND4-R: 5'-AACCACAATAACAATTCTAGCCACACTACCT-3'.

[0021] The partial sequence of Echinococcus shiquense ND4 obtained by amplification sequencing is as follows: CATGCAGTGAGTTAGATGGTAAGCGTTGGTTGGCGTTTTTGAGTTTATCTCATATAGTAGTTCCATTTTTTGGTTTTTTTGTTAGAGATTGGGTTAGAGTGGGCTATAGATTTTTTTATTGTTTTGGTCATGGTTTGAGTGCAGGTTTGGTGTTTGGTTTATTATGGTGTTTTTATGAAGTTTTAAATACTCGTAATTGAGTGTTGATAAAGTCCGGTGTAGGTAGTGTGGCTAGAATTGTTATTGTGGTT 3. Design of crRNA primers Target sequences containing the CRISPR-Cas12a recognition sequence (PAM) TTTN were identified. Based on the PAM location, sgRNA primers were designed at differentially expressed sites using CRISPR software (http: / / crispor.tefor.net / ). The spacer sequence of the designed sgRNA was analyzed for coverage and specificity using NCBI BLAST. The sgRNA sequence is UAAUUUCUACUAAGUGUAGAUAAAUACUCGUAAUUG AGUGUUGA. The alignment results showed that the designed sgRNA spacer sequence had 100% coverage within the tested species and good specificity.

[0022] 4. Template preparation Using the sample DNA in Table 1 as a template, PCR amplification was performed using ND1-F / R according to the recommended system in the Cisco reagent manual to obtain high-concentration products. The specific amplification system is shown in Table 2, and the corresponding PCR program is shown in Table 3. After cloning and expression, the plasmid was extracted.

[0023]

[0024] 5. RPA amplification Using the plasmid from step "4. Template Preparation" as a template, the ND4 gene fragment of *Echinococcus shiquensis* was amplified by RPA technology: RPA reaction system (50 μL): 25 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer F, 2.4 μL 10 μM downstream primer R, 3 μL template, 1 part of RPA enzyme lyophilized powder, and ddH2O to make up to 50 μL; the reaction system was incubated in a 39℃ constant temperature box for 20 min to obtain the RPA amplification product (containing the *Echinococcus shiquensis* ND4 gene specific fragment).

[0025] The RPA buffer formulation is as follows: Tris-HCl (pH 7.6-8.0, 25℃) 50mM, potassium acetate 50mM, PEG35000 (w / v) 5.5%, BSA 0.1mg / ml, DTT 1mM, dNTPs (each type, dATP / dCTP / dGTP / dTTP) 0.2mM, creatine phosphate 40mM, creatine kinase 1× working concentration (approximately 0.5-1U / μL), and nuclease-free purified water.

[0026] 6. CRISPR detection After measuring the plasmid concentration as described in "4. Template Preparation", dilute it 10-fold. 3 10 2 10 1 10 0 10 - 1 The plasmid copies / μL and the negative template were used to prepare the CRISPR reaction system according to the system in Table 4.

[0027]

[0028] The qPCR instrument was programmed at 37℃ for 30 min, with FAM channel fluorescence signals collected every 30 s. The changes in the fluorescence signal curve reflected the progress of the reaction. After the reaction was completed, the reaction tubes were placed on a portable blue light gel cutter to observe the fluorescence.

[0029] III. Specificity Detection of Echinococcus shiquense RPA-CRISPR System Using the DNA samples from the 10 samples in Table 1 as templates, RPA amplification was performed on the DNA using the selected RPA primers F / R. The RPA reaction system and conditions were the same as those described in Section II, "Nucleic Acid Extraction and Primer Design". The RPA reaction products were then used to prepare the CRISPR system shown in Table 4 and placed in a qPCR instrument. The qPCR instrument was programmed at 37°C for 30 minutes, with the FAM channel fluorescence signal collected every minute.

[0030] result( Figure 2 The results showed that only the sample containing *Echinococcus shiquensis* exhibited fluorescence, while the other samples did not. This indicates that the detection method established in this experiment has good specificity and can effectively distinguish the target species.

[0031] IV. Sensitivity Detection of the RPA-CRISPR System for Echinococcus shiquensis After amplifying the DNA extracted from sample S3, a plasmid was constructed. The plasmid was then extracted and serially diluted 10-fold. 3 10 2 10 1 10 0 10 -1 A total of 5 concentrations were tested, following the reaction system and methods described in Section III, "Specific Detection of Echinococcus shiquense RPA-CRISPR System".

[0032] The results are as follows Figure 3 As shown, the detection sensitivity of the *Echinococcus shiquensis* RPA-CRISPR system of this invention is a single-digit copy number.

Claims

1. A rapid detection method for Echinococcus shiquensis based on RPA-CRISPR / Cas, characterized in that... The method includes the following steps: S1. Extract DNA from the sample to be tested; S2.RPA Amplification: Configure the RPA reaction system and amplify the products using the RPA method; S3. CRISPR / Cas system reaction detection: Take the above amplification products, add fluorescent reporter probe, Cas12a and sgRNA, perform CRISPR reaction detection, and read the detection signal; The package includes the Cas12a protein (LbCas12a), the RPA primer combination F-5'-CATGCAGTGAGTTAGATGGTAAGCGTTGGTT-3', R-5'-AACCACAATAACAATTCTAGCCACACTACCT-3', and the sgRNA with the sequence UAAUUUCUACUAAGUGUAGAUAAAUACUCGUAAUUGAGUGUUGA. It also includes a fluorescent reporter probe with the sequence 5'-TTATT-3'. Finally, it includes RPA amplification reagents, containing RPA enzyme and magnesium acetate. The RPA amplification reaction system includes RPA buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the RPA amplification reaction conditions are: 39℃ for 20 min. The CRISPR / Cas system reaction system includes: 10×LbCas12a Reaction Buffer, LbCas12a, template, fluorescent reporter probe, and sgRNA; the CRISPR / Cas system reaction conditions are: 37℃ for 30 min. The components of the RPA amplification reaction system were prepared in the following proportions: 29.5 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer, 2.4 μL 10 μM downstream primer, 3 μL DNA template, and RPA enzyme lyophilized powder. The components of the CRISPR / Cas system reaction system were prepared in the following proportions: 2 μL RPA reaction product, 2 μL 10×LbCas12a Reaction Buffer, 1 μL 1 μM LbCas12a, 1 μL 10 μM fluorescent reporter probe, and 1 μL 1 μM sgRNA, with ddH2O added to a final volume of 20 μL. The reaction conditions were: qPCR program set to 37℃ for 30 min, with FAM channel fluorescence signal collected every 30 s using a real-time quantitative PCR instrument.