Microbial nucleic acid test paper based on dCas protein, nucleic acid hybridization and isothermal amplification and application thereof
By using dCas protein and nucleic acid hybridization technology, combined with isothermal amplification of primers modified with molecules such as FAM, multiplex target nucleic acid detection of chromatographic test strips was achieved, solving the problem of insufficient single-detection throughput in existing technologies and realizing high-sensitivity and high-specificity multiplex target nucleic acid detection.
Patent Information
- Application Number
- CN202511325276.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-15
- Publication Date
- 2026-05-12
AI Technical Summary
Existing chromatography test strips have limited throughput per test, and mainly detect one or two target nucleic acids, making it difficult to detect multiple target nucleic acids simultaneously.
Using dCas protein and nucleic acid hybridization technology, isothermal amplification is performed using primers modified with molecules such as FAM. Combined with the dCas/gRNA/target nucleic acid ternary complex, different sequences of capture probes are immobilized on different detection lines of the chromatography strip to achieve specific enrichment and color development of multiple target nucleic acids.
It enables simultaneous detection of three or more target nucleic acids, with the detection time completed within 30 minutes. The sensitivity reaches less than 10 copies, and it has high specificity and simple operation, making it suitable for the detection of different target nucleic acid sequences.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and medical testing technology, and in particular to a microbial nucleic acid detection test strip based on dCas protein, nucleic acid hybridization and isothermal amplification and its application. Background Technology
[0002] For the detection of target nucleic acids, polymerase chain reaction (PCR) is the most classic and widely used method due to its high specificity and sensitivity. However, PCR requires equipment such as thermal cyclers and professional operation, making it unsuitable for rapid on-site testing. Isothermal amplification of nucleic acids, on the other hand, eliminates the need for temperature changes, freeing it from instrumentation and making it a promising candidate for rapid on-site testing. Currently, commonly used isothermal amplification techniques include sequence-dependent amplification (NASBA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA). In recent years, with the development of CRISPR-Cas technology, techniques combining isothermal amplification of nucleic acids with Cas proteins have also emerged, achieving significant progress in detection sensitivity, specificity, and accuracy.
[0003] To facilitate immediate and on-site detection, researchers have applied isothermal amplification of nucleic acids and CRISPR-Cas technology to flow chromatography strips, enabling visualized detection through colorimetric enrichment using colloidal gold nanoparticles. However, regardless of whether isothermal amplification or CRISPR-Cas technology is used, the current throughput of target nucleic acids detected by a single flow chromatography strip is still limited to less than three target nucleic acids. The main problem lies in the fact that in existing technologies, the enrichment and colorimetric enrichment of target nucleic acids by the detection lines on the flow chromatography strips relies on the interaction of biomolecule pairs such as biotin and streptavidin. However, due to the limited number of biomolecule pairs, the number of target nucleic acids that a single flow chromatography strip can currently detect is still mainly one or two. Summary of the Invention
[0004] To address the aforementioned issues, this invention develops a microbial nucleic acid detection strip based on dCas protein, nucleic acid hybridization, and isothermal amplification, achieving detection of three or more target nucleic acids with high throughput.
[0005] The detection principle of this invention is as follows: Primers modified with molecules such as FAM are used to isothermally amplify the target nucleic acid, resulting in the amplified nucleic acid being labeled with molecules such as FAM. dCas and target nucleic acid-specific gRNA precisely recognize and bind to the amplified target nucleic acid sequence, forming a dCas / gRNA / target nucleic acid ternary complex. Different capture probe sequences corresponding to different target nucleic acid-specific gRNAs are immobilized on different detection lines of the chromatography strip. The sample pad of the chromatography strip contains a gold-labeled anti-FAM antibody. When the dCas / gRNA / target nucleic acid ternary complex is added to the sample pad, it binds to the FAM and other molecules labeled on the nucleic acid. Different capture sequences are designed into the gRNAs of different targets, allowing them to complementarily pair with the corresponding capture probe sequences on the detection lines of the chromatography strip, thereby achieving the enrichment and color development of the dCas / gRNA / target nucleic acid ternary complex on the corresponding detection lines.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows:
[0007] (1) Extract the genomic DNA or RNA to be tested from the sample to be tested;
[0008] (2) Using the genomic DNA or RNA to be detected as a template, perform multiplex isothermal amplification;
[0009] (3) The multiplex amplified nucleic acid product is mixed with dCas protein and target nucleic acid-specific gRNA to form a dCas / gRNA / target nucleic acid complex, wherein the gRNA contains a capture sequence for complementary pairing with the capture probe on the detection line of the chromatography strip;
[0010] (4) The mixed reagent is dropped onto the immunochromatographic test strip, which has several detection lines and one control line. The detection lines are fixed with capture probes that are complementary to the capture sequence of gRNA.
[0011] (5) Determine the test results by observing the colors of the test line and the control line.
[0012] Specifically, the genome to be detected is the genome of a microbial, tissue, blood, and / or cellular biological sample, including DNA genome, RNA genome, plasmid, and / or double-stranded DNA fragment.
[0013] Specifically, multiplex isothermal amplification includes simultaneous amplification of similar target nucleic acids using universal primer pairs, as well as simultaneous amplification of corresponding target nucleic acids using multiple sets of specific primer pairs.
[0014] Specifically, one or both primers in each primer pair are modified with molecules such as FAM at their 5' ends.
[0015] Specifically, the dCas protein is a Cas protein with its nuclease domain inactivated, including but not limited to dCas9, dCas12, and dCas13. Taking dCas9 as an example: Cas9 has two catalytic domains, HNH and RuvC. The HNH domain cleaves complementary DNA sequences, and RuvC cleaves non-complementary DNA sequences. However, dCas9 does not contain either of these active catalytic domains.
[0016] Specifically, the gRNA includes single-stranded sgRNA, as well as two-stranded tracrRNA and crRNA, and has an extended capture sequence at the 5' end and / or 3' end of one or more of the sgRNA, tracrRNA, and crRNA, with a length ranging from 5 to 50 bases.
[0017] Specifically, the gRNA is a single-guide RNA containing a seed sequence of 20 bases complementary to the pre-interstitial region sequence of the target DNA sequence, and the PAM is a motif adjacent to the pre-interstitial region sequence, located immediately following the target sequence of 20 base pairs complementary to the sgRNA. The PAM sequence is 5′-NGG-3′.
[0018] Specifically, the dCas / gRNA / target nucleic acid complex specifically recognizes one strand of the target DNA sequence in the adjacent region of PAM through the seed sequence of sgRNA, and after complementary binding, forms a dCas / gRNA / target nucleic acid ternary complex structure.
[0019] According to the detection method of claim 1, the capture sequence of gRNA in the dCas / gRNA / target nucleic acid ternary complex is complementary to the capture probe sequence fixed on the detection line of the chromatography strip to achieve enrichment and color development of the dCas / gRNA / target nucleic acid ternary complex.
[0020] Specifically, the capture probe sequence on the detection line is immobilized by the interaction of BSA or biotin and streptavidin, with a length ranging from 5 to 50 bases; the control line is an antibody against FAM.
[0021] Specifically, the sample pad of the chromatography test strip is labeled with a gold-labeled monoclonal antibody against molecules such as FAM. After binding to FAM molecules at one and / or both ends of the target nucleic acid in the dCas / gRNA / target nucleic acid ternary complex, it is enriched and colored on the detection line.
[0022] The beneficial effects of this invention are:
[0023] 1. Detection throughput: It can simultaneously detect 3 or more target nucleic acids;
[0024] 2. Detection time: The amplification and detection of the target nucleic acid can be completed within 30 minutes;
[0025] 3. High sensitivity: This invention can achieve the detection of target nucleic acids of less than 10 copies;
[0026] 4. High specificity: This invention achieves high-specificity target detection by utilizing the specific recognition of target nucleic acids by the Cas protein;
[0027] 5. Simple operation: This invention combines single-tube isothermal amplification and target recognition. The detection results can be observed after the reaction reagent is added to the chromatography strip.
[0028] 6. High versatility: This invention only requires changing the specific primers and the target nucleic acid-specific gRNA to be used for the detection of different target nucleic acid sequences. Attached Figure Description
[0029] Figure 1 This is a schematic diagram of the overall detection process based on the design principle of this invention;
[0030] Figure 2 This invention provides the detection results of HIV-1 virus.
[0031] Figure 3 This invention presents the detection results of different subtypes of HIV-1 virus. Figure 4 This invention presents the detection results for HIV-1 virus, syphilis, and gonorrhea. Detailed Implementation
[0032] The technical solution of the present invention will be further described in detail below with reference to examples. The embodiments shown are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0033] Unless otherwise specified, the reagents, consumables and equipment used in this invention are all conventional reagents, consumables and equipment in this technical field; the reagents and consumables used in the examples are all commercially available; the technologies of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and other disciplines involved in this invention are all conventional technologies in this field.
[0034] Example 1: Detection of HIV-1 viral nucleic acid using the present invention
[0035] The HIV-1 gene transcribed in vitro was selected as the target, and its sequence is shown in SEQ ID NO.1;
[0036] NO.1:
[0037] GGGCAAATGACACATCAGCCTTTATCACCTAGAACTTTGAATGCATGGGTGAAAGTAGTAGAAGAAAAGGGTTTTAACCCAGAAGTAATACCCCATGTTCTCAGCATTATCAGAGGGAGCCACCCCACAAGATTTAAATATGATGCTAAATATAGTGGGGGGACACCAGGCAGCAATGCAAATGTTAAAA GAAACCATCAATGAGGAAGCTGCAGAATGGGATAGGGTACACCCAGTACATGCAGGGCCTATTCCACCAAGCCAGATGAGGGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAAGAACAAATAGGATGGATGACAAACAATCCACCTATCCCAGTGGGAGACATCTATAAAAGATGGA
[0038] The method for preparing target RNA is as follows:
[0039] (1) PCR amplification of transcription template
[0040] a. Design primers
[0041] Upstream primer F1, as shown in SEQ ID NO.2;
[0042] NO.2: TAATACGACTCACTATAGGGTAACCCAGAAGTAATACCCATGTTCTCAG
[0043] Downstream primer R1, as shown in SEQ ID NO.3;
[0044] NO.3: CATCCATCCTATTTGTTCTTGAAGGGTACTAGTAGTTCC
[0045] b. PCR amplification
[0046] Using the aforementioned upstream and downstream primers, and with a plasmid containing the selected target gene as a template, the target fragment was amplified by PCR using a high-fidelity DNA polymerase. The PCR product was purified using a gel extraction kit.
[0047] (2) In vitro transcription of target RNA
[0048] a. Using purified PCR products as templates, in vitro transcription was performed using T7 RNA polymerase at 37 degrees Celsius;
[0049] b. The transcripts were purified using an RNA purification kit, the concentration of the RNA products was determined using NanoDrop, and the transcripts were stored at -80 degrees Celsius.
[0050] (3) RPA kit isothermal amplification of target RNA
[0051] a. Design primers
[0052] Upstream primer F2, as shown in SEQ ID NO.4;
[0053] NO.4:GAGGGAGCCACCCCACAAGATTTA
[0054] Downstream primer R2, as shown in SEQ ID NO.5;
[0055] NO.5:AAGGGTACTAGTAGTTCCTGCTATG
[0056] b. Isothermal amplification
[0057] Using the TwistAmp Basic RT kit, add Rehydration Buffer, primers F2 and R2, and template RNA to the kit's dry powder tube, mix thoroughly with a shaker, add the reaction activator magnesium acetate, and react at 37 degrees Celsius for 15 minutes.
[0058]
[0059] (4) Amplification of target nucleic acid recognition and binding
[0060] a. gRNA sequence design
[0061] The 5' end 20 bases of the gRNA form a seed sequence complementary to the prespacer region. For the target nucleic acid sequence, the prespacer region with the PAM sequence NGG is selected as the gRNA recognition and binding site within the sequence-preserving region. The gRNA sequence is shown in SEQ ID NO. 6.
[0062] NO.6:
[0063] CCAAGGGGAAGUGACAUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUCUCUACUAAACG
[0064] b. Binding of target nucleic acids
[0065] Add dCas protein, gRNA, and NEBuffer 2.1 to an EP tube. Transfer the target nucleic acid amplified by RPA to the EP tube and mix thoroughly. React at 37 degrees Celsius for 5 minutes.
[0066]
[0067] (5) Chromatographic strip detection
[0068] a. Preparation of chromatography strips
[0069] The immunochromatographic test strip includes a base plate, and on the base plate are a sample pad, a latex microsphere pad, an NC membrane, and an absorbent pad. The sample pad contains pre-added gold-labeled anti-FAM antibody. Detection and control lines are coated onto the NC membrane to form parallel bands: the control line is an antibody against FAM; the detection line is a BSA-labeled capture probe, the probe sequence of which is shown in SEQ ID NO. 7.
[0070] NO.7: CGTTTAGTAGAG
[0071] b. Detection of mixed samples
[0072] Add enzyme-free water to the EP tube, mix well, and then drop it onto the sample pad of the chromatography strip. Wait several minutes and observe the color changes of the test line and control line. If both the test line and control line show color, the sample test result is positive; if neither the test line nor the control line shows color, the test reagent is invalid; if the test line does not show color but the control line does, the test result is negative. Figure 2 The result shown is the positive test result of Example 1.
[0073] Example 2: Detection of HIV-1 viral nucleic acid of different subtypes using the present invention
[0074] The HIV-1 gene transcribed in vitro was selected as the target, and three different subtypes prevalent in China were selected. The sequences of CRF01_AE, CRF07_BC and CRF08_BC are shown in SEQ ID NO.8, 9 and 10.
[0075] NO.8:
[0076] GGGCAAATGGTACATCAGCCTTTATCACCTAGAACTTTGAATGCATGGGTGAAAGTAGTAGAAGAAAAGGGTTTTAACCCAGAAGTAATACCCATGTTCTCAGCATTATCAGAGGGAGCCACCCCACAAGATTTAAATATGATGCTAAATATAGTGGGGGGACACCAGGCAGCAATGCAGATGTTAAAAGAAACCATCAATGAGGAAGCTGCAGAATGGGATAGGGTACACCCAGTACATGCAGGGCCTATTCCACCAGGCCAGATGAGGGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAAGAACAAATAGGATGGATGACAAACAATCCACCTATCCCAGTGGGAGACATCTATAAAAGGTGGA
[0077] NO.9:
[0078] GGGCAAATGGTACATCAGCCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTGGTAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATATTAAAAGATACCATCAATGAAGAGGCTGCAGAATGGGATAGATTACATCCAGTACATGCAGGGCCTATTGCACCAGGCCAAATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGCATGGATGACGAGTAACCCACCTGTTCCAGTAGGAGACATCTATAAAAGATGGA
[0079] NO.10:
[0080] GGGCAAATGGTACATCAGCCCCTATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTGGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTCACAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGTTAAATACAGTAGGGGGACATCAAGCAGCCATGCAAATGCTAAAA GATACCATCAATGAAGAGGCTGCAGAATGRGATAGATTGCATCCAGTGCATGCAGGGCCAGTGGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACTCTTCRGGAGCAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGRA
[0081] The method for preparing target RNA is as follows:
[0082] (1) PCR amplification of transcription template
[0083] a. Design primers as in Example 1.
[0084] b. PCR amplification is the same as in Example 1.
[0085] (2) The target RNA was transcribed in vitro as in Example 1.
[0086] (3) RT-RPA kit for isothermal amplification of target RNA
[0087] a. Design primers as in Example 1.
[0088] b. Isothermal amplification is the same as in Example 1.
[0089] (4) Amplification of target nucleic acid recognition and binding
[0090] a. gRNA sequence design
[0091] Three different gRNA sequences were designed for different subtypes, as shown in SEQ ID NO.11, 12, and 13.
[0092] NO.11:
[0093] CAUGUUCUCAGCAUUAUCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUCUCUACUAAACG
[0094] NO.12:
[0095] AAAAGAUACCAUCAAUGAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUUCUUGUCGUUAU
[0096] NO.13:
[0097] UCCAGUGCAUGCAGGGCCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUUGAUUAACUGU
[0098] b. The binding of the target nucleic acid is the same as in Example 1.
[0099] (5) Chromatographic strip detection
[0100] a. The preparation of the chromatography test strip is the same as in Example 1.
[0101] Three capture probes were designed, and the probe sequences are shown in SEQ ID NO.14, 15, and 16.
[0102] NO.14: CGTTTAGTAGAG
[0103] NO.15: ATACGACAAGA
[0104] NO.16: ACAGTTATCAA
[0105] b. Mixed sample testing is the same as in Example 1.
[0106] like Figure 3 The results of Example 2 are shown.
[0107] Example 3: Using the present invention to detect HIV-1 virus, syphilis, and gonorrhea nucleic acid
[0108] The genes of HIV-1, syphilis, and gonorrhea viruses were selected through in vitro transcription. The HIV-1 gene was the same as in Example 1, and the gene sequences of syphilis and gonorrhea viruses were shown in SEQ ID NO.17 and 18.
[0109] NO.17:
[0110] CCCGTTCGCAATCAAAGTCAGCCTGTAGTATCCCGGCCCTGAACCTTTAAACCGATCGAACCCATAGTTGATACCACACGAAATGCGGGGCACTCTTCCTGTCTTCCACCAGGAGTCAGCAGAGTGCTTGGTGCCATAACTCGCCATCAGATTGGTGTAGCTCGCGTC
[0111] NO.18:
[0112] CAGCATCTCCACAATCACACAATGCCTGTATGCAGGCTCTGGTTTTGGTGGCTAGTGGGGTTGTTGCCTTTATGGTAGTGGAGAGGCTGTTTCTGACCCTTGATCAGAAATTCAATGTCTGCCTGCTACTTTGTAGTATATGACAGGCAAAAAATTTTAAATGTTCATAAGAAGAGCATTTATTTTCATGAGAATCAAAAGAATGATGCCCTTTCGTTGCCTATCTAGTTTATTGTACTGTAGTCTAGTATACT
[0113] The method for preparing target RNA is as follows:
[0114] (1) PCR amplification of transcription template
[0115] a. Design primers
[0116] 1. The HIV-1 virus primers are the same as in Example 1.
[0117] 2. Primer design for Treponema pallidum:
[0118] Upstream primer F3, as shown in SEQ ID NO.19;
[0119] NO.19: TAATACGACTCACTATAGGGCCCGTTCGCAATCAAAGTCAGCCT
[0120] Downstream primer R3, as shown in SEQ ID NO.20;
[0121] NO.20:GACGCGAGCTACACCAATCTGATG
[0122] 3. Gonorrhea virus primer design:
[0123] Upstream primer F4, as shown in SEQ ID NO.19;
[0124] NO.21: TAATACGACTCACTATAGGGTTGTATGCAGGCTCTGGTTTTGGTG
[0125] Downstream primer R4, as shown in SEQ ID NO.20;
[0126] NO.22:AGTATACTAGACTACAGTACAATAAACTAG
[0127] b. PCR amplification is the same as in Example 1.
[0128] (2) The target RNA was transcribed in vitro as in Example 1.
[0129] (3) RT-RPA kit for isothermal amplification of target RNA
[0130] a. Design primers
[0131] 1. The HIV-1 virus primers are the same as in Example 1.
[0132] 2. Primer design for Treponema pallidum:
[0133] Upstream primer F5, as shown in SEQ ID NO.7;
[0134] NO.23: CGTCCCTATACCCGTTCGCAATCA
[0135] Downstream primer R5, as shown in SEQ ID NO.8;
[0136] NO.24:TACTACGGTGATGACGCGAGCTAC
[0137] 3. Gonorrhea virus primer design:
[0138] Upstream primer F6, as shown in SEQ ID NO.7;
[0139] NO.25:GCTAGTGGGGTTGTTTGCCTTTATGG
[0140] Downstream primer R6, as shown in SEQ ID NO.8;
[0141] NO.26: GATAGGCAACGAAAGGGCATCATTC
[0142] b. Isothermal amplification is the same as in Example 1.
[0143] (4) Amplification of target nucleic acid recognition and binding
[0144] a. gRNA sequence design
[0145] 1. The HIV-1 viral gRNA sequence is the same as in Example 1.
[0146] 2. The gRNA sequence of Treponema pallidum is shown in SEQ ID NO. 27;
[0147] NO.27:
[0148] AGUUGAUACCACACGAAAUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUUCUUGUCGUUAU
[0149] 3. The gonorrhea virus gRNA sequence is shown in SEQ ID NO.28.
[0150] NO.28:
[0151] TTGCCTTTATGGTAGTGGAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUUGAUUAACUGU
[0152] b. The binding of the target nucleic acid is the same as in Example 1.
[0153] (5) Chromatographic strip detection
[0154] a. The preparation of the chromatography test strip is the same as in Example 2.
[0155] b. Mixed sample testing is the same as in Example 1.
[0156] like Figure 4 The results of the test in Example 3 are shown.
Claims
1. A microbial nucleic acid detection test strip based on dCas protein, nucleic acid hybridization, and isothermal amplification, and its application, which enables high-throughput detection of specific target nucleic acids under isothermal conditions, characterized in that... Includes the following steps: (1) Extract the genomic DNA or RNA to be tested from the sample to be tested; (2) Using the genomic DNA or RNA to be detected as a template, perform multiplex isothermal amplification; (3) The multiplex amplified nucleic acid product is mixed with dCas protein and target nucleic acid-specific gRNA to form a dCas / gRNA / target nucleic acid complex, wherein the gRNA contains a capture sequence for complementary pairing with the capture probe on the detection line of the chromatography strip; (4) The mixed reagent is dropped onto the immunochromatographic test strip, which has several detection lines and one control line. The detection lines are fixed with capture probes that are complementary to the capture sequence of gRNA. (5) Determine the test results by observing the colors of the test line and the control line.
2. The detection method according to claim 1, characterized in that, The genome to be detected is the genome of a microbial, tissue, blood, and / or cellular biological sample, including DNA genome, RNA genome, plasmid, and / or double-stranded DNA fragment.
3. The detection method according to claim 1, characterized in that, Multiplex isothermal amplification includes the simultaneous amplification of similar target nucleic acids using universal primer pairs, as well as the simultaneous amplification of corresponding target nucleic acids using multiple sets of specific primer pairs.
4. The detection method according to claim 3, characterized in that, One or both primers in each primer pair are modified with molecules such as FAM at their 5' ends.
5. The detection method according to claim 1, characterized in that, The dCas protein is a Cas protein with its nuclease domain inactivated, including but not limited to dCas9, dCas12, and dCas13. Taking dCas9 as an example: Cas9 has two catalytic domains, HNH and RuvC. The HNH domain cleaves complementary DNA sequences, and RuvC cleaves non-complementary DNA sequences. However, dCas9 does not contain either of these active catalytic domains.
6. The detection method according to claim 1, characterized in that, The gRNA includes single-stranded sgRNA, as well as two-stranded tracrRNA and crRNA, and has an extended capture sequence at the 5' end and / or 3' end of one or more of the sgRNA, tracrRNA, and crRNA, with a length ranging from 5 to 50 bases.
7. The detection method according to claim 5, characterized in that, The gRNA contains a seed sequence of 20 bases complementary to the pre-interstitial region sequence of the target DNA sequence. The PAM is a motif adjacent to the pre-interstitial region sequence, located immediately following the target sequence of 20 base pairs complementary to the gRNA. The PAM sequence is 5′-NGG-3′.
8. The detection method according to claim 1, characterized in that, The dCas / gRNA / target nucleic acid complex specifically recognizes one strand of the target DNA sequence in the adjacent region of PAM through the seed sequence of sgRNA, and after complementary binding, forms a dCas / gRNA / target nucleic acid ternary complex structure.
9. The detection method according to claim 1, characterized in that, The capture sequence of gRNA in the dCas / gRNA / target nucleic acid ternary complex is complementary to the capture probe sequence fixed on the detection line of the chromatography strip to achieve enrichment and color development of the dCas / gRNA / target nucleic acid ternary complex.
10. The detection method according to claim 9, characterized in that, The capture probe sequence on the detection line is immobilized by the interaction of BSA or biotin and streptavidin, and its length ranges from 5 to 50 bases; the control line is an antibody against FAM.
11. The detection method according to claim 9, characterized in that, The sample pad of the chromatography test strip is labeled with a gold-labeled monoclonal antibody against FAM and other molecules. After binding to FAM and other molecules at one and / or both ends of the target nucleic acid in the dCas / gRNA / target nucleic acid ternary complex, the antibody is enriched and colored on the detection line.