Early screening method for low-browning germplasm resources of beak walnuts based on transcription factor expression quantity
By detecting the expression levels of AsbHLH68 and/or AsMYB232 transcription factors in beaked walnut germplasm and combining this with mechanical damage treatment to activate transcription factor expression, the problems of long breeding cycles and large detection blind spots caused by browning of beaked walnut kernels have been solved, enabling early and accurate screening and efficient breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTHWEST FORESTRY UNIVERSITY
- Filing Date
- 2026-01-28
- Publication Date
- 2026-05-12
AI Technical Summary
Browning of the kernels of beaked walnuts leads to long breeding cycles, high costs, and large blind spots in detection. Existing technologies make it difficult to accurately screen browning-resistant germplasm during the seedling stage.
By detecting the expression levels of AsbHLH68 and/or AsMYB232 transcription factors in beaked walnut germplasm, and using real-time quantitative PCR technology combined with mechanical damage treatment to activate transcription factor expression, browning-resistant germplasm was screened.
It enables early, non-destructive, and precise germplasm screening, shortens the breeding cycle, reduces costs, and improves screening accuracy and breeding efficiency.
Smart Images

Figure CN122012773A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to an early screening method for low browning germplasm resources of *Prunus beakae* based on transcription factor expression levels. Background Technology
[0002] *Annamocarya sinensis*, a monotypic genus of walnuts in the family Juglandaceae, is a rare and endangered tree species under national key protection, possessing both unique scientific research value and excellent economic potential as a woody oilseed crop. However, kernel browning is a key challenge restricting the industrial utilization of *Annamocarya sinensis*. Research shows that kernel browning in *Annamocarya sinensis* is essentially a substrate-dependent enzymatic oxidation reaction: due to the pre-accumulation of large amounts of flavonoids and other phenolic substances within the kernel, when processing causes tissue breakage, these substrates come into contact with polyphenol oxidase (PPO) and rapidly oxidize to form dark brown quinone or tannin polymers. Currently, the selection of superior varieties with low substrate accumulation and resistance to browning mainly relies on traditional phenotypic observation methods. This method requires the plant to reach reproductive maturity, and the degree of browning is assessed by destroying the fruit structure and exposing it to air.
[0003] This method has the following technical drawbacks: lag and high cost: the long growth period of beaked walnut, from sowing to fruiting, takes several years, making the breeding cycle extremely long, and the large number of inferior plants in the field increases the management burden; irreversibility: the identification process means the destruction of the seeds, making it impossible to "identify and save seeds" for a single seed; detection blind spots: upstream regulatory genes that lead to substrate accumulation (such as specific transcription factors) usually have high spatiotemporal specificity, and are often in a "dormant" or low-expression state in seedling vegetative organs (such as leaves), making it easy for conventional molecular detection to produce false negatives.
[0004] Therefore, there is an urgent need to establish an early screening system based on damage-induced mechanisms. By simulating the processing stress environment to activate the expression of key regulatory genes, the seed kernel metabolic characteristics and browning risk of mature plants can be accurately predicted at the seedling stage. This will provide a breakthrough technical means to shorten the breeding cycle of woody plants. Summary of the Invention
[0005] This invention aims to provide an early screening method for low-browning germplasm resources of *Prunus beakae* based on transcription factor expression levels to address the problems existing in the background art. Specifically, this invention provides the following technical solution:
[0006] This invention provides a molecular marker associated with browning of beaked walnut germplasm. The molecular marker is the transcription factor AsbHLH68 and / or the AsMYB232 gene or its encoded protein. The nucleotide sequence of the AsbHLH68 gene is shown in SEQ ID NO:5 or a sequence having more than 90% homology and function. The nucleotide sequence of the AsMYB232 gene is shown in SEQ ID NO:6 or a sequence having more than 90% homology and function.
[0007] Furthermore, the present invention provides a product for detecting the molecular marker, the product comprising reagents, kits, or gene chips, the product detecting the expression level of the molecular marker.
[0008] Furthermore, the present invention provides the application of the molecular markers or products described herein in marker-assisted selection breeding of browning-resistant beaked walnut germplasm. The expression levels of the transcription factors AsbHLH68 and / or AsMYB232 genes or their encoded proteins are positively correlated with the browning trait of beaked walnuts, and the lower the expression level, the more resistant the germplasm is to browning.
[0009] Furthermore, the present invention provides a method for screening browning-resistant beaked walnut germplasm, comprising the following steps:
[0010] (1) Collect tissue samples from the tested beaked walnut plants;
[0011] (2) Detect the expression levels of the transcription factors AsbHLH68 and / or AsMYB232 as described in claim 1 in the sample;
[0012] (3) Compare the detection results with the control threshold, and select plants whose transcription factor expression level is significantly lower than the control threshold as browning resistant candidate germplasm.
[0013] Furthermore, in step (1), the tissue sample is a mature leaf of a beaked walnut. Before the test, the detached leaves of the test plant are mechanically damaged and incubated at room temperature for 0.5-2 hours to induce the expression of the transcription factor.
[0014] Furthermore, in step (2), real-time quantitative PCR was used to detect the expression levels of transcription factors AsbHLH68 and / or AsMYB232.
[0015] Furthermore, the specific primer pair sequences used for detecting AsbHLH68 are shown in SEQ ID NO:1 and SEQ ID NO:2; the specific primer pair sequences used for detecting AsMYB232 are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0016] Furthermore, the control threshold is the average level of transcription factor expression in high browning beaked walnut plants or populations, and the method for judging high browning beaked walnuts is that the beaked walnut kernel immediately turns brown within 30 seconds after being cut open.
[0017] Furthermore, the screening criteria are as follows: using AsActin as an internal reference gene, the expression levels of AsbHLH68 and / or AsMYB232 genes are calculated. When the relative expression level of AsbHLH68 in the test plants is not higher than 2.113, and / or the relative expression level of AsMYB232 is not higher than 3.651, the plants are judged to be browning resistant.
[0018] The technical effects achieved by this invention are as follows:
[0019] 1. Significantly shortens the breeding cycle and enables early, non-destructive prediction: Existing technologies must rely on fruit phenotypic identification after the plant has reached reproductive maturity, a process that can take several years. This invention, by detecting specific molecular markers in seedling leaves, shifts the identification period to the seedling stage, 3-5 years earlier than traditional methods. Furthermore, this method requires only the collection of a small number of leaves, avoiding destructive sampling of valuable germplasm fruits, and achieving the living conservation and sustainable utilization of germplasm resources.
[0020] 2. Based on underlying metabolic regulation mechanisms, the accuracy of screening is significantly improved: Traditional phenotypic observation is easily affected by environmental factors and it is difficult to distinguish between "high enzyme activity" and "high substrate accumulation". This invention, based on the molecular mechanism of "transcriptional repression leading to substrate accumulation", directly identifies the "source" genes (AsbHLH68 and AsMYB232) that cause browning. This detection based on genotype and transcriptional levels essentially avoids the subjective errors and environmental interference of phenotypic identification, and can accurately identify potential high-risk plants for browning.
[0021] 3. Overcoming the technical bottleneck of tissue-specific expression detection: Addressing the challenge of extremely low expression abundance of target transcription factors in normal seedling leaves, making them difficult to detect using conventional methods, this invention innovatively introduces a "mechanical damage-induced" pretreatment step. By simulating the stress environment during seed processing, the expression of stress-response genes in leaves is successfully activated, significantly amplifying the detection signal and effectively avoiding false negatives caused by gene silencing.
[0022] 4. Reduce breeding costs and improve breeding efficiency: This invention allows for large-scale screening of seedlings in the nursery stage, eliminating most of the inferior plants with a high risk of browning before transplanting. This significantly reduces ineffective planting area, saving years of land occupation, water and fertilizer management, and labor costs, allowing limited resources to be concentrated on cultivating superior plants and significantly improving the breeding efficiency of browning-resistant new varieties of beaked walnut. Attached Figure Description
[0023] Figure 1 Leaf Imaging: This image shows the in vivo imaging results of the transient expression experiment in tobacco leaves. Left Image: Shows fluorescence imaging of tobacco leaves after injection of different combinations. The upper leaf region was injected with the AsDFR12 promoter + empty vector, and the lower region was injected with the AsDFR12 promoter + transcription factor (AsbHLH68 or AsMYB232). Right Legend: Explanation of the injection protocol corresponding to the left image. For example, "0080-AsDFR12 pro + 62-sk-AsbHLH68" indicates the injection of the AsDFR12 promoter vector and the AsbHLH68 expression vector. The results visually show that the fluorescence intensity decreased after the addition of the transcription factor, verifying the interaction between the transcription factor and the gene.
[0024] Figure 2 The first panel shows the expression differences of marker genes between the high and low browning groups. The left panel (AsbHLH68) shows the expression difference of the AsbHLH68 gene between the two groups. The bars (filled diagonal lines) represent the relative expression level detected by RT-qPCR, and the line graph (black squares) represents the Log2(FPKM+1) value from transcriptome sequencing. The results show that the expression level in the high browning group is significantly higher than that in the low browning group. The right panel (AsMYB232) shows the expression difference of the AsMYB232 gene between the high and low browning groups. The bars and line graphs have the same meaning as the left panel, also showing a significantly higher expression level in the high browning group. Detailed Implementation
[0025] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with embodiments, so as to fully understand the purpose, features and effects of this application. For the testing methods, purchased goods, unless otherwise specified, shall be used under conventional conditions or conditions recommended by the manufacturer. Unless otherwise defined herein, the scientific and technical terms used in connection with this invention shall have the meanings commonly understood by one of ordinary skill in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials described herein may also be used in the practice and testing of this disclosure.
[0026] Example 1
[0027] A method for screening low-brown beak walnut germplasm includes the following steps:
[0028] Step 1: Sample Collection and Induction Treatment
[0029] Mature leaves from healthy, vigorous walnut trees were collected (without waiting for fruit ripening). To simulate the physiological stress environment during kernel processing and activation of related gene expression, the detached leaves underwent standardized mechanical damage treatment (e.g., cutting them into pieces of approximately 1 cm² using sterile scissors, or using serrated forceps for multi-point compression). The treated leaves were then incubated at room temperature (25±2℃) for 0.5–2 hours to allow time for transcription factor response and accumulation.
[0030] Step 2: RNA extraction and cDNA synthesis
[0031] Leaf samples induced in step one were collected, flash-frozen in liquid nitrogen, and ground. Total RNA was extracted from the leaves, and the first strand of cDNA was synthesized using a reverse transcription kit.
[0032] Step 3: Detection of expression levels of key genes
[0033] The relative expression levels of target transcription factors AsbHLH68 and AsMYB232 were detected using real-time quantitative PCR (RT-qPCR). Internal reference gene: preferably AsActin from walnut trees. Primer sequences: Specific primer pairs for detecting AsbHLH68 are shown in SEQ ID NO:1 and SEQ ID NO:2; specific primer pairs for detecting AsMYB232 are shown in SEQ ID NO:3 and SEQ ID NO:4. Data calculation: [The text abruptly ends here, so the translation stops as well.] The relative expression level of the target gene relative to the internal reference gene is calculated.
[0034] Step 4: Screening and Judgment
[0035] Based on the relative expression levels obtained from RT-qPCR detection, and combined with a substrate accumulation and transcriptional repression model, the following criteria were established: A reference threshold was set: Known high-browning beaked walnut plants (or the average level of the population) were used as controls to set a risk threshold for transcription factor expression levels. Low-browning germplasm assessment (retention): If the relative expression levels of AsbHLH68 and / or AsMYB232 in the tested plant were significantly lower than the threshold (e.g., lower than 50% of the control group), the AsDFR12 gene was not strongly repressed, and the accumulation of flavonoid substrates in the kernel was low, classifying it as a potential "low-browning" germplasm and retaining it. High-browning germplasm assessment (elimination): If the expression levels of the above transcription factors were higher than or close to the threshold, the plant was considered to have a risk of excessive accumulation of substrates such as catechins due to AsDFR12 transcriptional repression, classifying it as a "high-browning" germplasm and recommending its removal.
[0036] Effect verification:
[0037] 1. Validation of the correlation between transcription factors and browning trait
[0038] 1) Material Selection and Transcriptome Sequencing: The applicant selected beaked walnut germplasm resources with known significant phenotypic differences, including three high-browning and three low-browning germplasm samples (Note: The criterion for selection was that the beaked walnut kernel immediately browned within 30 seconds of being cut open into high-browning germplasm, and did not brown into low-browning germplasm). Transcriptome sequencing analysis was performed after sample collection.
[0039] 2) Validation of expression differences (RT-qPCR): The sequencing results were validated using RT-qPCR technology. The results showed that, under the induction / sampling conditions, the relative expression levels of transcription factors AsbHLH68 and AsMYB232 in the high browning group were significantly higher than those in the low browning group. AsbHLH68: The average expression level in the high browning group was 4.90 times that in the low browning group; AsMYB232: The average expression level in the high browning group was 3.76 times that in the low browning group.
[0040] 3) Targeting Relationship Validation (Dual-Luciferase Assay): A reporter vector containing the AsDFR12 promoter and an effector vector containing AsbHLH68 / AsMYB232 were constructed. Dual-Luciferase Assay results in tobacco leaves showed that both AsbHLH68 and AsMYB232 could directly bind to the AsDFR12 promoter region and inhibit its activity, confirming their molecular mechanism as negative regulators. The dual-luciferase assay demonstrated that AsbHLH68 and AsMYB232 directly bind to the AsDFR12 promoter.
[0041] Example 2
[0042] Establishment of a standardized RT-qPCR detection system
[0043] This embodiment details the molecular detection process used for screening, including primer design, RNA extraction, reverse transcription, and real-time quantitative fluorescence detection steps.
[0044] 1) Design specific primer pairs targeting the AsbHLH68 gene:
[0045] Forward primer: 5'- GAGTGGGGTAACAGTGGTGG -3'
[0046] Reverse primer: 5'-CGATGTCGGTGATGGAGGAG-3'
[0047] Design specific primer pairs targeting the AsMYB68 gene:
[0048] Forward primer: 5'-TACTGGCATTGCACCAGTGT-3'
[0049] Reverse primer: 5'-ATGATTGCAGACTCCCAGCC-3'
[0050] Design specific primer pairs targeting the AsActin gene:
[0051] Forward primer: 5'-CCTTAGGTTTTCGCCGGGAT-3'
[0052] Reverse primer: 5'-CTGCAAGTAGCACTGGATGC-3'
[0053] 2) Establish a standardized RT-qPCR reaction system.
[0054] a) In this embodiment, Novizan's [FastPure] is used. ®RNA extraction was performed using the Universal Plant Total RNA Isolation Kit-RC411. The specific steps are as follows:
[0055] Liquid nitrogen grinding: Plant samples are rapidly ground into powder in liquid nitrogen, and 0.3 ml of the sample is used for the experiment.
[0056] Sample lysis: Add 600 μl of Buffer PSL, vortex to mix, and immediately centrifuge at 12,000 rpm for 5 min. Collect the supernatant.
[0057] gDNA removal: Transfer the supernatant to FastPure gDNA-Filter Columns III, centrifuge at 12,000 rpm for 30 seconds, and collect the filtrate.
[0058] RNA adsorption: Transfer the entire mixture to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.
[0059] To remove impurities: Add 700 μl of Buffer RWA, centrifuge at 12,000 rpm for 30 sec, and discard the filtrate. Add 500 μl of Buffer RWB, centrifuge at 12,000 rpm for 30 sec, and discard the filtrate; repeat once. Centrifuge an empty column at 12,000 rpm for 2 min.
[0060] RNA elution: Add 30-100 μl RNase-free ddH2O and centrifuge at 12,000 rpm for 1 min.
[0061] b) Reverse transcription was performed using the [All-In-One 5X RT MasterMix] kit from abm.
[0062] The specific 20 μL reaction system is as follows:
[0063] All-In-One 5X RT MasterMix: 4μL
[0064] RNA template: 1 μg
[0065] ddH2O: Add to a final volume of 20 μL
[0066] The amplification procedure steps are as follows:
[0067] Enzyme incubation (37℃): 15 min
[0068] Reverse transcription reaction (60℃): 10 min
[0069] Reaction termination (95℃): 3 min
[0070] c) Using ABM's [BlasTaq] TM The 2X qPCR MasterMix kit was used for real-time quantitative PCR.
[0071] The specific 20 μL reaction system is as follows:
[0072] BlasTaq™ 2X qPCR MM: 10 μL
[0073] Forward primer (10 μM): 0.5 μL
[0074] Reverse primer (10 μM): 0.5 μL
[0075] cDNA template: 100 ng
[0076] ddH2O: Add to a final volume of 20 μL
[0077] The thermal profile amplification procedure is as follows:
[0078] Pre-denaturation: 95°C, 180s
[0079] Amplification cycles (40 cycles): denaturation 95°C, 15 sec; annealing / extension 60°C, 60 sec.
[0080] Melting Curve: 65°C to 97°C, heated at a rate of 0.1°C / s.
[0081] Example 3: Field blind testing application
[0082] 1. Sample collection: Select a batch of seedlings of *Prunus serrulata* with unknown genetic background or no phenotype, collect their mature leaves, and perform standardized mechanical damage induction treatment according to the aforementioned method.
[0083] 2. Detection and calculation: RNA was extracted and RT-qPCR was performed according to the method described in Example 2. AsActin was used as an internal reference gene to calculate the relative expression levels of AsbHLH68 and AsMYB232 in each sample.
[0084] 3. Result Interpretation: The test results were compared with the established thresholds (AsbHLH68 ≤ 2.113 and AsMYB232 ≤ 3.651). Six plants were determined to have expression levels significantly lower than the thresholds and were predicted as "low-browning" germplasm. The remaining 14 plants were determined to have higher expression levels and were predicted as "high-browning" risk germplasm. The six "low-browning" germplasm plants were cultured to the point of fruiting; upon dissection of the kernels, five of them showed no browning within 30 seconds.
Claims
1. Molecular markers associated with browning of beaked walnut germplasm, characterized by, The molecular markers are transcription factors AsbHLH68 and / or AsMYB232 genes or their encoded proteins, wherein the nucleotide sequence of the AsbHLH68 gene is shown in SEQ ID NO:5 or a sequence having more than 90% homology and function; the nucleotide sequence of the AsMYB232 gene is shown in SEQ ID NO:6 or a sequence having more than 90% homology and function.
2. A product that detects the molecular marker of claim 1, characterized in that, The product includes reagents, kits, or gene chips, and the product detects the expression level of the molecular marker.
3. The application of the molecular marker of claim 1 or the product of claim 2 in marker-assisted selection breeding of brown-resistant beaked walnut germplasm, characterized in that, The expression levels of the transcription factors AsbHLH68 and / or AsMYB232 genes or their encoded proteins are positively correlated with the browning trait of beaked walnuts; the lower the expression level, the more resistant the germplasm to browning.
4. A method for screening brown-resistant beaked walnut germplasm, characterized in that, Includes the following steps: (1) Collect tissue samples from the tested beaked walnut plants; (2) Detect the expression levels of the transcription factors AsbHLH68 and / or AsMYB232 as described in claim 1 in the sample; (3) Compare the detection results with the control threshold, and select plants whose transcription factor expression level is significantly lower than the control threshold as browning resistant candidate germplasm.
5. The method according to claim 4, characterized in that, In step (1), the tissue sample is a mature leaf of a beaked walnut. Before the test, the detached leaves of the test plant are mechanically damaged and incubated at room temperature for 0.5-2 hours to induce the expression of the transcription factor.
6. The method according to claim 4 or 5, characterized in that, In step (2), real-time quantitative PCR was used to detect the expression levels of transcription factors AsbHLH68 and / or AsMYB232.
7. The method according to claim 6, characterized in that, The specific primer pair sequences used to detect AsbHLH68 are shown in SEQ ID NO:1 and SEQ ID NO:2; the specific primer pair sequences used to detect AsMYB232 are shown in SEQ ID NO:3 and SEQ ID NO:
4.
8. The method according to claim 4, characterized in that, The control threshold is the average level of transcription factor expression in high browning beaked walnut plants or populations. The method for judging high browning beaked walnuts is that the beaked walnut kernel immediately turns brown within 30 seconds after being cut open.
9. The method according to claim 4, characterized in that, The specific screening criteria are as follows: using AsActin as an internal reference gene, the expression levels of AsbHLH68 and / or AsMYB232 genes are calculated. When the relative expression level of AsbHLH68 in the test plants is not higher than 2.113 and / or the relative expression level of AsMYB232 is not higher than 3.651, the plants are judged to be browning resistant.