Multiplex PCR (Polymerase Chain Reaction) primer combination for identifying species of pangolin and application of multiplex PCR primer combination

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a multiplex PCR primer combination for identifying species of pangolin and application of the multiplex PCR primer combination. Three pairs of specific primers are designed aiming at species specific conserved regions in three kinds of pangolin mitochondrial genes and respectively target COI genes of Chinese pangolin, pangolin males and pangolin south African. By utilizing the primer group, synchronous identification of three pangolin species can be realized in the same PCR reaction system, and visual interpretation is performed through agarose gel electrophoresis according to the size of an amplified fragment. The detection method disclosed by the invention has the advantages of rapidness, accuracy, strong specificity, simplicity and convenience in operation and the like, is suitable for species identification of squama manis scales, tissues, blood and products thereof, and provides an efficient and reliable technical means for illegal trade traceability and species protection monitoring and identification of the squama manis.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a multiplex PCR primer combination for identifying pangolin species and its application. Background Technology

[0002] Pangolins are among the most heavily traded mammals globally, and all species are listed in CITES Appendix I, prohibiting international commercial trade. The Chinese pangolin, Malayan pangolin, and South African pangolin are morphologically difficult to distinguish, especially in scales, tissues, blood, or processed products, where traditional morphological identification methods have significant limitations. Currently, species identification largely relies on DNA barcoding technologies, such as COI and Cyt b mitochondrial gene fragment sequencing. While this method is highly accurate, it is time-consuming and costly, making it unsuitable for large-scale screening or rapid on-site testing.

[0003] Multiplex PCR technology can simultaneously amplify multiple specific targets in a single reaction system and achieve parallel detection through product length or label differences. It has outstanding advantages such as high throughput, fast speed, low cost, and small sample requirements, and is particularly suitable for species identification, pathogen typing, and genetic screening.

[0004] Therefore, there is an urgent need for a multiplex PCR detection primer that can quickly and accurately distinguish between Chinese, Malayan, and South African pangolins. Summary of the Invention

[0005] The purpose of this invention is to provide a set of multiplex PCR detection primers for the simultaneous identification of Chinese pangolin, Malayan pangolin and South African pangolin. Using the primer set, the three pangolin species can be identified simultaneously in the same PCR reaction system, and the results can be visualized by agarose gel electrophoresis based on the size of the amplified fragments.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a set of multiplex PCR primers for the simultaneous identification of Chinese pangolin, Malayan pangolin, and South African pangolin. The primers consist of three pairs of specific primers, which can achieve uniform amplification in the same PCR reaction system and produce products of different lengths that can be distinguished by electrophoresis. The first primer pair used to identify the Chinese pangolin has nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The second primer pair used to identify Malayan pangolins has nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The third primer pair used to identify the South African pangolin has nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0007] The present invention also provides a multiplex PCR detection kit for identifying pangolin species, the kit comprising the primer combination described above.

[0008] Preferably, the kit further includes DNA extraction reagents and PCR amplification reagents.

[0009] This invention also provides a method for identifying pangolin species, the method comprising the following steps: S1: Extract total DNA from the sample; S2: Using the DNA extracted in step S1 as a template, the sample is subjected to multiplex PCR amplification using the primer set described in claim 1 to obtain the amplification product; S3: Perform agarose gel electrophoresis analysis on the PCR amplification products from step S2, observe the results under a gel imaging system, and determine the species type.

[0010] Preferably, the PCR amplification reaction system in step S2 includes: 12.5 μL of 2×SuperTaq PCR StarMix, 1.5 μL each of 10 μM ZH-COI-F / ZH-COI-R and 10 μM ML-COI-F / ML-COI-R, 2 μL of NF-COI-F / NF-COI-R template DNA, and deionized water added to a final volume of 25 μL.

[0011] Preferably, the reaction conditions for the multiplex PCR amplification reaction in step S2 are: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 25 cycles; and finally 72℃ extension for 5 min.

[0012] Preferably, the method for determining the species type in step S3 is as follows: When there are no amplification products, the species is not present in the sample. If the amplification product is a single fragment of 372 bp, then the sample is a Chinese pangolin. If the amplification product is a single fragment of 594 bp, then the sample is a South African pangolin. If the amplification products are two fragments with sizes of 594bp and 1169bp respectively, then the sample is a Malayan pangolin.

[0013] This invention also provides the use of the primer combination described above in the preparation of reagents or kits for the simultaneous identification of the Chinese pangolin, Malayan pangolin, and South African pangolin. Compared with the prior art, the advantages of this invention are: (1) This invention utilizes the advantages of multiplex PCR, which can complete the screening of three species in a single reaction, saving detection costs and time. Compared with outsourced sequencing, the detection cost of a single sample can be reduced by about 70%-80%, providing an economical and feasible technical solution for large-scale screening and routine monitoring.

[0014] (2) This invention provides for the first time a set of multiplex PCR primers and a matching kit that can simultaneously and rapidly distinguish between Chinese pangolin, Malayan pangolin and South African pangolin in one reaction tube, filling a technological gap in this field.

[0015] (3) The three pairs of primers designed in this invention target highly specific conserved regions of the mitochondrial genes of three pangolin species. After rigorous verification, there is no cross-amplification with other common mammals (such as cats, dogs, and mice) and different pangolin species, ensuring that the identification results are accurate and reliable.

[0016] (4) The widespread application of this invention can provide rapid and authoritative species identification evidence for combating the illegal trade in pangolins and their products, which is helpful for case investigation, source tracing, and judicial conviction. At the same time, it also provides an efficient tool for monitoring wild pangolin populations, identifying rescued individuals, and managing genetic resources, and has significant social benefits and ecological protection value. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Schematic diagram of primer concentration optimization detection results; where M: DL2000 Marker, 1-3: Malayan pangolin primer concentration 0.2uM, 4-6: final concentration of Malayan pangolin primer 0.4uM, 7-9: final concentration of Malayan pangolin primer 0.6uMμL, 10-12: final concentration of South African pangolin primer 0.2uM, 13-15: final concentration of South African pangolin primer 0.4uM, 16-18: final concentration of South African pangolin primer 0.4uM, 19-21: final concentration of Chinese pangolin primer 0.2uM, 0.4uM, 0.6uM, 22-24: final concentration of Chinese pangolin primer 0.2uM, 0.4uM, 0.6uM, 25-27: final concentration of Chinese pangolin primer 0.2uM, 0.4uM, 0.6uM, 28: negative control.

[0019] Figure 2A schematic diagram of the detection results optimized for reaction temperature; where M: DL2000 Marker, 1-8: Malayan pangolin primer temperature 54℃-61℃, 9-16: Chinese pangolin primer temperature 54℃-61℃, 18-25: South African pangolin primer temperature 54℃-61℃, 17: negative control.

[0020] Figure 3 This is a schematic diagram of the results of the primer specificity analysis; where M: DL2000 Marker, 1: negative control, 2: Chinese pangolin DNA, 3: Malayan pangolin DNA, 4: South African pangolin DNA, 5: cat DNA, 6: canine DNA, and 7: mouse DNA.

[0021] Figure 4 This is a schematic diagram illustrating the primer sensitivity analysis results; where M represents the DL2000 Marker, and 1-8 represent the concentration of the South African pangolin-positive plasmid (1.6 × 10⁻⁶). 8 -1.6×10 1 copies / μL, 9-16: Malayan pangolin positive plasmid concentration 1.25×10 8 -1.25×10 1 copies / μL, 17-24: The concentration of the Chinese pangolin-positive plasmid was 3.21 × 10⁻⁶. 8 -3.21×10 1 copies / μL.

[0022] Figure 5 This is a schematic diagram of the repeatability analysis results of the primers; where M: DL2000 Marker, 1-6: South African pangolin positive plasmid and test sample, 7-12: Malayan pangolin positive plasmid and test sample, 13-18: Chinese pangolin positive plasmid and test sample, 19: negative control. Detailed Implementation

[0023] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0024] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0025] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0026] Example 1 Primer Design This invention designs multiplex PCR primers by extensively comparing highly conserved and specific regions of the mitochondrial genome of the Chinese pangolin, Malayan pangolin, and South African pangolin published in the NCBI (National Center for Biotechnology Information) GenBanK database, specifically: ZH-COI-F: 5'CCCGAAGTATACATCCTAATTCTCC 3' (SEQ ID NO.1) ZH-COI-R: 5'GTCTAGGGATGAATTGGCTAAT 3' (SEQ ID NO.2) ML-COI-F: 5'TAAGTCTTCTAATTCGCGCTGA 3' (SEQ ID NO.3) ML-COI-R: 5'GTTTACGCCCACGAAC 3' (SEQ ID NO.4) NF-COI-F: 5'TGGAAATTGGCTAGTGCCTTTGA 3' (SEQ ID NO.5) NF-COI-R: 5'GCTCAGACTATACCTATGTACCCA 3' (SEQ ID NO.6) Example 2 2.1 Sample DNA Extraction Extract DNA using standard methods or a DNA extraction kit. Store the extracted DNA at -20°C for later use or use it immediately for PCR amplification.

[0027] 2.2 Construction of positive plasmids Construct a positive plasmid, and construct a recombinant plasmid DNA containing the target gene fragment. Transform the recombinant plasmid into DH 5α competent cells for amplification. Extract the plasmid using the PlasmidMini Kit I kit, and determine the plasmid concentration using a full-wavelength microplate reader (Thermo Fisher Scientific). Store at -20℃.

[0028] 2.3 Optimization of Multiplex PCR Reaction Conditions To optimize the reaction system and conditions, the prepared positive plasmid standard was diluted to 0.01 ng / μL as a detection template. Each pair of specific primers was diluted separately, with final concentration gradients of 0.2 μM, 0.4 μM, and 0.6 μM. Using a matrix method, combinations of different primer concentrations were screened, and the optimal multiplex PCR primer concentrations were determined to be: ZH-COI-F / ZH-COI-R and NF-COI-F / NF-COI-R at a final concentration of 0.4 μM, and ML-COI-F / ML-COI-R at a final concentration of 0.6 μM. The annealing temperature was set between 54-61℃ to determine the optimal annealing temperature, which was ultimately determined to be 60℃.

[0029] The specific steps for multiplex PCR are as follows: S1 DNA template preparation: Genomic DNA was extracted from the sample to be tested using a commercial DNA extraction kit, following the instructions.

[0030] S2 Multiplex PCR amplification: Using DNA as a template, the above primers are used to perform multiplex PCR amplification on the sample to obtain the amplification product; The reaction system consisted of 12.5 μL of 2×SuperTaq PCR StarMix, 1.5 μL each of 10 μM ZH-COI-F / ZH-COI-R and 10 μM ML-COI-F / ML-COI-R, 1 μL each of 10 μM NF-COI-F / NF-COI-R, and 2 μL of template DNA. Deionized water was added to bring the total volume to 25 μL.

[0031] The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 25 cycles; and a final extension at 72℃ for 5 min.

[0032] S3 Electrophoresis Detection and Result Interpretation: PCR amplification products were analyzed by agarose gel electrophoresis. A 1% agarose gel was prepared (1 g agarose dissolved in 100 mL of 1× TAE buffer, heated to dissolve, and then 10 μL of nucleic acid dye was added). After solidification, the gel was placed in an electrophoresis tank. 9 μL of PCR product was mixed with 1 μL of 10× Loading Buffer and loaded onto the gel. Electrophoresis was performed in 1× TAE buffer at 120 V. After electrophoresis, specific bands were observed under a gel imaging system, and the species type was determined based on the band size.

[0033] The positive plasmid samples and the confirmed test samples were tested according to the above method. Each sample was performed in triplicate, with DNA extracted from each sample and analyzed in the same amplification run. The positive plasmid from the Chinese pangolin and the amplification product of the test sample both showed a single fragment at 372 bp; the positive plasmid from the South African pangolin and the test sample showed a single fragment at 594 bp; the positive plasmid from the Malayan pangolin showed a single fragment at 1169 bp, and the test sample showed two fragments at 594 bp and 1169 bp (e.g., ...). Figure 5 (As shown).

[0034] This indicates that the test results were consistent when repeated three times.

[0035] Example 3 Specificity Test To investigate whether this detection method would cross-react with other common mammals (cats, dogs, and mice), DNA from cats, dogs, and mice was used as templates, DNA from three types of pangolins was used as a positive control, and a negative control (deionized water) was set up to evaluate the specificity of the detection method.

[0036] The different templates were detected using the multiplex PCR detection method established above.

[0037] The results are as follows Figure 3 It shows that, from Figure 3 As can be seen, after the negative control was reacted with cat, dog, and mouse DNA as templates, no bands were shown in the corresponding lanes, indicating that the detection method has good specificity.

[0038] Example 4 Sensitivity Test The copy number of the constructed positive plasmid standard was calculated using the following formula: Copy number (copies / μL) = Concentration (ng / μL) × 6.022 × 10⁻⁶ 23 / [Plasmid size (bp) × 660 × 10] 9 The positive plasmid was then serially diluted 10-fold. Using positive plasmids of different dilutions as templates, and with optimized primer concentrations and reaction conditions, a negative control (deionized water) was set up to evaluate the sensitivity of the detection method.

[0039] Test results as follows Figure 4 As shown, the results indicate that the detection limits of this method for different pangolin species are as follows: South African pangolin 1.6 × 10⁻⁶. 4 copies / μL; Malayan pangolin 1.25×10 4 copies / μL; Chinese pangolin 3.21×10 4 copies / μL.

[0040] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A set of multiplex PCR primers for simultaneous identification of the Chinese pangolin, Malayan pangolin, and South African pangolin, characterized in that, The PCR reaction consists of three pairs of specific primers, which can achieve uniform amplification in the same PCR reaction system and produce products of different lengths that can be distinguished by electrophoresis. The first primer pair used to identify the Chinese pangolin has the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; The second primer pair used to identify Malayan pangolins has nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The third primer pair used to identify the South African pangolin has nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

2. A multiplex PCR detection kit for identifying pangolin species, characterized in that, The kit comprises the primer combination of claim 1.

3. The reagent kit according to claim 2, characterized in that, The kit also includes DNA extraction reagents and PCR amplification reagents.

4. A method for identifying pangolin species, characterized in that, The method includes the following steps: S1: Extract total DNA from the sample; S2: Using the DNA extracted in step S1 as a template, the sample is subjected to multiplex PCR amplification using the primer set described in claim 1 to obtain the amplification product; S3: Perform agarose gel electrophoresis analysis on the PCR amplification products from step S2, observe the results under a gel imaging system, and determine the species type.

5. The method according to claim 4, characterized in that, The PCR amplification reaction system described in step S2 includes: 12.5 μL of 2×SuperTaq PCR StarMix, 1.5 μL each of 10 μM ZH-COI-F / ZH-COI-R and 10 μM ML-COI-F / ML-COI-R, 2 μL of NF-COI-F / NF-COI-R template DNA, and deionized water added to a final volume of 25 μL.

6. The method according to claim 4, characterized in that, The reaction conditions for the multiplex PCR amplification reaction in step S2 are as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 15 s, for a total of 25 cycles; and final extension at 72℃ for 5 min.

7. The method according to claim 4, characterized in that, The method for determining the species type in step S3 is as follows: When there are no amplification products, the species is not present in the sample. If the amplification product is a single fragment of 372 bp, then the sample is a Chinese pangolin. If the amplification product is a single fragment of 594 bp, then the sample is a South African pangolin. If the amplification products are two fragments with sizes of 594bp and 1169bp respectively, then the sample is a Malayan pangolin.

8. Use of the primer combination as described in claim 1 in the preparation of reagents or kits for the simultaneous identification of Chinese pangolin, Malayan pangolin and South African pangolin.

Images