SNP (Single Nucleotide Polymorphism) marker and KASP (Kinase Assay Specific Protein) detection primer of wheat stem rot resistant site Qcr.hnk-6BS in adult-plant stage and application of SNP marker and KASP detection primer
By developing the SNP marker SNP AX-109329176 on wheat chromosome 6BS and its KASP detection primers, we solved the problem of identification and breeding of wheat stem base rot resistance in mature plants, realized efficient molecular marker-assisted selection, and improved the accuracy and efficiency of breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HENAN CROP MOLECULAR BREEDING RES INST
- Filing Date
- 2026-01-12
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient to effectively improve wheat resistance to stem rot through molecular marker-assisted selection breeding methods, especially in resistance identification and breeding at the mature plant stage where efficient molecular marker tools are lacking.
A SNP marker SNP AX-109329176 located on wheat chromosome 6BS and its corresponding KASP detection primers were developed for rapid, high-throughput detection of genotypes of wheat resistance to stem base rot at the adult stage. Combined with PCR amplification and fluorescence signal detection, molecular marker-assisted selection for wheat resistance to stem base rot was achieved.
This method enables efficient identification and breeding of wheat resistance to stem base rot at the mature stage, improves the accuracy and efficiency of breeding, provides an efficient molecular marker-assisted selection method, and enhances wheat resistance to stem base rot.
Smart Images
Figure CN122012768A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the SNP marker, KASP detection primers, and applications of a wheat stem base rot resistance site Qcr.hnk-6BS. Background Technology
[0002] Wheat (Triticum aestivum L.) is one of the staple foods for humankind. Stem base rot is characterized by its highly saprophytic pathogen, wide host range, primary infection site at the stem base, and ability to occur throughout the entire growth cycle, posing a significant threat to wheat. Traditional methods, such as fungicides, are ineffective in eradicating the disease. Breeding and planting resistant varieties is the most effective and environmentally friendly measure for controlling wheat stem base rot. The discovery of resistance genes and the development of their molecular markers are the foundation and guarantee for breeding wheat varieties resistant to stem base rot.
[0003] Currently, there are very few cases of wheat stem rot resistance breeding that rely on creating favorable conditions for disease development through artificial inoculation in the field, with offspring selection based on phenotypic identification. Instead, molecular marker-assisted selection is more commonly used. Molecular marker-assisted selection is a modern plant breeding strategy that allows for the detection and selection of the types and quantities of wheat stem rot resistance genes and QTLs at the molecular level in early generations. Selecting individual plants that aggregate multiple target genes and QTLs can improve the effectiveness and persistence of stem rot resistance.
[0004] With the rapid development of genome sequencing technology, dozens of molecular markers have been developed and applied in various scientific research. Single nucleotide polymorphism (SNP) markers, due to their large number, wide and dense distribution, and suitability for rapid, high-throughput genotyping, are highly favored by various research fields. The rapid development of wheat genomics research has also spurred the iterative upgrading of gene chip technology. Wheat SNP chips with different densities, such as 9K, 15K, 55K, 90K, 660K, and 820K, have been successively developed. Based on SNP sites, developing KASP markers that facilitate high-throughput detection of SNP sites is the mainstream of molecular marker development now and for a considerable period to come. Summary of the Invention
[0005] This invention provides an SNP marker, SNP AX-109329176, associated with resistance to stem rot in mature wheat plants, and KASP detection primers for detecting this SNP marker. This SNP marker and KASP detection primers can be used for screening wheat germplasm resources resistant to stem rot and for selecting breeding progeny materials.
[0006] The present invention specifically adopts the following technical solution:
[0007] This invention first provides the application of SNP AX-109329176 in any of the following aspects:
[0008] (1) Assisted breeding of wheat resistant to stem base rot in the mature stage; specifically, it can be used to assist in the selection of offspring materials for wheat resistant to stem base rot.
[0009] (2) Identification or evaluation of resistance to stem base rot in mature wheat germplasm resources.
[0010] The SNP AX-109329176 is located at 4885850 bp on wheat chromosome 6BS, where the nucleotide polymorphism is either T or C.
[0011] This invention provides a product for detecting the aforementioned SNP AX-109329176, the product comprising:
[0012] (1) KASP detection primers for detecting the above-mentioned SNP AX-109329176 genotype, the KASP detection primers comprising:
[0013] Upstream primer CF1: 5'-AGCGCTCCATTGTTGGGTGTT-3' (SEQ ID NO:6);
[0014] Upstream primer CF2: 5'-AGCGCTCCATTGTTGGGTGTC-3' (SEQ ID NO:7);
[0015] Downstream primer CR: 5'-AACGCTAGCCCAGTCGAATAC-3' (SEQ ID NO:3).
[0016] The upstream primer CF1 also has a specific fluorescent sequence FAM at its 5' end, and the upstream primer CF2 also has a specific fluorescent sequence HEX at its 5' end.
[0017] The specific fluorescent sequence FAM is 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO:4);
[0018] The specific fluorescent sequence HEX is 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO:5).
[0019] (2) A reagent or kit containing the primer combination described in (1).
[0020] This invention provides for the use of the product for detecting the above-mentioned SNP AX-109329176 in any of the following aspects:
[0021] (1) Assisted breeding of wheat resistant to stem base rot at the mature stage;
[0022] (2) Identification or evaluation of resistance to stem base rot in mature wheat germplasm resources.
[0023] This invention provides a method for detecting resistance to stem rot in mature wheat plants, comprising:
[0024] The genotype of the aforementioned SNP AX-109329176 in the wheat genome was detected, and the resistance to stem rot in mature wheat plants was determined based on the genotype. When the genotype of SNP AX-109329176 is TT, the wheat is susceptible to stem rot in mature plants; when the genotype of SNP AX-109329176 is CC, the wheat is resistant to stem rot in mature plants.
[0025] Specifically, the product used to detect the above-mentioned SNP AX-109329176 was used to amplify the genomic DNA of wheat by PCR, and the fluorescence signal of the PCR amplification product was detected. Red fluorescence indicates CC disease-resistant genotype, blue fluorescence indicates TT disease-susceptible genotype, and green fluorescence indicates CT heterozygous genotype.
[0026] This invention also provides a method for breeding wheat, comprising:
[0027] (1) The above methods were used to detect the resistance of wheat parents to stem base rot at the adult stage;
[0028] (2) Select appropriate wheat parents for breeding according to the breeding objectives.
[0029] Terminology Explanation: KASP detection primers are specific detection primers designed based on the polymorphism of the target genome sequence of the experimental material. The polymorphism information is designed at the 3' end of the primer, and the HEX sequence adapter and FAM sequence adapter, which emit different colors after binding with fluorescent primers, are designed at the 5' end of the primer. Based on the ARMPCR principle, amplification is performed using universal fluorescent primers, and the genotype of the experimental material is determined based on the detected signal color.
[0030] The beneficial effects of this invention are as follows:
[0031] This invention identifies Qcr.hnk-6BS as the major effective locus for wheat resistance to stem base rot in adult plants. In order to better apply it to wheat disease resistance breeding practices, this invention also developed KASP detection primers for detecting this gene. These detection primers can be well used in molecular marker-assisted selection breeding practices for wheat resistance to stem base rot. Attached Figure Description
[0032] Figure 1Manhattan plot of genome-wide association analysis (GWAS) of resistance to stem base rot in mature wheat plants. Blue and purple dots in the plot represent SNP sites detected by one or more of the multilocus genome-wide association analysis methods, respectively.
[0033] Figure 2 Genotypic clustering of KASP primer combinations in the F2 population progeny of (A) 629 core wheat germplasm resources in Henan Province and (B) the disease-resistant variety Zhoumai 27 and the disease-susceptible variety Guomai 301. Red indicates CC disease-resistant genotype, blue indicates TT disease-susceptible genotype, and green indicates CT heterozygous genotype.
[0034] Figure 3 The average disease index of different haplotypes in the F2 population offspring of the disease-resistant variety Zhoumai 27 and the susceptible variety Guomai 301. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0036] Example 1
[0037] 1.1 Identification of the Qcr.hnk-6BS locus for resistance to stem rot in mature wheat plants
[0038] Given the scarcity of stem base rot resistance resources in wheat production and the high complexity of its pathogenic factors, we conducted a genome-wide association study on the resistance of 629 core wheat germplasms (Table 1) at the mature stage to stem base rot.
[0039] The results showed that SNP AX-109329176 (at 4885850 bp) located on the wheat 6BS chromosome was consistently detected in both the 2022-2023 and 2023-2024 years, and its BLUP value was also consistently positive. This SNP was tentatively named Qcr.hnk-6BS. Figure 1 ).
[0040] Table 1. Genotyping results of 629 wheat materials using KASP primer combinations and 660K SNP chip.
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052] In Table 1, a: wheat varieties with repeated names are provided with place of origin information. Varieties with both repeated names and place of origin information are distinguished by adding numbers after the place of origin; b: varieties with inconsistent molecular marker genotypes and 660K chip typing results are provided with molecular marker typing results. Varieties with consistent results are indicated by "—".
[0053] 1.2 Development of KASP primer combinations for detecting the Qcr.hnk-6BS site of resistance to stem rot in mature wheat plants
[0054] To better utilize Qcr.hnk-6BS for breeding wheat stem rot resistance, we developed an easy-to-detect KASP primer combination based on SNP AX-109329176.
[0055] 1.2.1 Primer Design and Synthesis
[0056] We extracted SNP AX-109329176 (at 4885850 bp) from the wheat chromosome 6BS at the reference genome (IWGSCv1.0) in the wheat database WheatOmics (http: / / 202.194.139.32 / ), taking 500 bp upstream and downstream of the physical location (total 1001 bp). Using the primer design software Primer 5.0, we designed a KASP primer combination specifically for detecting the genotype at this locus. The primer sequences are as follows:
[0057] Upstream primer CF1:
[0058] 5'- GAAGGTGACCAAGTTCATGCT AGCGCTCATTGTTGGGTGTT-3' (SEQ ID NO: 1);
[0059] Upstream primer CF2:
[0060] 5'- GAAGGTCGGAGTCAACGGATT AGCGCTCCATTGTTGGGTGTC-3' (SEQ ID NO:2);
[0061] Downstream primer CR: 5'-AACGCTAGCCCAGTCGAATAC-3' (SEQ ID NO:3).
[0062] The specific fluorescent sequence FAM is 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO:4);
[0063] The specific fluorescent sequence HEX is 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO:5).
[0064] 1.2.2 PCR reaction system
[0065] Includes: DNA (50 ng / μL), 2 x KASP Master mix and KASP Assay mix (100 μM of three primers, Forward primer-CF1, Forward primer-CF2, and Reverse primer-CR, mixed with sterile water in a volume ratio of 12:12:30:46), as detailed below:
[0066] Table 2. Reaction System
[0067]
[0068] 1.2.3 PCR reaction procedure
[0069] The PCR reaction procedure is detailed in Table 2.
[0070] Table 3. PCR reaction procedure
[0071]
[0072] 1.2.4 Result Interpretation
[0073] The PCR amplification products were subjected to fluorescence signal detection. Red fluorescence indicated the CC resistant genotype, blue fluorescence indicated the TT susceptible genotype, and green fluorescence indicated the CT heterozygous genotype.
[0074] 1.3 Application of KASP primer combinations
[0075] Genomic DNA was extracted from 629 core wheat germplasms in Henan Province listed in Table 1. PCR amplification was performed using the aforementioned KASP primer combination, and the fluorescence signal of the PCR amplification products was detected. The typing results of the 629 core wheat germplasms in Henan Province were determined based on the fluorescence color.
[0076] In addition, the wheat 660K SNP chip (an existing commercial product) was used to genotype the 629 core wheat germplasms in Table 1 from Henan Province.
[0077] The genotyping results of the above KASP primer combinations in 629 core wheat germplasms from Henan Province showed a consistency rate of approximately 88.4% with the genotyping results of the 660K wheat SNP chip. Figure 2 A (Table 1) shows that the KASP primer combination we developed for detecting Qcr.hnk-6BS has high resolution and can be applied to the identification of wheat germplasm resources resistant to stem rot.
[0078] 1.4 Validation of the Qcr.hnk-6BS locus for resistance to stem rot in mature wheat plants
[0079] We constructed an F2 population using two parents: Zhoumai 27, a disease-resistant variety with the CC genotype at the Qcr.hnk-6BS locus, and Guomai 301, a disease-susceptible variety with the TT genotype at the same locus. This resulted in 152 F2 plants. Genotyping of this F2 population was performed using the aforementioned KASP primer combination. The number of F2 plants with genotypes CC, CT, and TT were 36, 77, and 39, respectively. Figure 2 B), which conforms to 1:2:1 (X) 2 =0.1448, P=0.930).
[0080] We calculated the average disease index (disease index = 100 × ∑(number of diseased leaves at each level × representative value at each level) / (total number of leaves surveyed × highest representative value)) for the CC, CT, and TT genotypes in the F2 progeny. The indexes were approximately 21.19, 19.96, and 26.80, respectively. There was no significant difference in wheat stem rot resistance between the CC and CT genotypes, but both showed significant differences compared to the susceptible TT genotype. Figure 3 This indicates that the Qcr.hnk-6BS site plays a crucial role in the resistance of wheat stem base rot in the adult stage of this population, and the KASP primer combination we developed can be used for breeding wheat stem base rot resistance.
[0081] The above results indicate that the KASP primer combination developed based on the wheat mature-stage stem rot resistance locus Qcr.hnk-6BS can be well used in molecular marker-assisted selection breeding practices for wheat stem rot resistance.
[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of SNP AX-109329176 in any of the following aspects, characterized in that, (1) Assisted breeding of wheat resistant to stem base rot at the mature stage; (2) Identify or evaluate the resistance of wheat germplasm resources to stem base rot at the mature stage; The SNP AX-109329176 is located at 4885850 bp on wheat chromosome 6BS, where the nucleotide polymorphism is either T or C.
2. A product used for detecting SNP AX-109329176, characterized in that, The SNP AX-109329176 is located at 4885850 bp on wheat chromosome 6BS, and the nucleotide polymorphism at this location is either T or C. The products include: (1) KASP detection primers for detecting the SNP AX-109329176 genotype, the KASP detection primers comprising: Upstream primer CF1: 5'-AGCGCTCCATTGTTGGGTGTT-3'; Upstream primer CF2: 5'-AGCGCTCCATTGTTGGGTGTC-3'; Downstream primer CR: 5'-AACGCTAGCCCAGTCGAATAC-3'; (2) A reagent or kit containing the detection primers described in (1).
3. The product for detecting SNP AX-109329176 according to claim 2, characterized in that, The upstream primer CF1 also has a specific fluorescent sequence FAM at its 5' end, and the upstream primer CF2 also has a specific fluorescent sequence HEX at its 5' end.
4. The product for detecting SNP AX-109329176 according to claim 3, characterized in that, The specific fluorescent sequence FAM is 5'-GAAGGTGACCAAGTTCATGCT-3'; The specific fluorescent sequence HEX is 5'-GAAGGTCGGAGTCAACGGATT-3'.
5. The application of the product for detecting SNP AX-109329176 according to any one of claims 2-4 in any of the following aspects, characterized in that, (1) Assisted breeding of wheat resistant to stem base rot at the mature stage; (2) Identification or evaluation of resistance to stem base rot in mature wheat germplasm resources.
6. A method for detecting resistance to stem rot in mature wheat plants, characterized in that, include: The genotype of SNP AX-109329176 in the wheat genome was detected, and the resistance of wheat to stem rot at the adult stage was determined based on the genotype. SNP AX-109329176 is located at 4885850 bp on wheat chromosome 6BS, and the polymorphism of this SNP marker is T or C. When the genotype of SNP AX-109329176 is TT, it is wheat susceptible to stem rot at the adult stage, and when the genotype of SNP AX-109329176 is CC, it is wheat resistant to stem rot at the adult stage.
7. The method for detecting resistance to stem rot in mature wheat plants according to claim 6, characterized in that, Using the product for detecting SNP AX-109329176 as described in claim 3 or 4, PCR amplification of wheat genomic DNA is performed, and fluorescence signal detection is performed on the PCR amplification product. Red fluorescence indicates CC disease-resistant genotype, blue fluorescence indicates TT disease-susceptible genotype, and green fluorescence indicates CT heterozygous genotype.
8. A method for breeding wheat, characterized in that, include: (1) Using the method described in claim 6 or 7 to detect the resistance of wheat parents to stem base rot at the adult stage; (2) Select appropriate wheat parents for breeding according to the breeding objectives.