Detection gene of Eimeria suis, fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method

Abstract

The invention relates to the technical field of biology, in particular to a detection gene of Eimeria suis, a fluorescent quantitative PCR (polymerase chain reaction) detection kit and a preparation method. According to the present invention, the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: AGCTAATTGGTACCTCTTCATACTGGTGGATTATTAATGCTATATGGGTGATCAGTCTTATACACAACACAA, and the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1; the kit prepared from the cox 1 gene and the SYAB Green fluorescent quantitative PCR detection reagent has the characteristics of high sensitivity, strong specificity and good repeatability when being used for detecting the Eimeria suis.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to providing a detection gene for Eimeria suis and a quantitative real-time PCR detection kit and preparation method for it. Background Technology

[0002] Eimeria coccidiosis is a common intestinal protozoan disease in pig farming, causing diarrhea, decreased growth performance, and varying degrees of economic losses in piglets. In my country, Eimeria coccidiosis infection is widespread. Although some drugs exist for treating Eimeria coccidiosis, the emergence of drug resistance is a cause for concern. Reports indicate that the overall infection rate of coccidiosis in pigs in my country is as high as 21.9%, a serious problem plaguing many pig farms in the country.

[0003] Currently, laboratory diagnosis of swine coccidiosis relies on fecal oocyst flotation microscopy and morphological identification. However, in the unsporulated state, morphological differentiation between different Eimeria species and between Eimeria and Isospora is challenging and easily influenced by factors such as the experience of laboratory personnel and mixed infections, thus limiting the accurate identification and quantitative assessment of Eimeria species in swine. Molecular biological detection techniques based on nucleic acid amplification, such as conventional PCR, can only provide qualitative or semi-quantitative detection and cannot accurately determine the infection intensity of Eimeria species. Although the aforementioned identification techniques have provided a high degree of specificity for the detection of swine coccidiosis, they are mostly qualitative or multi-step identification methods, and may still face problems such as relatively cumbersome operating procedures, insufficient adaptability to fecal matrix inhibition factors, and the lack of a unified quantitative interpretation system in routine monitoring in large-scale pig farms.

[0004] Patent No. 2013103827488 discloses primers and a detection kit for detecting seven species of Eimeria in chickens. The primers are designed based on the IGS and ITS specific sequences of seven Eimeria species: *Eimeria tenella*, *Eimeria virulence*, *Eimeria giant*, *Eimeria scabra*, *Eimeria scabra*, *Eimeria brevicornuate*, and *Eimeria brevicornuate*. A real-time PCR kit prepared using these seven primer pairs can accurately, objectively, and quantitatively detect these seven Eimeria species in chickens, and the kit exhibits very high specificity and sensitivity. While it mentions SYAB Green fluorescence detection, the target of detection is different, and it cannot be applied to the detection of *Eimeria* species in pigs.

[0005] Patent No. 202410613484.0 discloses a dual PCR primer set, kit, and method for detecting intestinal parasitic protozoa in pigs. This invention provides a dual PCR primer set for detecting *Ispora suis* and *Eimeria*, and establishes a dual PCR method based on this primer set for detecting these two species. The primer set and dual PCR method of this invention can determine the mixed or single infection status of *Ispora suis* and *Eimeria* in a sample through a single dual PCR reaction. This is faster and more sensitive than ordinary single PCR methods, and lower in cost and simpler to operate than real-time quantitative PCR. However, its limitation is that it can only qualitatively detect coccidiosis in pigs and cannot further determine the intensity of infection.

[0006] To better control swine coccidiosis, further epidemiological surveillance is needed. Therefore, developing an effective method for detecting Eimeria spp. infection in swine to prevent and control the spread of swine coccidiosis and reduce economic losses is of practical significance. Summary of the Invention

[0007] In view of this, the present invention provides a detection gene and a real-time PCR detection kit and preparation method for Eimeria suis, which has the characteristics of high sensitivity, strong specificity and good repeatability.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: a detection gene for *Eimeria* spp., characterized in that the detection gene is the cox 1 gene, and the conserved sequence of the cox 1 gene is: AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA; The primer set for the cox 1 gene is as follows: Upstream primer Cox-F: GCTTTCGGTGTTATTTCTCA Downstream primer Cox-R: TGTGCCCAAACTAATGAACC.

[0009] A kit for quantitative real-time PCR detection of Eimeria suis includes the upstream primer Cox-F, the downstream primer Cox-R for the cox 1 gene, and the SYAB Green quantitative real-time PCR detection reagent.

[0010] The preparation method of the quantitative real-time PCR detection kit for Eimeria suis includes the following steps: 1) Extract the genome from pig fecal samples; 2) The genome from step 1) was detected by real-time PCR using SYAB Green real-time PCR reagent and primer set; 3) Optimize the reaction conditions for SYAB Green real-time PCR, and confirm the annealing temperature and primer concentration; 4) Obtain the amplification curves and Ct values ​​from steps 2) and 3); 5) Determine the presence of Eimeria coccidia by Ct value. When the Ct value of the sample is <35, the test result is positive, indicating that the sample contains Eimeria coccidia; when the Ct value is ≥35, the test result is negative, indicating that the sample does not contain Eimeria coccidia.

[0011] 6) Determine the severity of Eimeria coccidia infection using Ct values. A standard curve for the quantification of Eimeria oocyst DNA was constructed using the SYBR Green qPCR method. The quantitative relationship model between the concentration (x) of Eimeria oocysts and the Ct value was obtained: Ct = -3.2047x + 35.011, thus yielding an infection intensity OPG=10. (35.011-Ct) / 3.2047 .

[0012] In step 3), the annealing temperature in the SYAB Green real-time PCR reaction conditions is 57.6℃; the primer concentration for the cox 1 gene is 0.4 μmol / L.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The present invention constructs a plasmid containing the cox 1 gene of Eimeria as a standard for quantitative fluorescence detection of Eimeria, which has the characteristics of high sensitivity, strong specificity, good repeatability and speed.

[0014] 2. This invention constructs a high-purity, stable cox 1 gene plasmid as a standard, and combines it with an optimized SYAB Green real-time PCR reaction system and conditions to achieve high sensitivity, high specificity, and accurate quantitative detection of Eimeria coccidia, thereby meeting the needs of clinical diagnosis, environmental monitoring, and epidemiological research for Eimeria coccidia detection.

[0015] 3. This invention utilizes SYAB Green fluorescence quantitative technology for precise quantitative detection of Eimeria suis. During PCR amplification, SYAB Green dye specifically binds to double-stranded DNA and generates a fluorescence signal. As the target sequence is exponentially amplified, the amount of double-stranded DNA in the reaction system increases, and the fluorescence increases synchronously. The instrument collects fluorescence in real time and generates an amplification curve. By establishing a correspondence between the initial template amount and Ct through the threshold cycle number (Ct) and the standard curve or relative quantitative model, the quantitative detection of target DNA and oocyst number of Eimeria suis can be achieved.

[0016] 4. This invention can further determine the infection intensity of Eimeria suis, and realize the assessment of "whether infected - how much infected - infection intensity" of positive samples: After establishing a standard curve, the infection intensity of coccidia in the sample is obtained through the "copy number - oocyst number (OPG)" conversion model constructed by this invention; combined with the actual production of pig farms and clinical diarrhea risk thresholds, the infection intensity can be classified, which can be used to guide group management, adjustment of environmental disinfection frequency and precise medication. Attached Figure Description

[0017] Figure 1 The image shows the PCR amplification results of the cox 1 gene from Eimeria coccidia.

[0018] Figure 2 This is an optimization diagram of the optimal annealing temperature for the method of this invention.

[0019] Figure 3 This is a diagram showing the optimal primer concentration for the method of this invention.

[0020] Figure 4 This is a graph showing the sensitivity detection results of the method of the present invention.

[0021] Figure 5 Standard curves of Eimeria oocyst plasmids were plotted for the method of this invention.

[0022] Figure 6 This is a diagram showing the specific detection results of the method of the present invention.

[0023] Figure 7 A SYBR Green qPCR standard curve was plotted for Eimeria coccidia oocyst samples using the method of this invention. Detailed Implementation

[0024] To facilitate a better understanding of the present invention by those skilled in the art, the following detailed description, in conjunction with accompanying drawings and embodiments, will illustrate the present invention in detail. However, the described embodiments are only a part of the embodiments of the present invention and are not intended to limit the present invention to those embodiments.

[0025] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0026] The conserved sequence of the cox 1 gene in a species of Eimeria suis is as follows: AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA; The primer set for the cox 1 gene is as follows: Upstream primer Cox-F: GCTTTCGGTGTTATTTCTCA Downstream primer Cox-R: TGTGCCCAAACTAATGAACC.

[0027] The kit for quantitative real-time PCR detection of Eimeria suis includes the upstream primer Cox-F, the downstream primer Cox-R of the cox 1 gene, and the SYAB Green quantitative real-time PCR detection reagent.

[0028] A method for preparing a quantitative real-time PCR detection kit for Eimeria suis includes the following steps: 1) Extract the genome from pig fecal samples; 2) The genome from step 1) was detected by real-time PCR using SYAB Green real-time PCR reagent and primer set; 3) The reaction conditions for SYAB Green real-time PCR were optimized, and the annealing temperature was confirmed to be 57.6℃; the primer concentration for the cox 1 gene was 0.4 μmol / L. 4) Obtain the amplification curves and Ct values ​​from steps 2) and 3); 5) Determine the result using the Ct value. When the Ct value of the sample is <35, the test result is positive, indicating that the sample contains Eimeria coccidia; when the Ct value is ≥35, the test result is negative, indicating that the sample does not contain Eimeria coccidia.

[0029] 6) Determine the severity of Eimeria coccidia infection using Ct values. A standard curve for the quantification of Eimeria oocyst DNA was constructed using the SYBR Green qPCR method. The quantitative relationship model between the concentration (x) of Eimeria oocysts and the Ct value was obtained: Ct = -3.2047x + 35.011, thus yielding an infection intensity OPG=10. (35.011-Ct) / 3.2047 . Example 1

[0030] 1. Genomic DNA was extracted from Eimeria coccidia oocysts collected from pig feces and used as a template for PCR amplification. Based on the cox 1 gene sequence, amplification primers Cox-F and Cox-R were synthesized by Xi'an Qingke Biotechnology Co., Ltd., cloned into the cloning T-vector pMD™19 (Simple), and transformed into Escherichia coli DH5α competent cells. Single colonies were picked and expanded for culture. Positive clones were identified by bacterial culture PCR and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing.

[0031] Plasmids were extracted from the correctly sequenced bacterial culture and named pMD 19-cox 1, serving as a positive plasmid standard for *Eimeria* coccidia. The concentration and purity were determined using an ultra-micro spectrophotometer. An OD260 / OD280 ratio between 1.8 and 2.0, and a concentration of 35.3 ng / μL, indicated that the extracted plasmid was of good quality and suitable for plotting a standard curve.

[0032] The total volume of the PCR reaction system used to amplify the cox 1 gene of Eimeria coccidia was 25 μL: 12.5 μL of 2 × RapidTaq Master Mix, 1 μL of Cox-F, 1 μL of Cox-F, 1 μL of template, and 9.5 μL of ddH2O.

[0033] The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 57℃ for 15 s, 72℃ for 10 s, 35 cycles; 72℃ extension for 5 min.

[0034] Agarose gel electrophoresis results showed that a single band of the cox 1 gene was obtained after PCR amplification. Gene sequencing confirmed that the constructed pMD19-cox 1 standard plasmid had no mutations, insertions, or deletions, and was consistent with the published cox 1 gene sequence. Figure 1 As shown, from left to right, the images are: DL 500 DNA Marker, and the PCR amplification product of the cox 1 gene.

[0035] The primer sequences for amplification and the full-length amplified Cox 1 sequence are as follows: The conserved sequence of the Cox 1 gene is: AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA Primer pair for the Cox 1 gene: Upstream primer Cox-F: GCTTTCGGTGTTATTTCTCA Downstream primer Cox-R: TGTGCCCAAACTAATGAACC Example 2

[0036] A kit for the quantitative real-time PCR detection of Eimeria coccidia includes the following steps: 1. Dilution of plasmid standards: The recombinant pMD19-cox1 plasmid correctly sequenced in Example 1 was serially diluted 10-fold using sterile ddH2O to prepare a standard of 1.14 × 10⁻⁶ plasmids. 8 copies / μL, 1.14×10 7 copies / μL, 1.14×10 6 copies / μL, 1.14×10 5 copies / μL, 1.14×10 4 copies / μL, 1.14×10 3 copies / μL, 1.14×10 2 Standard solution in copies / μL.

[0037] 2. Primers The cox 1 gene sequences of *Eimeria* were retrieved from the NCBI nucleotide database GenBank (http: / / www.ncbi.nlm.nih.gov) (GenBank numbers: OQ595092.1, OQ595090.1, MF589745.1, KU255437.1, OQ595087.1, OQ595089.1, OQ595088.1, MH350860.1, MK284238.1, OQ595093.1). Specific primers were designed using Primer Premier 5 software and further validated using BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to ensure specificity. The specific sequences are shown below: Upstream primer Cox-F: GCTTTCGGTGTTATTTCTCA Downstream primer Cox-R: TGTGCCCAAACTAATGAACC 3. Optimization of SYAB Green Real-Time PCR Reaction Conditions To determine the optimal conditions for the qPCR detection system of Eimeria tenella in this invention, optimization was carried out on the annealing temperature and primer concentration.

[0038] Using pMD19-cox1 plasmid as a template, optimal annealing temperatures were screened by setting annealing temperature gradients of 62.0℃, 61.3℃, 60.0℃, 57.6℃, 54.7℃, 52.4℃, 50.8℃, and 50.0℃. Figure 2 As shown, the annealing temperatures 1–8 are 62.0℃, 61.3℃, 60.0℃, 57.6℃, 54.7℃, 52.4℃, 50.8℃, and 50.0℃ respectively, and the optimal annealing temperature is determined to be 57.6℃. Primer concentration gradients are set as follows: 0.15 μmol / L, 0.2 μmol / L, 0.25 μmol / L, 0.3 μmol / L, 0.35 μmol / L, 0.4 μmol / L, 0.45 μmol / L, and 0.5 μmol / L. Figure 3 As shown, the primer concentrations 1-8 are: 0.15 μmol / L, 0.2 μmol / L, 0.25 μmol / L, 0.3 μmol / L, 0.35 μmol / L, 0.4 μmol / L, 0.45 μmol / L, and 0.5 μmol / L, respectively; 9. For the negative control, the optimal primer concentration was determined to be 0.4 μmol / L; The specific reaction system and conditions of this invention are shown in Tables 1 and 2.

[0039] 4. Establish a standard curve With 1.14×10 8 copies / μL, 1.14×10 7 copies / μL, 1.14×10 6 copies / μL, 1.14×10 5 copies / μL, 1.14×10 4 copies / μL, 1.14×10 3 copies / μL, 1.14×10 2 Using standard solutions of copies / μL as templates, SYBR Green real-time PCR was performed.

[0040] The quantitative PCR reaction system consisted of 20 μL: 10 μL of 2×FAST qPCR Master Mixture (Green), 0.5 μL of Cox-F, 0.5 μL of Cox-R, 1 μL of plasmid standards at different dilutions, and ddH2O to bring the total to 20 μL.

[0041] The reaction conditions were: pre-denaturation at 95℃ for 2 min; 40 cycles of 95℃ for 15 s and 57.6℃ for 15 s. The obtained Ct values ​​were used to calculate the standard curve equation and plotted as a standard curve. The results are shown in the figure below, with a correlation coefficient R0. 2 >0.99 indicates that the standard plasmid copy number and Ct value of this SYAB Green real-time PCR method have a good linear relationship; Figure 4 The values ​​from 1 to 7 are 1.14 × 10⁻⁶. 8 copies / μL, 1.14×10 7 copies / μL, 1.14×10 6 copies / μL, 1.14×10 5 copies / μL, 1.14×10 4 copies / μL, 1.14×10 3 copies / μL, 1.14×10 2 copies / μL, used as templates for amplification curves; Figure 5 The horizontal axis represents the logarithm of the standard concentration, and the vertical axis represents the Ct value. The curve shows a good linear relationship, with a correlation coefficient R² greater than 0.99.

[0042] 5. Specific detection Using the genomes of Eimeria coccidia, Isocytozoa, Nematoda esophagostomum, Bacillus spp., and Microsporidia bitellae as templates, the specificity of the method was verified by detecting them using the established SYAB Green real-time PCR method.

[0043] The results showed that the established SYAB Green real-time PCR detection method had good specificity, exhibiting good amplification effects only on the Eimeria genome; no amplification curves or Ct values ​​were observed for other genomes (e.g., Eimeria genus). Figure 6 ).

[0044] 6. Repeatability test This study tested serially diluted Eimeria coccidia plasmid standards using intra- and inter-batch repeatability tests. The results showed that the coefficient of variation (CV) for each concentration gradient was less than 3% (Table 3), confirming the good repeatability and stability of the established qPCR method.

[0045] Example 3

[0046] 1. Establish a SYBR Green qPCR standard curve for Eimeria coccidia oocyst samples. The enriched and purified Eimeria coccidia oocyst fluid was counted using a McMaster counting chamber, and the average value was taken from two counts. The concentration was found to be 4.17 × 10⁻⁶. 5 / mL, serially dilute the oocyst fluid to 1.0×10 5 / mL~1.0×10 1 Five concentrations ( / mL) were used for DNA extraction, and the qPCR method established in Example 2 was used for detection. The quantitative standard curve equations were obtained, as shown in Table 4. Figure 7 As shown.

[0047] Example 4

[0048] 1. Sample Collection In 2025, fecal samples were collected from a large-scale farm in Xianyang City, Shaanxi Province. The samples were immediately transported to the laboratory, where DNA was extracted using a fecal DNA extraction kit. The DNA was then aliquoted and stored at -20°C for later use.

[0049] 2. Sample Testing The extracted nucleic acid was used as a template and amplified and detected according to the SYAB Green real-time PCR reaction system and conditions described in Example 2. Simultaneously, the collected fecal samples were examined under a microscope using the saturated saline flotation method. The results showed that the positive detection rate of the SYAB Green real-time PCR method of this invention was higher than that of the saturated saline flotation method, further verifying the superiority of the method of this invention.

[0050]

[0051] Conclusion: This invention enables highly sensitive, specific, and accurate quantitative detection of Eimeria coccidia, and can be used for Eimeria detection in clinical diagnosis, environmental monitoring, and epidemiological research.

Claims

1. A detection gene for *Eimeria* coccidia, characterized in that, The gene being detected is the cox 1 gene, and the conserved sequence of the cox 1 gene is as follows: AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA; The primer set for the cox 1 gene is as follows: Upstream primer Cox-F: GCTTTCGGTGTTATTTCTCA Downstream primer Cox-R: TGTGCCCAAACTAATGAACC.

2. A kit for the detection of Eimeria suis using real-time PCR, characterized in that, The kit includes the upstream primer Cox-F and the downstream primer Cox-R for the Cox 1 gene, and the SYAB Green real-time PCR detection reagent.

3. The preparation method of the quantitative real-time PCR detection kit for Eimeria suis according to claim 2, characterized in that, Includes the following steps: 1) Extract the genome from pig fecal samples; 2) The genome from step 1) was detected by real-time PCR using SYAB Green real-time PCR reagent and primer set; 3) Optimize the reaction conditions for SYAB Green real-time PCR, and confirm the annealing temperature and primer concentration; 4) Obtain the amplification curves and Ct values ​​from steps 2) and 3); 5) Determine the presence of Eimeria coccidia by Ct value. When the Ct value of the sample is <35, the sample test result is positive, indicating that the sample contains Eimeria coccidia; when the Ct value is ≥35, the sample test result is negative, indicating that the sample does not contain Eimeria coccidia. 6) Determine the severity of Eimeria coccidia infection using Ct values. A standard curve for the quantification of Eimeria oocyst DNA was constructed using the SYBR Green qPCR method. The quantitative relationship model between the concentration (x) of Eimeria oocysts and the Ct value was obtained: Ct = -3.2047x + 35.011, thus yielding an infection intensity OPG=10. (35.011-Ct) / 3.2047 .

4. The preparation method of the quantitative real-time PCR detection kit for Eimeria suis according to claim 3, characterized in that, In step 3, the annealing temperature for the SYAB Green real-time PCR reaction is 57.6℃; the primer concentration for the cox1 gene is 0.4 μmol / L.

Images