Human MTHFR, MTRR and SLC19A1 gene detection kit, detection method and application of human MTHFR, MTRR and SLC19A1 gene detection kit

By combining HRM technology with real-time quantitative PCR and designing specific primer pairs, the problems of incomplete detection and high cost of MTHFR and MTRR genes in existing technologies have been solved, enabling rapid and accurate polymorphism detection, which is suitable for fecal microbiota transplantation donor screening and various sample types.

CN122012735APending Publication Date: 2026-05-12SHANGHAI FENGDAO BIOMEDICAL TECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI FENGDAO BIOMEDICAL TECHNOLOGY CO LTD
Filing Date
2026-02-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In existing technologies, MTHFR and MTRR gene testing products do not cover the SLC19A1 gene. The testing methods are cumbersome and costly, and there is no genetic background screening for fecal microbiota transplantation scenarios, resulting in incomplete testing, high costs, and limited application scenarios.

Method used

High-resolution melting curve analysis (HRM) technology, combined with real-time quantitative PCR, was used to design specific primer pairs to detect four gene loci: MTHFR 677, MTHFR 1298, MTRR 66, and SLC19A1 80. The entire transport-metabolism-reduction pathway was assessed, simplifying the operation and reducing costs.

Benefits of technology

It enables rapid and accurate polymorphism detection, reduces detection costs, is applicable to various sample types, is suitable for fecal microbiota transplantation donor screening, improves detection efficiency and sensitivity, and is applicable to whole blood, tissue and other samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012735A_ABST
    Figure CN122012735A_ABST
Patent Text Reader

Abstract

The invention discloses a human MTHFR (methylenetetrahydrofolate reductase), MTRR (methylenetetrahydrofolate reductase) and SLC19A1 gene detection kit. The kit is based on a high-resolution melting curve analysis technology, and comprises four groups of primer pairs aiming at C677T and A1298C sites of MTHFR genes, A66G sites of MTRR genes and A80G sites of SLC19A1 genes. The kit can be used for rapidly, sensitively and accurately identifying the genotypes of the four key sites under the same reaction procedure by detecting the melting temperature of PCR products and the difference of curve shapes. The kit is suitable for risk assessment of cardiovascular diseases and birth defects, is more innovatively applied to donor screening and receptor assessment of coprophilous fungus transplantation, fills the blank of genetic background detection tools in the field, and has the advantages of low cost, high sensitivity, high specificity, simplicity and convenience in operation, high repeatability, quick and objective detection result and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0002] This invention belongs to the field of biomedical detection technology, specifically relating to molecular diagnostic technology, and particularly to a kit for detecting human MTHFR, MTRR and SLC19A1 gene polymorphisms, and the application of the kit in high-resolution melting curve (HRM) analysis, which is particularly suitable for genetic background screening related to fecal microbiota transplantation. Background Technology

[0004] Folic acid is an essential B vitamin for the human body, playing a central role in DNA synthesis, repair, and methylation modification. Folic acid deficiency can cause uracil misinsertion in human DNA and chromosome breaks, leading to genomic instability and an increased probability of mutations. Abnormalities in the folic acid metabolic pathway can result in hyperhomocysteinemia, which in turn increases the risk of cardiovascular disease, neural tube defects, recurrent miscarriages, and various cancers. The human body cannot synthesize folic acid itself and must obtain it from diet or gut microbiota metabolites, relying on a series of key enzymes and transport proteins for its metabolism.

[0005] Polymorphisms in the following three genes are particularly crucial in the folic acid metabolism pathway:

[0006] (1) The MTHFR (5,10-methylenetetrahydrofolate reductase) gene encodes 5,10-methylenetetrahydrofolate reductase and is located on chromosome 1 at 1p36.3. MTHFR is 19.3kb in length and has 12 exons. The mRNA is 7,105bp in length and encodes a protein composed of 657 amino acid residues. It can catalyze the reduction of 5,10-MTHFR to 5-methyltetrahydrofolate and, as a methyl donor, participates in the methylation of homocysteine ​​to methionine. MTHFR gene mutations mainly occur at two sites: 677 and 1298. The mutation at site 677 (C>T) will cause different degrees of changes in the activity of the 5,10-methylenetetrahydrofolate reductase encoded by the gene. The 677TT mutation reduces the enzyme activity by almost 70%, while the 677CT mutation reduces the activity by 35%. A polymorphism at position 1298 of the MTHFR gene results in the substitution of isoleucine with methionine, leading to a decrease in the rate of homocysteine ​​remethylation. According to relevant literature, the mutation at position 1298 can have a synergistic effect with the mutation at position 677, further reducing the activity of 5,10-methylenetetrahydrofolate reductase.

[0007] (2) The MTRR (5-methyltetrahydrofolate-homocysteinemethyltransferase-reductase) gene encodes methionine synthase reductase, located on chromosome 5p15.3-p15.2. The MTRR gene is 32021 kb in length, and the mRNA is 3274 bp in length, containing 15 exons and encoding a protein with 726 amino acids. The methionine synthase reductase encoded by MTRR can regenerate functionally active methionine synthase through reducing methylation. A mutation at position 66 (A>G) in the MTRR gene can affect the folate DNA methylation metabolic pathway.

[0008] (3) SLC19A1 is a reduced folic acid carrier gene that encodes the lipid-soluble carrier 19A1 on the cell membrane. It is involved in the active transport of various substances into the cell. The common polymorphism site of SLC19A1 is 80 (A>G), which can replace the encoded histidine at position 27 with arginine, thereby changing the function of the expressed protein.

[0009] Currently available in vitro diagnostic kits only target the MTHFR and MTRR genes, lacking kits specifically for the MTHFR, MTRR, and SLC19A1 genes. Furthermore, most kits employ probe-based methods or direct sequencing and pyrosequencing. To meet current public demand and facilitate large-scale sample testing, these methods are costly and time-consuming, and also prolong diagnostic time. Sequencing methods are cumbersome, time-consuming, and have low sensitivity. Therefore, there is an urgent need to develop a highly specific, sensitive, and cost-effective method capable of detecting genotypes at all four loci (MTHFR, MTRR, and SLC19A1). This would allow for better and faster detection of genotypes at these four loci.

[0010] Therefore, in summary, the existing technology has the following shortcomings:

[0011] (1) Incomplete detection targets: Most kits only cover MTHFR and MTRR, neglecting the importance of the folate transporter SLC19A1. Studies have shown that assessing only metabolic enzymes without assessing transporters cannot fully reflect an individual's folate utilization capacity.

[0012] (2) Limitations of the method: Sequencing is cumbersome, time-consuming and costly; although TaqMan probe method has good specificity, it has high synthesis cost and is limited by the number of fluorescence channels, making multiple detection difficult.

[0013] (3) Limited application scenarios: Existing products are mostly used for prenatal screening or cardiovascular risk assessment, and there are no genetic background screening products specifically for fecal microbiota transplantation. In fecal microbiota transplantation, the interaction between the host and donor microbiota is significantly affected by the host's genetic background (especially genes that affect the metabolism of the intestinal microenvironment).

[0014] Therefore, developing a low-cost, easy-to-operate, and highly sensitive gene detection kit and method capable of detecting four key sites—MTHFR, MTRR, and SLC19A1—is of great significance for improving the folic acid metabolism assessment system and guiding the screening of fecal microbiota transplantation donors. Summary of the Invention

[0016] The purpose of this invention is to provide a human MTHFR, MTRR, and SLC19A1 gene detection kit based on high-resolution melting curve analysis (HRM) technology. This kit can rapidly and accurately detect polymorphisms at four gene loci—MTHFRC677T and A1298C, MTRR A66G, and SLC19A1 A80G—under the same reaction procedure.

[0017] The technical solution adopted in this invention is as follows:

[0018] A human MTHFR, MTRR, and SLC19A1 gene detection kit includes the following components: four detection solutions (MTHFR 677, MTHFR 1298, MTRR 66, and SLC19A1 80), nucleic acid amplification reaction solution, enzyme mixture, positive control standard, and blank control.

[0019] The four detection solutions, MTHFR 677 / MTHFR 1298 / MTRR 66 / SLC19A1 80, include the following four primer pairs:

[0020] The first primer pair consists of a forward primer and a reverse primer targeting the MTHFR 677 site, the nucleotide sequences of which are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0021] The second primer pair consists of a forward primer and a reverse primer targeting the MTHFR 1298 site, the nucleotide sequences of which are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0022] The third primer pair consists of a forward primer and a reverse primer targeting the MTRR 66 site, the nucleotide sequences of which are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0023] The fourth primer pair consists of a forward primer and a reverse primer targeting the SLC19A1 80 site, the nucleotide sequences of which are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively.

[0024] The nucleic acid amplification reaction solution also includes: dNTPs, magnesium ions, buffer solution, and saturated fluorescent dye.

[0025] Preferably, the enzyme mixture is DNA polymerase; the saturated fluorescent dye is selected from SYBR Green, LCGreen, Eva Green or Reso Light.

[0026] Preferably, the positive control standard includes wild-type homozygous genomic DNA, mutant heterozygous genomic DNA, and mutant homozygous genomic DNA targeting four loci.

[0027] This invention also discloses a method for detecting human MTHFR, MTRR, and SLC19A1 genes using the above-mentioned gene detection kit, characterized by comprising the following steps:

[0028] Step 1: Extract human genomic DNA from the sample to be tested;

[0029] Step 2, Prepare the PCR reaction system: Mix each detection solution with the nucleic acid amplification reaction solution, enzyme mixture, purified water and the sample to be tested obtained in Step 1, respectively;

[0030] Step 3: Perform real-time quantitative PCR amplification;

[0031] Step 4: Perform high-resolution melting curve analysis on the amplified product obtained in Step 3;

[0032] Step 5, Data Processing and Result Determination: By analyzing the peak shape of the melting curve and the changes in melting temperature, the genotypes of the test samples at the four loci are determined.

[0033] Preferably, the PCR amplification in step 3 includes the following steps:

[0034] Step 31, Pre-denaturation: Hold at 95°C for 2 to 10 minutes;

[0035] Step 32, amplification cycle: perform 35-50 cycles at 95°C for 10 seconds, at 60°C for 25 seconds, and at 72°C for 10 seconds.

[0036] Preferably, the high-resolution melting curve analysis in step 4 includes the following steps:

[0037] Step 41, melting analysis: Heat at 95°C for 1 minute, at 40°C for 1 minute, then heat to 65°C, and then heat to 95°C at a rate of 0.01°C / s to 1°C / s, while continuously collecting fluorescence signals.

[0038] Preferably, the result determination criteria in step 5 are as follows:

[0039] The wild-type homozygote exhibited a single melting peak, and the melting temperature value was consistent with that of the wild-type standard.

[0040] The mutant homozygote exhibited a single melting peak, and the melting temperature value was consistent with that of the mutant standard.

[0041] Heterozygotes exhibit double melting peaks or characteristic changes in the shape of the melting curve, and the curve morphology is consistent with that of the heterozygous standard.

[0042] The present invention also discloses the use of the above-mentioned gene detection kit in human MTHFR, MTRR and SLC19A1 genotyping for non-disease diagnostic purposes.

[0043] The present invention also discloses the use of the above-mentioned gene detection kit in the preparation of products for screening fecal microbiota transplantation donors or assessing the suitability of fecal microbiota transplantation recipients.

[0044] Preferably, the screening or evaluation includes: detecting the MTHFR, MTRR, and SLC19A1 genotypes of the individuals to be tested to assess the individual's folate metabolism capacity and homocysteine ​​level risk, thereby guiding donor-recipient pairing for fecal microbiota transplantation or post-transplantation nutritional intervention strategies.

[0045] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0046] 1. Comprehensiveness: For the first time, it integrates SLC19A1 gene detection, forming a complete pathway assessment of "transport-metabolism-reduction" with MTHFR and MTRR. It is not only suitable for routine screening, but also fills the gap in the assessment of the genetic background of fecal microbiota transplantation donors.

[0047] 2. Method advantages: Using HRM technology, there is no need for expensive fluorescent probes. Only one pair of primers is needed to distinguish between wild, heterozygous and mutant genotypes, which significantly reduces the detection cost.

[0048] 3. High efficiency and convenience: Closed tube testing avoids the risk of contamination caused by opening the tube after PCR; the testing time is short, and results can be obtained in about 1.5-2 hours.

[0049] 4. Wide applicability: Applicable to various sample types such as whole blood, tissue, and paraffin sections, with low requirements for DNA concentration (as low as 5 ng / μL for detection).

[0050] 5. The MTHFR, MTRR and SLC19A1 gene detection kits provided by this invention also have the advantages of simple operation, strong reproducibility, rapid detection results and low and objective price, which are conducive to large-scale promotion and use.

[0051] 6. The comparison between the detection method of the present invention and existing detection methods is as follows:

[0052] Attached Figure Description

[0054] Figure 1 To set up the PCR amplification program.

[0055] Figure 2 This is a melting curve of the positive control standard for the test sample at the MTHFR C677T site.

[0056] Figure 3 This is a melting curve of the wild-type gene at the MTHFR C677T site in the sample to be tested.

[0057] Figure 4 and Figure 5 This is a melting curve of the mutant gene at the SLC19A1 A80G site in the sample to be tested.

[0058] Figure 6 and Figure 7 This is a melting curve of the heterozygous gene at the SLC19A1 A80G site in the sample to be tested.

[0059] Figure 8 and Figure 9 This is a melting curve of the wild-type gene at the SLC19A1 A80G site in the sample to be tested.

[0060] Figures 10 to 13 Melting curve of heterozygous gene at MTHFR A1298C site in the sample to be tested (repeated 4 times).

[0061] Figures 14 to 17 Melting curve of heterozygous gene at MTHFR C677T site in the sample to be tested (repeated 4 times).

[0062] Figures 18 to 23 Melting curve of the mutant gene at the MTHFR C677T site in the sample to be tested (repeated 6 times).

[0063] Figure 24 This is a melting curve of the heterozygous gene at the SLC19A1 A80G site in the sample to be tested.

[0064] Figure 25This is a melting curve of the wild-type gene at the SLC19A1 A80G site in the sample to be tested.

[0065] Figure 26 This is a melting curve of the wild-type gene at the MTRR A66G site in the sample to be tested.

[0066] Figure 27 This is a melting curve of the heterozygous gene at the MTHFR A1298C site in the sample to be tested.

[0067] Figure 28 This is a melting curve of the heterozygous gene at the SLC19A1 A80G site in the sample to be tested.

[0068] Figure 29 This is a melting curve of the mutant gene at the MTHFR C677T site in the sample to be tested. Detailed Implementation

[0070] This invention's gene detection kit is based on a real-time quantitative PCR platform. Utilizing PCR amplification technology and high-resolution melting analysis (HRMA) technology, and taking into account the principle that base differences between genotypes cause variations in product melting temperature and melting curve differences, the kit detects the differences in melting curves between samples and standards for four genotypes. By comparing and analyzing which standards the sample matches, the genotype of the sample can be identified. The melting curve is designed based on the principle that saturated fluorescent dyes specifically bind to double-stranded DNA, emitting fluorescence while single-stranded DNA does not. The melting process causes the DNA double strands to unwind as the temperature increases, generating changes in fluorescence signal, which are then plotted using high-frequency real-time fluorescence detection.

[0071] The detection sites for the four genes in this application are shown below:

[0072] Gene Detection sites MTHFR NM-005957.4: C.665>T (p.Ala222Val; C677T) MTHFR NM-005957.4: C.1286A>C (p.Glu429Ala; A1298C) MTRR NM-002454.2: c.66A>G (p.Ile22Met; A66G) SLC19A1 NM-194255.2: C.80A>G (p.His27Arg; A80G)

[0073] (1) Introduction to the MTHFR C677T site

[0074] Gene sequence: CCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTG.

[0075] 5,10-Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in methionine-folate metabolism. It reduces 5,10-methylenetetrahydrofolate in the body to 5-methyltetrahydrofolate. Homocysteine, with the participation of 5-methyltetrahydrofolate and vitamin B12, is converted into an active methyl group, which is then directly provided to the body as a macromolecule requiring methyl groups. Normal MTHFR activity plays an important role in preventing homocysteine ​​accumulation. Mutations in the MTHFR gene that reduce MTHFR activity can impair the conversion of homocysteine ​​to methionine, leading to decreased folate levels and hyperhomocysteinemia.

[0076] The 677C>T polymorphism transforms MTHFR alanine into valine, which is located in the enzyme's active region. The activity of the heterozygous enzyme is reduced to 65%, and that of the homozygous enzyme is reduced to 30%.

[0077] Mothers carrying the T allele have a higher risk of giving birth to children with Down syndrome than mothers carrying the 677C / C allele. Compared to the CC wild-type, the odds ratio (OR) for Chinese women with the TT genotype who give birth to children with neural tube defects is 3.35, indicating that carrying the TT genotype is a risk factor for giving birth to a child with neural tube defects. The heterozygous CT genotype in Chinese women is also a genetic risk factor for neural tube defects. The risk of offspring with non-syndromic cleft lip and palate is 2.420 times higher for parents carrying the T allele than for offspring of parents without the T allele. The risk of offspring with non-syndromic cleft lip and palate is 4.162 times higher for both mother and child who are homozygous for the TT mutation compared to offspring who are not homozygous for the TT mutation. Maternal MTHFR gene C677T polymorphism is associated with the occurrence of congenital heart disease in their offspring, and maternal carriers of the homozygous TT genotype are an important risk factor for congenital heart disease in their offspring.

[0078] (2) Introduction to the MTHFR A1298C site

[0079] Gene sequence: CTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGAGTGATGCTGGAGTGGG.

[0080] A1298C is another polymorphic site in the MTHFR gene. Mutations at this site convert glutamate to alanine, reducing enzyme activity to 83% in the heterozygous type and 61% in the homozygous type. Compared to the AA genotype, Chinese women with the CC and CA genotypes have a higher risk of giving birth to children with NTDs. Heterozygous 677C>T and 1298A>C genotypes show higher homocysteine ​​levels and lower plasma folate concentrations. The risk of offspring with non-syndromic cleft lip and palate is approximately 4.43% higher in the mother with the 677CT / 1298AC genotype compared to the 677CC / 1298AA genotype.

[0081] (3) Introduction to the MTRR A66G site

[0082] Gene sequence: ACAGCAGGGACAGGCAAAGGCCATCGCAGAAGAAATTGTGAGCAAGCTGTGGTACATGGATTTTCTGCAGATCTTCACTGTATTAGTGAATCCGATAAGGTTAGAGCCGTTACAGTGGA.

[0083] Methionine synthase reductase (MTRR) is a flavoprotein-associated enzyme that maintains the activity of methionine synthase and plays an important regulatory role in maintaining the methionine cycle in the body.

[0084] The gene for this enzyme exhibits a 66A→G polymorphism, leading to the substitution of methionine for isoleucine and a significant reduction in enzyme activity. This results in decreased methionine synthase activity and an accumulation of homocysteine ​​in the body. Mothers with the MTRR A66G mutation have an increased risk of Down syndrome, while those with the MTHFR gene 677C-T mutation have a significantly increased risk of Down syndrome.

[0085] (4) Introduction to the SLC19A1 A80G site

[0086] Gene sequence: CTGAGCAGGATGGTGCCCTCCAGCCCAGCGTGGAGAAGCAGGTGCCCGTGGAACCTGGGCCTGACCCCGAGCTCCGGTCCTGGCGGCACCTCGTGTGCTACCTTTGCTTCTACGGCTTCATGGCGCA.

[0087] Reduced folate carrier 1 (RFC1) and folate receptor (FR) work together to transport folate from tissues to cells. Point mutations in the RFC1 gene can cause defects in folate transport, thereby affecting folate metabolism. RFC1 has an important impact on developing embryos, especially on the transport of folate across the placenta; therefore, changes in the RFC1 gene may affect normal fetal tissue development.

[0088] The risk of NTDs in offspring of mothers with the RFC1GG genotype is higher than that of mothers with the AA genotype; mothers who do not supplement with folic acid in early pregnancy have a higher risk of neural tube defects in their offspring than mothers who do supplement with folic acid; and offspring of mothers who do not supplement with folic acid during pregnancy have a higher risk of neural tube defects in offspring with the GG and GA genotypes than in offspring with the AA genotype.

[0089] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0090] Example 1: Composition and Preparation of the Reagent Kit

[0091] This embodiment describes the preparation of a gene detection kit for detecting the above four gene loci, with a specification of 12 samples per kit. The gene detection kit includes four detection solutions: MTHFR 677, MTHFR 1298, MTRR 66, and SLC19A1 80. The kit also includes nucleic acid amplification reaction solution, enzyme mixture, positive control standard, and blank control.

[0092] 1. Four types of test solutions

[0093] The four detection solutions include four pairs of specific primers for high-resolution melting curve detection, and their specific gene sequences are shown in Table 1.

[0094]

[0095] Each primer pair was stored in a separate brown centrifuge tube; the concentrations of the primers in the tube and the concentrations added to the PCR reaction system are shown in Table 2.

[0096]

[0097] 2. Nucleic acid amplification reaction solution

[0098] The nucleic acid amplification reaction solution is a mixture of the components shown in Table 3.

[0099]

[0100] The PCR buffer was a commercially available 10× concentration, the saturated fluorescent dye was a commercially available 2× concentration, and 1.0 mM dNTP and 10 mM magnesium chloride solutions were prepared by taking the corresponding volumes and mixing them together.

[0101] The nucleic acid amplification reaction solution was stored in brown centrifuge tubes. In this embodiment, the saturated fluorescent dye was indicated by the SYBR Green signal.

[0102] 3. Enzyme mixture

[0103] The enzyme mixture in this embodiment is DNA polymerase.

[0104] DNA polymerase was stored in clear centrifuge tubes at a concentration of 5 U / μL, with a single tube volume of 16 μL.

[0105] 4. Positive control standard

[0106] Plasmids or genomic DNA containing wild-type, heterozygous, and mutant sequences at the above four sites were constructed, with a single tube concentration of 5 ng / μL.

[0107] In this embodiment, each positive control standard is stored in one transparent centrifuge tube, as shown in Table 4.

[0108]

[0109] 5. Blank control

[0110] The blank control in this example is purified water.

[0111] When using the kit described in this example, please note the following:

[0112] (1) The operation should be carried out by personnel with professional experience or who have been trained and qualified.

[0113] (2) The reagents in the reagent tube should be fully melted, mixed and centrifuged before use so that the liquid is concentrated at the bottom of the reagent tube.

[0114] (3) The laboratory should be used in separate areas for reagent preparation, sample processing, reaction solution preparation, and amplification detection and analysis. During operation, workers should wear complete work clothes, hats, shoes, gloves, etc. Each area should be used exclusively for its own purposes and should not be used interchangeably to avoid contamination.

[0115] (4) When dispensing the reaction solution, try to avoid generating bubbles and take care to prevent leakage so as to avoid fluorescent substances contaminating the instrument.

[0116] (5) If the workbench or pipettes become contaminated with samples or reagents during the experiment, they should be treated immediately with 10% sodium hypochlorite or 75% alcohol. The workbench should be cleaned immediately after the experiment, and the workbench and all experimental supplies should be disinfected regularly.

[0117] Example 2: Detection of polymorphisms in human MTHFR, MTRR, and SLC19A1 genes

[0118] This embodiment utilizes the gene detection kit obtained in Example 1 to detect the polymorphisms of human MTHFR (C677T, A1298C), MTRR (A66G), and SLC19A1 (A80G) genes, and includes the following steps:

[0119] Step 1: Extract and process human genomic DNA from the sample to be tested.

[0120] This embodiment uses whole blood samples as an example. 200 μL of whole blood sample was drawn into a clean centrifuge tube, and genomic DNA was extracted using a commercial nucleic acid extraction kit (such as the Roche extraction kit). The DNA concentration was measured using a micro-nucleic acid quantification instrument, and the extracted DNA was diluted to 5 ng / μL with purified water for use as a detection template.

[0121] Step 2, Prepare the PCR reaction system

[0122] Prepare a 20 μL reaction system per well in a 96-well plate. Configure a separate well for each primer pair. The specific components and volumes added to each well are as follows: dilute the in-tube concentration of each test solution in the kit from 1.0 μM to 0.5 μM, then add 1 μL of the diluted test solution to the well; add 10 μL of the nucleic acid amplification reaction solution to the well; add 0.2 μL of DNA polymerase (5 U / μL) to the well; and add 2 μL of the diluted DNA sample from step 1 to the well; finally, bring the volume to 20 μL with purified water.

[0123] Carefully cover the 96-well plate membrane, shake to mix, and then centrifuge at 2000 to 3000 rpm for 5 to 10 seconds at room temperature.

[0124] The specific components are shown in Table 5:

[0125]

[0126] Step 3, Real-time quantitative PCR amplification

[0127] Place the completed reaction tubes into the Roche LightCycler® 480 Real-Time PCR System, such as... Figure 1 The amplification program diagram shown is executed with the following temperature and cycle settings for detection:

[0128] (1) Pre-denaturation: Hold at 95℃ for 5 minutes;

[0129] (2) Amplification cycle (45 cycles): Hold at 95℃ for 10 seconds, at 60℃ for 25 seconds, and at 72℃ for 10 seconds (acquire SYBR Green fluorescence signal at the 72℃ extension end).

[0130] Step 4, High-Resolution Melting (HRM) Curve Analysis

[0131] (1) At 95℃ for 1 minute, cool down to 40℃ and hold for 1 minute, then heat up to 65℃, and then continue to heat up at a rate of 0.02℃ / s until it reaches 95℃. During this process, the instrument continuously collects fluorescence signals at a high frequency of 25 times / ℃.

[0132] (2) Cool down after signal acquisition: 30 seconds at 40℃.

[0133] To ensure the effectiveness of the detection method in Example 2 and to monitor for contamination prevention, a "blank control" and a "positive control" were simultaneously set up when preparing the reaction system in step 2.

[0134] (1) Blank control (NTC): Replace the sample DNA with 2 μL of purified water in a 20 μL reaction system. If the amplification curve does not rise and there is no characteristic melting peak (or only primer dimers with very low Tm values), it indicates that the experimental system is free from exogenous genome contamination.

[0135] (2) Positive control: Twelve pre-prepared standards (covering wild-type, heterozygous, and mutant at each of the four loci) at a concentration of 5 ng / μL were used to replace the sample DNA for amplification. The standard melting curve generated by the positive control was used as the benchmark for GeneScanning classification and color matching of the test samples in Example 3.

[0136] Step 5: Data Processing and Result Determination

[0137] After the experiment, analyze and judge according to the following steps:

[0138] (1) Run the amplification curve analysis with template-free control (NTC). If no amplification curve rises, it indicates that the experiment is uncontaminated and analysis can continue. When an amplification curve rises, run the TmCalling program. If the product is a primer dimer, it indicates that the experiment is uncontaminated and analysis can continue.

[0139] (2) Run the TmCalling program to analyze the melting curves of the standard and the sample. The curves should show a single peak (except for the main peak, other regions should be smooth), with no dimers or non-specific amplification. This indicates that the experimental system is normal and can continue the analysis.

[0140] (3) Parameter adjustment requirements when running the GeneScanning program:

[0141] a) In the Normalization options, Pre-MeltSliderSettings and Post-MeltSliderSettings are generally set to the default and do not need to be adjusted.

[0142] b) In the TemperatureShift option, Threshold is set to 0 (the default is 5).

[0143] Once the settings are complete, you can proceed with subsequent analysis and calculations.

[0144] (4) Run the GeneScanning program to calculate the melting curve typing of the standard. The typing results of the standard at each site should be accurately distinguished into 3 types and displayed in 3 different colors.

[0145] (5) Run the GeneScanning program to calculate the melting curve genotyping of the standard and the sample. Analyze the genotype by comparing the curves of the sample and the standard. If the curve of the sample matches one color with the curve of the standard, the curves are in agreement, indicating that the genotype of the sample is the same as that of the standard.

[0146] (6) If the requirements of items 1 and 4 are not met, and the standard requirements in item 2 are not met, it is recommended to retest; if the requirements of item 2 are not met, it is recommended to re-extract DNA and retest.

[0147] In specific analysis, the instrument's TmCalling and GeneScanning programs were used to analyze the melting curves. The quadruple genotype was determined by comparing the differences in melting temperature (Tm) and peak shape characteristics of the amplified products.

[0148] Wild-type homozygotes exhibit a single melting peak;

[0149] The mutant homozygote exhibits a single melting peak, and its Tm value shifts characteristically due to changes in thermal stability.

[0150] Heterozygotes exhibit double melting peaks or asymmetric broad peaks.

[0151] See Figure 2 and Figure 3 Taking the MTHFR C677T locus as an example, the presence of two peaks indicates heterozygous CT, such as... Figure 3 The blue peak in the graph, further as... Figures 14 to 17 This indicates extremely high reproducibility; those exhibiting a single peak and a later position (higher Tm value) are wild-type CCs, such as... Figure 3 The red peak in the graph; those showing a single peak and a prominent position (lower Tm value) are mutant TT, further as... Figures 18 to 23 , Figure 29 This indicates that it has extremely high reproducibility.

[0152] For the SLC19A1 A80G site, wild-type GG shows a single peak (e.g. Figure 8 , Figure 9 and Figure 25 (This indicates that) heterozygous AG exhibits a bimodal pattern (e.g., Figure 6, Figure 7 , Figure 24 , Figure 28 This indicates that the mutant AA exhibits a single peak (e.g., Figure 4 and Figure 5 show).

[0153] For the MTHFR A1298C site, its heterozygous AC shows a typical bimodal pattern (e.g. Figures 10 to 13 , Figure 27 show).

[0154] For the MTRR A66G site, its wild-type AA exhibits a typical single peak (e.g. Figure 26 show);

[0155] If the peak shape and Tm value of the sample curve match the above standard curve, it is determined to be the corresponding genotype.

[0156] Example 3: Repeatability Experiment

[0157] Figures 4 to 29 All of these were repeated experiments at different sites on the sample.

[0158] To test the reproducibility of the kit of the present invention, the kit prepared in Example 1 was used to test the positive control standards (containing wild-type, heterozygous, and mutant types of four sites: MTHFR 677, MTHFR 1298, MTRR 66, and SLC19A1 80), and the tests were repeated 10 times under different batches, different operators, and different times.

[0159] Experimental results show that:

[0160] The amplification curves of the four loci showed a high degree of consistency in peak time. In melting curve analysis, the intra- and inter-assay coefficients of variation (CV) for melting temperature (Tm value) of each genotype were all <0.5%. Specifically, the wild-type Tm value of MTHFR 677 locus was stable at 85.50±0.20℃, and the mutant Tm value was stable at 84.80±0.20℃. The Tm values ​​of each genotype of the other three target loci, including SLC19A1 80 locus, fluctuated within ±0.20℃, and the characteristic bimodal / broad peak morphology of each heterozygous genotype showed perfect consistency in 10 replicates.

[0161] The experimental results conclusively demonstrate that the kit of the present invention has extremely high detection stability and repeatability.

[0162] Example 4: Results of Sanger sequencing alignment and accuracy analysis of the detection method

[0163] To verify the accuracy of the detection method of the present invention, 50 peripheral blood samples that had been tested and classified using the method in Example 1 were randomly selected. At the same time, the "gold standard" of gene detection—Sanger direct sequencing—was used to independently sequence four loci in these 50 samples: MTHFR C677T / A1298C, MTRR A66G, and SLC19A1 A80G.

[0164] The analysis results showed that the detection results (wild-type, heterozygous, and mutant genotyping) of Example 2 had a 100% concordance rate with the base sequence results obtained by Sanger sequencing, with no false positives or false negatives. Furthermore, compared to the cumbersome tube-opening operation of Sanger sequencing, which takes 8-12 hours, the closed-tube detection method of this invention can produce results in only 1.5 to 2 hours, and the required DNA concentration (as low as 5 ng / μL) is much lower than that of sequencing. This indicates that this detection method significantly improves detection efficiency and sensitivity while maintaining extremely high accuracy, fully meeting the requirements of high-throughput clinical screening.

[0165] Example 5: Specificity test of the detection kit

[0166] To verify the specificity of the four independent detection solutions (single-tube detection systems) in this invention and to eliminate the risk of non-specific binding of primers to homologous sequences or adjacent mutations, this experiment underwent rigorous cross-checking. In particular, the SLC19A1 gene has high sequence homology with other members of the folic acid transporter family (such as SLC19A2 and SLC19A3), making it highly susceptible to false amplification; simultaneously, MTHFR 677 and 1298 belong to the same gene, requiring the exclusion of interference from other sequences within the gene.

[0167] The following specific reference samples (templates) were prepared for cross-testing in this experiment:

[0168]

[0169] The templates were added to PCR reaction wells containing four independent detection solutions: MTHFR 677, MTHFR 1298, MTRR 66, and SLC19A1 80 (prepared strictly according to the 20 μL system in Example 2), and the high-resolution melting (HRM) procedure in Example 2 was executed.

[0170] Experimental results show that:

[0171] (1) When using T1, T2 and T3 as interfering templates, no effective amplification curves appeared in the reaction wells of the four detection solutions, and the HRM melting curves showed a smooth baseline without any specific main peak or impurity peaks. This proves that the primers of the present invention do not cross-react with homologous family genes or adjacent non-target mutations.

[0172] (2) When using T4 (wild-type target) as a template, typical, smooth wild-type single melting peaks appeared in the reaction wells of the four detection solutions and only in their respective expected Tm value ranges.

[0173] (3) No amplification curve was observed when detecting T5 (NTC), and no primer dimer peak was observed in the melting curve.

[0174] in conclusion:

[0175] The above results conclusively confirm that the four sets of specific primer pairs (SEQ ID NO.1-8) rigorously screened in this invention, combined with a specific reaction system of 5mM magnesium ions and 0.5mM dNTPs optimized by orthogonalization, completely eliminate non-specific binding of homologous sequences and interference from primer dimers. The specificity of the single system reaches 100%, fully meeting the high standards required for accurate clinical genotyping.

[0176] Example 6: Sensitivity Validation of the Detection Kit

[0177] To verify the sensitivity (limit of detection) of the kit in Example 1 in detecting human MTHFR, MTRR and SLC19A1 gene polymorphisms, serial dilution experiments were performed on positive control standards with known genotypes and clinically extracted genomic DNA.

[0178] Genomic DNA extract with an initial concentration of 20 ng / μL was serially diluted with purified water to prepare a series of test templates at concentrations of 10 ng / μL, 5 ng / μL, 2 ng / μL, and 1 ng / μL. 2 μL of each template concentration was added to a 20 μL PCR reaction mixture, and the mixture was analyzed using the established high-resolution melting (HRM) procedure.

[0179] Experimental results show that the detection system of this invention has extremely low requirements for nucleic acid template concentration. When the sample DNA concentration is as low as 5 ng / μL, or even as low as 1 ng / μL, the amplification curves for the four sites MTHFR (677, 1298), MTRR 66, and SLC19A1 80 can still stably produce peaks; at the same time, the corresponding melting curve peak shape (single-peak or double-peak characteristics) and Tm value remain smooth and clear, without curve distortion caused by signal attenuation, and can achieve 100% accurate typing comparison with high-concentration standards. These experimental data conclusively demonstrate that the detection method has extremely high sensitivity, and is particularly suitable for complex samples with some degradation or low concentration.

[0180] Example 7: Application in human health assessment and multi-site co-mutation risk assessment for non-disease diagnostic purposes

[0181] In this embodiment, the human MTHFR, MTRR, and SLC19A1 gene detection kit prepared in this invention was used to perform genotyping on peripheral blood samples from 200 individuals undergoing physical examinations for non-disease diagnostic purposes. Simultaneously, plasma folic acid concentration and serum homocysteine ​​(Hcy) concentration were detected to assess the individual's folic acid metabolism capacity throughout the entire pathway and potential health risks.

[0182] Existing technologies typically detect only single or dual gene loci (e.g., only the MTHFR 677 locus), failing to comprehensively reflect an individual's metabolic status. This embodiment, through full-pathway target detection, reveals the synergistic mutational effects of different genotype combinations in folic acid metabolism.

[0183] The evaluation results and data examples are shown in Table 7:

[0184]

[0185] In Table 7, serum homocysteine ​​concentration is a true biochemical metabolic indicator of the human body. The higher the value (e.g., above 15 μmol / L), the worse the folic acid metabolism capacity, and the higher the risk of cardiovascular and cerebrovascular diseases and birth defects. The folic acid metabolism abnormality risk rate is the proportion of people with abnormal metabolic indicators actually detected in the population with this specific genotype combination.

[0186] Table 7 clearly shows that the risk of metabolic abnormalities caused by a single metabolic enzyme mutation (such as MTHFR 677TT) or a single transporter mutation (SLC19A1 80GG) is only 31.2%–37.0%. However, when an individual carries both mutations, the combined effect of "impaired cellular transport" and "loss of internal metabolic enzyme activity" leads to a surge in homocysteine ​​concentration (20.8 μmol / L), exponentially increasing the risk of metabolic abnormalities to 95.2%, and reaching 100% for mutations at three or more sites.

[0187] Existing kits typically only detect MTHFR and MTRR (i.e., focus only on "metabolic enzymes"), completely ignoring SLC19A1 (i.e., "transporter"). If existing kits are used, the failure to detect SLC19A1 will misclassify a large number of subjects who are actually at 95.2% extremely high risk as low- or medium-risk individuals.

[0188] As can be seen from the data in Table 7, the kit of the present invention has for the first time achieved full-pathway detection of "transport-metabolism-reduction". Only through the detection kit of the present invention can we accurately identify and intercept those high-risk individuals with multi-site co-mutations that have been missed by existing technologies, thus proving that the kit has scientific uniqueness and extremely high clinical effectiveness in human health assessment and precision nutritional intervention.

[0189] Analysis of the data in Table 7 shows that multi-site synergistic mutations (such as "transporter defects" combined with "metabolic enzyme defects") lead to an exponentially increased risk of folic acid metabolism abnormalities. Using the kit of this invention for health assessment can accurately identify 95.2% and 100% of extremely high-risk individuals who might be missed by single-target detection, thus providing subjects with a more scientific and individualized nutritional intervention strategy.

[0190] Example 8: Specific use of the kit in the preparation of products for screening fecal microbiota transplantation donors

[0191] The health of the gut microbiota is closely related to the host's genetic and metabolic background. Studies have shown that the colonization and metabolism of certain beneficial bacteria in the gut (such as Bifidobacteria and Lactobacillus) are highly dependent on the folic acid concentration in the gut microenvironment.

[0192] This embodiment applies the gene detection kit disclosed in Example 1 to the screening process of fecal microbiota transplantation (FMT) donors. Traditional FMT donor screening only excludes individuals carrying infectious diseases or pathogens, while neglecting the influence of the donor's genetic background on their gut microbiota metabolic function.

[0193] In this study, 20 healthy volunteers intended as FMT donors underwent MTHFR, MTRR, and SLC19A1 genotyping. Fecal microbiota from these donors was then used to transplant the embryos into corresponding recipients (e.g., patients with metabolic syndrome or gut microbiota dysbiosis). Follow-up for 6 months was conducted to assess transplantation success rate and improvement in recipient serum homocysteine ​​levels. Specific screening and clinical follow-up data are shown in Table 8.

[0194]

[0195] Table 8 clearly shows that donors carrying the double high-risk mutation "SLC19A1 80GG+MTHFR 677TT" live in an extremely harsh folic acid metabolic microenvironment, resulting in a natural deficiency in the healthy microbial community in their feces that can synthesize and utilize folic acid. Transplanting the microbial community of such donors into recipients not only fails to help the recipients restore their normal microecology, but also leads to a 0% transplant success rate.

[0196] Therefore, the detection kit of this invention can be used to prepare FMT donor screening reagents. The specific screening criteria are: detecting the above four loci in candidate donors, directly eliminating high-risk donors carrying the SLC19A1 80 mutation combined with the MTHFR mutation, and preferentially selecting wild-type donors at all loci. This application successfully fills the gap in the field of FMT lacking precise screening tools for host genetic metabolic background, and can increase the clinical cure rate of FMT to over 88%.

[0197] Example 9: Use of this kit in assessing recipient suitability for fecal microbiota transplantation and guiding post-transplantation interventions

[0198] In addition to screening donors, the kit of the present invention can also be used to assess the suitability of FMT receptors.

[0199] In clinical trials, recipients intended for FMT therapy were tested. If the recipient was found to carry a highly defective genotype combination (e.g., MTHFR 677TT combined with SLC19A1 80GG), this indicated that the recipient's own intestinal mucosal cells had extremely poor capacity for active transport and metabolic utilization of folic acid. Even if healthy flora from a "high-quality donor" were transplanted, the high-quality flora would struggle to colonize the recipient's gut long-term due to the lack of normal nutrient and metabolic synergy with the host epithelial cells.

[0200] The specific clinical guidance strategy based on this assessment result is as follows:

[0201] After identifying the high-risk genotype of the recipient using this kit, the recipient is supplemented with specific doses of exogenous active nutrients (such as 5-methyltetrahydrofolate and short-chain fatty acids like butyrate) during the pre-transplantation and post-transplantation maintenance periods to artificially compensate for the deterioration of the intestinal microenvironment caused by the recipient's gene defects. This strategy, combining gene assessment with nutritional intervention, can significantly prolong the colonization period of high-quality donor flora in the recipient's gut, thereby achieving truly personalized and precise FMT treatment.

[0202] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A human MTHFR, MTRR, and SLC19A1 gene detection kit, characterized in that: It includes the following components: four detection solutions (MTHFR677 / MTHFR1298 / MTRR66 / SLC19A180), nucleic acid amplification reaction solution, enzyme mixture, positive control standard, and blank control; The four detection solutions, MTHFR 677 / MTHFR 1298 / MTRR 66 / SLC19A1 80, include the following four primer pairs: The first primer pair consists of a forward primer and a reverse primer targeting the MTHFR 677 site, the nucleotide sequences of which are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively. The second primer pair consists of a forward primer and a reverse primer targeting the MTHFR 1298 site, the nucleotide sequences of which are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. The third primer pair consists of a forward primer and a reverse primer targeting the MTRR 66 site, the nucleotide sequences of which are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively. The fourth primer pair consists of a forward primer and a reverse primer targeting the SLC19A1 80 site, the nucleotide sequences of which are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively. The nucleic acid amplification reaction solution includes: dNTPs, magnesium ions, buffer solution, and saturated fluorescent dye.

2. The gene detection kit according to claim 1, characterized in that: The enzyme mixture is DNA polymerase; The saturated fluorescent dye is selected from one of SYBR Green, LC Green, Eva Green, or Reso Light.

3. The gene detection kit according to claim 1, characterized in that: The positive control standards include wild-type homozygous genomic DNA, mutant heterozygous genomic DNA, and mutant homozygous genomic DNA targeting four loci.

4. A method for detecting human MTHFR, MTRR, and SLC19A1 genes using the gene detection kit according to any one of claims 1 to 3, characterized in that: Includes the following steps: Step 1: Extract human genomic DNA from the sample to be tested; Step 2, Prepare the PCR reaction system: Mix each detection solution with the nucleic acid amplification reaction solution, enzyme mixture, purified water and the sample to be tested obtained in Step 1, respectively; Step 3: Perform real-time quantitative PCR amplification; Step 4: Perform high-resolution melting curve analysis on the amplified product obtained in Step 3; Step 5, Data Processing and Result Determination: By analyzing the peak shape of the melting curve and the changes in melting temperature, the genotypes of the test samples at the four loci are determined.

5. The detection method according to claim 4, characterized in that: The PCR amplification in step 3 includes the following steps: Step 31, Pre-denaturation: Hold at 95°C for 2 to 10 minutes; Step 32, amplification cycle: perform 35-50 cycles at 95°C for 10 seconds, at 60°C for 25 seconds, and at 72°C for 10 seconds.

6. The detection method according to claim 4, characterized in that: The high-resolution melting curve analysis in step 4 includes the following steps: Step 41, melting analysis: Heat at 95°C for 1 minute, at 40°C for 1 minute, then heat to 65°C, and then heat to 95°C at a rate of 0.01°C / s to 1°C / s, while continuously collecting fluorescence signals.

7. The detection method according to claim 4, characterized in that, The result determination criteria in step 5 are as follows: The wild-type homozygote exhibited a single melting peak, and the melting temperature value was consistent with that of the wild-type standard. The mutant homozygote exhibited a single melting peak, and the melting temperature value was consistent with that of the mutant standard. Heterozygotes exhibit double melting peaks or characteristic changes in the shape of the melting curve, and the curve morphology is consistent with that of the heterozygous standard.

8. Use of the gene testing kit according to any one of claims 1 to 3 in human MTHFR, MTRR and SLC19A1 genotyping for non-disease diagnostic purposes.

9. Use of the gene detection kit according to any one of claims 1 to 3 in the preparation of products for screening fecal microbiota transplantation donors or assessing the suitability of fecal microbiota transplantation recipients.

10. The use according to claim 9, characterized in that, The screening or assessment includes: detecting the MTHFR, MTRR, and SLC19A1 genotypes of the individuals to be tested to assess their folate metabolism capacity and homocysteine ​​level risk, thereby guiding donor-recipient pairing for fecal microbiota transplantation or post-transplantation nutritional intervention strategies.

Citation Information

Patent Citations

  • Kit and method for detecting MTHFR (methylene tetrahydrofolate reductase) and MTRR (methionine synthase reductase) gene polymorphism simultaneously with molecular beacon probes and melting curve

    CN107828870A

  • Human MTHFR and MTRR gene detection kit and application thereof

    CN108251522A

  • Combined detection method for pregnancy folate metabolism, calcium metabolism and H-type hypertension

    CN110257507A

  • Composition, kit and method for detecting human folate metabolism gene polymorphism

    CN111187828A

  • Freely combinable kit for detection of MTHFR and MTRR gene sequences and methods of using the same

    CN111334571A