Construction test method of single-tube RNAseq sequencing library, kit and application

Abstract

The invention discloses a construction method of a single-tube RNAseq sequencing library, a kit and application, the construction method comprises the following steps: (1) 1st cDNA synthesis: taking a treated RNA sample, and synthesizing a first chain cDNA by using reverse transcriptase, RNAseq Inhibitor, an OTR-6N primer and an OTR-TSO primer inserted into a basic group U; and (2) library PCR: adding UDG, Index PCR Primer and 2 * PCR Mix into a reverse transcription product, degrading a U basic group on an OTR-TSO primer by using the UDG, and directly carrying out index PCR amplification and purification, so as to obtain the RNAseq sequencing library. Based on the principle that a basic group is added to the tail end of a first chain of cDNA (complementary deoxyribonucleic acid) on the basis of the TdT enzyme activity of reverse transcriptase, an RNAseq library construction technology of a technical route of synthesizing cDNA-index PCR (polymerase chain reaction) amplification-purification by RNA reverse transcription is formed, the kit is formed, and the technology has the advantages of simplicity and convenience in operation, reduction of cross contamination among samples and high efficiency and application value.

Description

Technical Field

[0001] This invention belongs to the field of RNAseq sequencing library technology, specifically relating to a method, kit, and application for constructing a single-tube RNAseq sequencing library. Background Technology

[0002] The construction methods for RNAseq high-throughput sequencing libraries have undergone several iterations and updates. Starting with the initial technical route of 'cDNA first-strand synthesis - cDNA second-strand synthesis - cDNA purification - cDNA fragmentation and end repair - purification - 3' end A addition - product purification - adapter addition - ligation product purification - index PCR amplification - library purification', through the unremitting efforts of major companies worldwide, a more efficient technical route has been developed: 'cDNA first-strand synthesis - cDNA second-strand synthesis and end repair with 3' end A addition - adapter addition and ligation product - purification - index PCR amplification - library purification'. This greatly simplifies the experimental process, saves experimental time, and improves experimental efficiency.

[0003] With the deepening research on the activity of terminal transferase (TdT) in reverse transcription and the accumulation of application experience, a simplified technical route of 'cDNA first-strand synthesis - first-strand cDNA purification - index PCR amplification - library purification' has been developed. Although the above technique is very simplified, the entire experimental procedure consists of multiple tube transfection operations. Especially before index PCR amplification, the purification step is prone to errors and cross-contamination between samples, which in turn affects the experimental results.

[0004] Therefore, in constructing high-throughput RNAseq libraries, minimizing experimental procedures and the number of transfections before index PCR amplification will help improve the quality of RNAseq libraries and enhance experimental results. Summary of the Invention

[0005] Objective of the Invention: To address the problems existing in the prior art, this invention provides a method, kit, and application for constructing a single-tube RNA-seq sequencing library. The RNA-seq library construction technology of this invention adopts a single-tube mode of 'RNA reverse transcription to cDNA synthesis - index PCR amplification - purification'. The entire experimental process, from cDNA synthesis to index PCR amplification, is performed in the same PCR tube, ultimately forming an effective RNA-seq library.

[0006] Technical Solution: To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0007] In a first aspect, the present invention provides a method for constructing a single-tube RNA-seq sequencing library, comprising the following steps:

[0008] (1) 1 st cDNA synthesis: Take the processed RNA sample and use reverse transcriptase, RNAase inhibitor, OTR-6N primer and OTR-TSO primer with U inserted to synthesize the first-strand cDNA;

[0009] (2) Library PCR: Add UDG, Index PCR Primer, and 2×PCR Mix to the reverse transcription product. Use UDG to degrade the U bases on the OTR-TSO primers and directly perform index PCR amplification. After purification, the RNAseq sequencing library is obtained.

[0010] As a specific implementation plan: In step (1), the processed RNA sample refers to the extracted and purified RNA sample. If the sample quality is intact, it needs to be fragmented first, and then this step is performed; if the sample is severely degraded, it does not need to be fragmented and this step is performed directly.

[0011] As a specific implementation scheme, in step (1), the OTR-TSO primer with inserted base U is wherein the base U is deoxygenated dU or non-deoxygenated U.

[0012] As a specific implementation scheme, in step (1), the nucleotide sequence of the OTR-6N primer is shown in SEQ ID NO.1; the nucleotide sequence of the OTR-TSO primer with inserted base U is shown in SEQ ID NO.2.

[0013] As a specific implementation scheme, in step (2), the Index PCR Primer includes primers i5-Primer and i7-Primer; the nucleotide sequence of i5-Primer is shown in SEQ ID NO.3; the nucleotide sequence of i7-Primer is shown in SEQ ID NO.4.

[0014] Secondly, the present invention provides a kit for constructing a single-tube RNAseq sequencing library, the kit comprising OTR-TSO primers with an inserted base U.

[0015] As a specific implementation, the nucleotide sequence of the OTR-TSO primer with inserted base U is shown in SEQ ID NO.2.

[0016] As a specific implementation scheme, the kit includes:

[0017] RNA fragmentation reagent, reverse transcriptase, OTR-6N primer, OTR-TSO primer with U-insertion, Index PCR Primer, and uracil-DNA glycosylase UDG.

[0018] As a further embodiment, the nucleotide sequence of the OTR-6N primer is shown in SEQ ID NO.1; the IndexPCR Primer includes primers i5-Primer and i7-Primer; the nucleotide sequence of i5-Primer is shown in SEQ ID NO.3; and the nucleotide sequence of i7-Primer is shown in SEQ ID NO.4.

[0019] Thirdly, the present invention provides the application of the kit in the construction of single-tube RNAseq sequencing libraries.

[0020] Beneficial effects: Compared with existing technologies, this invention is based on the principle of adding bases to the first strand of cDNA by the TdT enzyme activity of reverse transcriptase, forming an RNAseq library construction technology with a 'RNA reverse transcription to synthesize cDNA - index PCR amplification - purification' technical route, and forming a kit. This technology is simple to operate, reduces cross-contamination between samples, and has high efficiency and application value. Attached Figure Description

[0021] Figure 1 This is a technical principle roadmap of the present invention. The diagram fully demonstrates the addition of TSO sequences using the terminal transferase activity of reverse transcriptase and the implementation of single-tube RNAseq through appropriate processing.

[0022] Figure 2 The graph shows the results of RNA sample integrity testing, with peaks representing RNA samples that meet quality standards.

[0023] Figure 3 The graph shows the results of RNA sample integrity testing, with the peaks representing RNA quality degradation samples.

[0024] Figure 4 This is a statistical graph showing the total gene expression levels obtained from the sequencing data of the two experimental groups.

[0025] Figure 5 This is a statistical graph showing the number of differentially expressed genes obtained from the sequencing data of the two experimental groups.

[0026] Figure 6 Volcano plot of differentially expressed genes obtained from sequencing data of the two experimental groups.

[0027] Figure 7 Optional indicator sequences for i5index and i7index. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Example 1: A single-tube RNA-seq sequencing library construction kit

[0030] The kit comprises the following components:

[0031] 5 x RT buffer [Tris-HCl: 250mM (pH8.3); KCl: 375mM; MgCl2: 15mM; DTT: 50mM; dNTPs: 10mM each]

[0032] OTR-TSO primer 12 μM;

[0033] OTR-6N Primer, 12 uM;

[0034] RT Enzyme Mix (RNase Inhibitor, 1uL; MMlv, 200 U / ul, 2 uL);

[0035] 2 x PCR Master Mix;

[0036] Uracil-DNA glycosidase UDG;

[0037] Index Primer Mix (I5 primer, 10 uM, 1 uL; I7 primer, 10 uM, 1 uL).

[0038] The primers in the above kit are primer sequences for the Illumina sequencing platform, as detailed below:

[0039] OTR-6N: GCCTCTACACATATTCTCTGTCTNNNN*N*N. (SEQ ID NO.1)

[0040] OTR-TSO: CTACACGACGC / ideoxyU / CTTCCGATCTTTTCTTATAT* / rG / * / rG / * / rG / . (SEQ ID NO.2)

[0041] i5-Primer:AATGATACGGCGACCACCGAGATCTACAC[i5index]ACACTCTTTCCCTACAGACGCTCTTCCGATCT-3'. (SEQ ID NO.3)

[0042] i7-Primer:CAAGCAGAAGACGGCATACGAGAT[i7index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3'. (SEQ ID NO.4)

[0043] Where * represents thiolation modification; ideoxyU represents inserted deoxyribonucleic acid (U); rG represents RNA state; i5index and i7index are standard optional indicator sequences, and specific selections are as follows: Figure 7 As shown.

[0044] Example 2 RNA Extraction and Quality Detection

[0045] There are many methods and kits for RNA extraction, but this experiment does not require them.

[0046] The extracted RNA needs to undergo integrity testing, for example, using an Agilent 2100 nucleic acid detection system to test RNA fragment integrity; Figure 2 and Figure 3 )

[0047] This experiment uses tissue RNA extraction as an example only.

[0048] 1. The tissue is ground into powder in liquid nitrogen;

[0049] 2. Place the mixture into a 2.0 mL EP tube, add 1 mL of Trizol reagent, and mix thoroughly.

[0050] 3. Add chloroform substitute and centrifuge at 12,000 rpm for 10 min at 4°C;

[0051] 4. Transfer the supernatant to an equal volume of isopropanol; and centrifuge at 12,000 rpm for 10 min at 4°C;

[0052] 5. Remove the supernatant, add 70% ethanol, and centrifuge at 12000 rpm for 10 min at 4°C;

[0053] 6. Repeat once;

[0054] 7. Remove the liquid and allow the sediment (transparent gel) to air dry at room temperature.

[0055] 8. Dissolve the RNA sample in enzyme-free water.

[0056] The obtained RNA sample was separated for NanoDrop assay to detect concentration and 2100 assay to detect fragment integrity. Figure 2 and Figure 3 If the RNA sample is of intact quality (e.g.) Figure 2 If the RNA sample is severely degraded (e.g., ...), then the purified RNA will be fragmented; if the RNA sample is severely degraded (e.g., ...), then the purified RNA will be fragmented. Figure 3 (No need to interrupt, proceed directly to the next step;)

[0057] RNA sample fragmentation can be performed as follows: Prepare a 1x Fragment Buffer by mixing 4 μL of 5x RT buffer (reverse transcription buffer) and 8 μL of H2O. If the RNA sample is intact and mRNA purification using magnetic beads is required, add the prepared Fragment Buffer directly to the magnetic beads for fragmentation. If the RNA sample is incomplete, adjust the amount of H2O used in preparing the 1x Fragment Buffer according to the RNA sample volume, i.e., the total volume of RNA and H2O should be 8 μL. [Vol] （H20） +Vol （RNA） =8 uL】.

[0058] Example 3: Conventional RNA-seq library construction and library concentration

[0059] RNA-seq library construction was performed using the Abclonal Fast RNA-seq Lib Prep Kit V2 (RK20306); the experimental procedure is briefly described below:

[0060] 1. Purify mRNA from total RNA using magnetic beads;

[0061] 2. The purified mRNA is then fragmented;

[0062] 3. cDNA one-strand synthesis;

[0063] 4. cDNA second-strand synthesis and end repair, addition of A;

[0064] 5. Connecting connectors;

[0065] 6. Purification of the ligation product using magnetic beads;

[0066] 7. Index PCR to obtain the library;

[0067] 8. Library concentration determination, the specific results are shown in Table 1.

[0068] Example 4: RNAseq library construction and library concentration of the present invention

[0069] RNA-seq library construction was performed using the kit provided in Example 1, as follows:

[0070] I. RNA Disruption

[0071] 1. Processed RNA or purified mRNA;

[0072] 2. Immediately add the following reagents to the purified RNA sample:

[0073]

[0074] 3. After mixing by pipetting and aspiration, place the sample on the PCR instrument and perform the following reaction:

[0075] Conditions for breaking down qualified RNA samples: 94℃, 5 min; 4℃, hold.

[0076] Disruption conditions for substandard RNA samples: 94℃, 1s; 4℃, hold.

[0077] II. Synthesis of First-Strand cDNA

[0078] 1. Add the following reagents directly to the RNA sample tubes (prepare first, then add 9 μL to each reaction tube):

[0079]

[0080] 2. Perform the following reaction in a PCR instrument:

[0081] 42℃, 90 min; 70℃, 10 min; 4℃, hold;

[0082] III. Degradation primers and PCR amplification

[0083] 1. When the PCR reaction temperature drops to 4℃, remove the centrifuge tube, centrifuge briefly, and immediately add the following reagents:

[0084]

[0085] 2. After adding the system, vortex mix and briefly centrifuge;

[0086] 3. Perform the following reaction in a PCR instrument:

[0087] 37 ℃, 15 min;

[0088] 98 ℃, 3 min;

[0089] 98 ℃, 15 s; 55 ℃, 15 s; 72 ℃, 30 s; repeat these 3 conditions 9 times;

[0090] 72 ℃, 1 min;

[0091] 4℃, hold.

[0092] IV. Purification

[0093] After PCR, the sample was purified using 40 μL of magnetic beads.

[0094] V. Concentration Determination

[0095] Library concentrations were determined using 1× HS DNA Reagent reagent on a Qubit 4.0 fluorescence detector, and the results are shown in Tables 1 and 2 (RNAseq1, RNAseq2, and RNAseq3).

[0096] Table 1 is a record table for the experimental process, recording important parameters, including the amount of RNA input, whether mRNA purification was performed, the number of index PCR cycles, and the final library concentration (for equal library volumes), etc.

[0097]

[0098] Example 5: Basic Analysis and Comparative Analysis of Sequencing Data from the Library Obtained in this Invention

[0099] 1. Fundamental Analysis

[0100] The obtained library sequencing results were subjected to quality control using FastQC to remove adapter sequences, aligned to the reference genome, and relevant parameters were statistically analyzed, as shown in the table below:

[0101] Table 2 is a table of sequencing result data analysis parameters, including total number of sequences, alignment rate, and other relevant parameters.

[0102]

[0103] 2. Comparative Analysis

[0104] Data was compared with a reference genome, and gene expression statistical analysis was performed to obtain total gene expression statistics. Figure 4 Statistical analysis of differentially expressed genes between the two experimental groups Figure 5 The two experimental groups showed differences in gene expression volcanoes Figure 6 .

[0105] Based on the statistical tables of experimental parameters and basic analysis parameters mentioned above, and comparing the total gene expression levels and differential gene expression analysis results, the OTR experimental group, although slightly weaker in library concentration than the conventional RNA-seq library construction method, is sufficient to meet sequencing requirements. The amount of sequencing data and alignment results are sufficient to obtain consistent sequencing data. Comparative analysis shows no difference in total gene expression levels between the two groups, with very few differentially expressed genes (only one in each group). This sufficiently demonstrates that the two experimental methods yielded consistent results.

[0106] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings and specific examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A method for constructing a single-tube RNA-seq sequencing library, characterized in that, Includes the following steps: (1) 1 st cDNA synthesis: Take the processed RNA sample and use reverse transcriptase, RNAase inhibitor, OTR-6N primer and OTR-TSO primer with U inserted to synthesize the first-strand cDNA; (2) Library PCR: Add UDG, Index PCR Primer, and 2×PCR Mix to the reverse transcription product. Use UDG to degrade the U bases on the OTR-TSO primers and directly perform index PCR amplification. After purification, the RNAseq sequencing library is obtained.

2. The method for constructing a single-tube RNA-seq sequencing library according to claim 1, characterized in that, In step (1), the processed RNA sample refers to the extracted and purified RNA sample. If the sample quality is intact, it needs to be fragmented first before proceeding with this step. If the sample is severely degraded, there is no need to interrupt the process; proceed directly to this step.

3. The method for constructing a single-tube RNA-seq sequencing library according to claim 1, characterized in that, In step (1), the OTR-TSO primer with inserted base U is wherein the base U is deoxygenated dU or non-deoxygenated U.

4. The method for constructing a single-tube RNA-seq sequencing library according to claim 1, characterized in that, In step (1), the nucleotide sequence of the OTR-6N primer is shown in SEQ ID NO.1; the nucleotide sequence of the OTR-TSO primer with inserted U is shown in SEQ ID NO.

2.

5. The method for constructing a single-tube RNA-seq sequencing library according to claim 1, characterized in that, In step (2), the Index PCR Primer includes primers i5-Primer and i7-Primer; the nucleotide sequence of i5-Primer is shown in SEQ ID NO.3; and the nucleotide sequence of i7-Primer is shown in SEQ ID NO.

4.

6. A kit for constructing single-tube RNA-seq sequencing libraries, characterized in that, The kit contains OTR-TSO primers with an inserted base U.

7. The reagent kit according to claim 6, characterized in that, The OTR-TSO primer with inserted base U has the nucleotide sequence shown in SEQ ID NO.

2.

8. The reagent kit according to claim 6, characterized in that, The kit contains: RNA fragmentation reagent, reverse transcriptase, OTR-6N primer, OTR-TSO primer with U-insertion, Index PCR Primer, and uracil-DNA glycosylase UDG.

9. The reagent kit according to claim 8, characterized in that, The nucleotide sequence of the OTR-6N primer is shown in SEQ ID NO.1; the Index PCR Primer includes primers i5-Primer and i7-Primer; the nucleotide sequence of i5-Primer is shown in SEQ ID NO.3; and the nucleotide sequence of i7-Primer is shown in SEQ ID NO.

4.

10. The use of the kit according to any one of claims 6-9 in the construction of single-tube RNAseq sequencing libraries.

Images