Clitocybe maxima strain InDel identification primer, construction of fingerprint spectrum and liquid strain of Clitocybe maxima strain InDel identification primer

By using InDel-labeled primer combinations and fingerprinting, combined with specialized culture media and optimized processes, the problem of rapid identification of *Pleurotus ostreatus* strains, especially liquid strains, has been solved, achieving efficient and accurate identification and quality control, and ensuring the purity and reliability of liquid strains.

CN122012778APending Publication Date: 2026-05-12SHANGHAI ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI ACAD OF AGRI SCI
Filing Date
2026-02-09
Publication Date
2026-05-12

Smart Images

  • Figure CN122012778A_ABST
    Figure CN122012778A_ABST
Patent Text Reader

Abstract

The invention discloses a clitocybe maxima strain InDel identification primer, construction of a fingerprint spectrum and a liquid strain of the clitocybe maxima strain InDel identification primer, and belongs to the field of molecular markers and edible fungus detection. The invention provides an InDel labeled primer combination (SEQ ID NO: 1-14) consisting of 7 pairs of primers, and a method for constructing a DNA fingerprint spectrum by using the primer combination and rapidly identifying strains of panus giganteus' Shenmushroom No.1 'and' Shenmushroom No.2 '. Meanwhile, the invention further provides a special liquid strain culture medium suitable for the strain and an optimized culture method of the special liquid strain culture medium. According to the technology, molecular identification and liquid strain production are combined, a complete technical system from strain identity verification to high-quality strain preparation is formed, the technology has the advantages of being accurate in identification, high in efficiency and high in repeatability, and an effective technical means is provided for panus giganteus variety right protection, strain quality control and industrialized production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular markers and edible fungi detection, specifically involving the construction of InDel identification primers and fingerprint patterns for a strain of *Pleurotus ostreatus* and its liquid culture. Background Technology

[0002] The information disclosed in this background section is intended only to enhance some understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art.

[0003] Pig stomach mushroom ( Pleurotus giganteus ) belongs to the phylum Basidiomycota ( Basidiomycota ), Pleurotus ( Pleurotus It is a large fungus with high nutritional and medicinal value. Its fruiting body is rich in protein, polysaccharides, trace elements and various bioactive substances, and is highly sought after in the market.

[0004] In recent years, with the rapid development of industrialized and large-scale edible mushroom production in China, the cultivation area of ​​*Pleurotus ostreatus* has been continuously expanding. However, the identification, evaluation, and breeding of new varieties of *Pleurotus ostreatus* are relatively lagging behind, failing to keep pace with the industry's development. Currently, the identification and differentiation of *Pleurotus ostreatus* strains in production and research still mainly rely on traditional morphological observation, mycelial antagonism tests, and fruiting cultivation experiments. These methods have inherent and insurmountable drawbacks: The process is lengthy: antagonism tests take 1-2 weeks, while fruiting tests take up to 3 months from inoculation to completion of biological characteristic identification, which seriously delays the breeding and production process.

[0005] Accuracy is poor: morphological characteristics are easily affected by environmental conditions and are highly subjective; while antagonistic reactions may not be obvious among some closely related strains, leading to misjudgment or missed judgment.

[0006] Inefficient: It cannot achieve rapid screening of large numbers of samples.

[0007] Of particular note is that with the popularization of liquid fermentation technology for edible fungi, liquid spawn has become the preferred choice for industrial production due to its advantages such as consistent mycelial age, short fermentation cycle, high inoculation efficiency, and suitability for automated control. However, liquid spawn appears as suspended mycelial balls or fragments, completely losing the macroscopic morphological characteristics of fruiting bodies and solid mycelia. This renders all traditional identification methods completely ineffective in the face of this morphology. This leads to a high risk of spawn confusion, degradation, and even malicious counterfeiting during the production, distribution, and use of liquid spawn. Once problems arise, they not only cause huge economic losses to production enterprises but also seriously disrupt market order. Furthermore, due to the lack of rapid and effective identification methods, traceability and rights protection are extremely difficult.

[0008] Therefore, the industry urgently needs a technical solution that can overcome morphological limitations and directly and rapidly identify *Pleurotus ostreatus* strains, especially the specific morphology of liquid strains.

[0009] The development of molecular marker technology has provided an ideal solution to the above problems. Among them, insertion / deletion (InDel) markers, as a type of molecular marker based on genome sequencing, have advantages such as abundant quantity, co-dominance, high accuracy, good stability, and ease of operation. They are particularly suitable for developing identification markers for specific species at the whole-genome level.

[0010] However, to date, there are no publicly reported InDel marker fingerprint profiles or identification methods developed at the whole-genome level for the specific identification of important cultivated strains (such as Shenxun No. 1 and Shenxun No. 2). More importantly, the existing technology completely lacks a complete quality control system that combines the production and preparation of liquid spawn with its molecular-level identification, making it impossible to guarantee the purity and authenticity of liquid spawn products from the source. This has become a key bottleneck restricting the healthy, stable, and sustainable development of the *Pleurotus ostreatus* industry. Summary of the Invention

[0011] In response to the shortcomings of existing technologies, particularly the inability of traditional methods to identify liquid microbial strains and the lack of targeted culture media and processes, this invention aims to provide a complete solution covering everything from core identification tools, specialized culture media, optimized processes to final product definition.

[0012] The technical solution adopted in this invention is as follows: In a first aspect, the present invention provides an InDel-labeled primer combination for identifying *Pleurotus ostreatus* strains Shenxun 1 and Shenxun 2, the primer combination consisting of 7 pairs of InDel-labeled primers, the nucleotide sequences of which are as follows: Lefp_id001 forward primer: CGTGGTAGCTAATGAACGCG, as shown in SEQ ID NO: 1; reverse primer: CCAGCTGTGGCATTGTCATC, as shown in SEQ ID NO: 2. Lefp_id002 forward primer: AAACGGTCCTCCATCGTGAG, as shown in SEQ ID NO:3; reverse primer: GGATGCCAGAAGAGCCAGAA, as shown in SEQ ID NO:4; Lefp_id003 forward primer: GTACCCGCCGGTAATCGAAA, as shown in SEQ ID NO: 5; reverse primer: GCAAACGGGCCAAAGTAGTC, as shown in SEQ ID NO: 6; Lefp_id004 forward primer: CGAACATCCCCCTCACGAAA, as shown in SEQ ID NO: 7; reverse primer: CGTCCTATGATGTCGCCCAG, as shown in SEQ ID NO: 8; Lefp_id005 forward primer: GGAGCGAGCAAAAGGTTGAG, as shown in SEQ ID NO: 9; reverse primer: GCAGCCTCTGGCCAATTTCTG, as shown in SEQ ID NO: 10. Lefp_id006 forward primer: GGCTCGAGTCGTTAGCTCTG, as shown in SEQ ID NO: 11; reverse primer: TTGACCCGCAGAAGATGGTC, as shown in SEQ ID NO: 12. Lefp_id007 forward primer: GGTCTCGTTCCACTGCATGA, as shown in SEQ ID NO: 13; reverse primer: TTGAGCCCAAATCTCCTCCG, as shown in SEQ ID NO: 14.

[0013] This invention, based on whole-genome sequencing of *Pleurotus ostreatus*, developed a core detection system consisting of seven pairs of InDel-marked primers. This primer combination exhibits high specificity, high amplification efficiency, and excellent reproducibility, serving as the foundation for constructing fingerprint profiles and identifying strains. The nucleotide sequences of each primer pair are as described in the specification, constituting the core detection tool of this invention.

[0014] And provide the application of the InDel-labeled primer combination in the preparation of a detection kit for identifying *Schefflera spp.* strain 1 or 2.

[0015] Secondly, the present invention provides a kit for identifying *Schefflera spp.* strains 1 and 2, comprising the aforementioned 7 pairs of InDel-labeled primers.

[0016] Thirdly, this invention provides a method for constructing an InDel-labeled fingerprint of a *Pleurotus ostreatus* strain. This method provides a standard operating procedure from sample to result, including: (1) Extract genomic DNA from the *Pleurotus ostreatus* strain to be tested; (2) Using the above InDel-labeled primer combination, the DNA to be tested was amplified by PCR reaction; (3) Electrophoresis detection and analysis of PCR amplification products to obtain a DNA fingerprint composed of 7 InDel-labeled allele fragments.

[0017] Further, in step (2), the PCR amplification reaction system is: 10 μl of 2×Premix Taq, 1 μl of each pair of forward and reverse primers, 0.5-2 μl of genomic DNA, and ddH2O to make up to 20 μl.

[0018] Further, in step (2), the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 45 s, 72℃ extension for 30 s, cycled 35 times; 72℃ final extension for 7 min.

[0019] Furthermore, in step (3), the control uses a DNA ladder with a molecular weight of D500 bp. The InDel-labeled fingerprint of the strain is obtained by taking a picture with a gel imaging device, which can determine the number and relative molecular weight of allelic fragments amplified by each InDel-labeled primer.

[0020] Fourthly, the present invention provides a standard InDel-labeled fingerprint pattern of the *Shenxun* strain 1 of *Pleurotus ostreatus*, characterized in that the fingerprint pattern consists of allelic fragment bands at 7 loci obtained by amplification using the primer combination described in the first aspect, wherein the band combination is: (1+2), (1+2), 2, (1+2), 2, 1, (1+2). The segment lengths corresponding to the equivalence segment numbers are as follows: Lefp_id001: Segment 1 is 234 bp, segment 2 is 217 bp; Lefp_id002: Segment 1 is 239 bp, segment 2 is 212 bp; Lefp_id003: Segment 1 is 285 bp, segment 2 is 264 bp; Lefp_id004: Segment 1 is 154 bp, segment 2 is 127 bp; Lefp_id005: Segment 1 is 134 bp, segment 2 is 109 bp; Lefp_id006: Segment 1 is 180 bp, segment 2 is 161 bp; Lefp_id007: Segment 1 is 208 bp, segment 2 is 191 bp.

[0021] Fifthly, the present invention provides a standard InDel-labeled fingerprint pattern of *Schefflera spp.* strain 2, characterized in that the fingerprint pattern consists of allelic fragment bands at 7 loci obtained by amplification using the primer combination described in the first aspect, wherein the band combination is: (1+2), 2, 2, 1, 1, 2, (1+2).

[0022] In a sixth aspect, the present invention provides a method for identifying *Pleurotus ostreatus* strain Shenxun No. 1 or Shenxun No. 2, (1) using the method described in the third aspect, constructing a fingerprint spectrum of the *Pleurotus ostreatus* strain to be tested; (2) Compare the fingerprint spectrum obtained in step (1) with the fingerprint spectrum described in the fourth or fifth aspect; If the fingerprint spectrum of the test strain is consistent with the fingerprint spectrum described in the fourth aspect, it is identified as *S. spp.* strain No. 1; if it is consistent with the fingerprint spectrum described in the fifth aspect, it is identified as *S. spp.* strain No. 2.

[0023] In a seventh aspect, the present invention provides a special culture medium for fermentation of *Pleurotus ostreatus* liquid spawn of strain 1 or 2; the culture medium comprises components at the following concentrations: Carbon source: sucrose 15 ~ 20 g / L (preferably 17.5 g / L), glucose 5 ~ 10 g / L (preferably 7.5 g / L), poplar wood chip extract 20 ~ 30 g / L (preferably 25 g / L); Nitrogen source: yeast extract 4 ~ 7 g / L (preferably 5 g / L), oat extract 5 ~ 10 g / L (preferably 7.5 g / L); Inorganic salts: MgSO4 1.0 ~ 2.0 g / L (preferably 1.5 g / L), KH2PO4 3.0 ~ 5.0 g / L (preferably 4.0 g / L), MnSO4 0.01 ~ 0.02 g / L (preferably 0.015 g / L).

[0024] Eighthly, the present invention provides an optimized cultivation method for liquid spawn of *Pleurotus ostreatus* var. *sinensis*, comprising the following steps: Strain activation: Inoculate the strain onto a PDA plate and use it immediately after the mycelium has fully covered the plate; Seed culture preparation: Inoculate the activated mycelial blocks into an Erlenmeyer flask containing the above liquid culture medium, and culture in a shaker for 5-6 days to obtain the first-grade seed culture; Fermentation in fermenter: Inoculate the primary seed culture into the fermenter at an inoculation rate of 0.05 v / v% to 1 v / v% and carry out fermentation culture. The fermentation culture medium is the liquid culture medium mentioned above. The conditions for the primary seed culture are as follows: Filling volume: 250 ~ 300 mL / 500 mL Erlenmeyer flask; Initial pH: Natural pH; Incubation temperature: 24 ~ 26℃ (preferably 25℃); Shaking table speed: 100 ~ 120 r / min; Culture time: 5 to 6 days (5 days is preferred).

[0025] The key culture parameters for the liquid fermenter are: Can pressure: 0.03 MPa ~ 0.05 MPa; Ventilation ratio: 0.2 vvm ~ 0.3 vvm; The cultivation temperature is 24℃~26℃ (preferably 25℃). Culture time: 5 to 6 days (5 days is preferred).

[0026] Ninthly, the present invention provides a molecularly verified liquid spawn product of *Pleurotus ostreatus*, including *Pleurotus ostreatus* Shenxun No. 1 or Shenxun No. 2 liquid spawn, which is produced and verified by a method comprising the following steps: (a) Cultured using the above-mentioned special culture medium and culture method; (b) The obtained mycelium was amplified by PCR and fingerprinted using the above InDel-labeled primer combination; (c) When the constructed fingerprint pattern is completely consistent with the fingerprint pattern of Shenxun No. 1 or Shenxun No. 2, the liquid strain is confirmed to be the corresponding real strain.

[0027] The liquid culture can be a primary seed culture or a liquid culture cultured in a fermenter.

[0028] In a tenth aspect, the present invention provides the application of the above-mentioned primer combinations, reagent kits, special culture media, optimized culture methods, fingerprint profiles, and liquid spawn products in the identification of the authenticity of *Pleurotus ostreatus* strains, protection of variety rights, breeding processes, or quality control of liquid spawn.

[0029] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects: (1) High specificity and accuracy: The 7 pairs of InDel marker primers developed in this invention and the fingerprint spectrum constructed thereon were able to uniquely identify Shenxun No. 1 and Shenxun No. 2 among the 17 collected strains of *Pleurotus ostreatus*. The specificity is high, the results are accurate and reliable, and the subjective misjudgment of morphology and antagonism test is effectively avoided.

[0030] (2) Fast and efficient: The entire identification process can be completed in 3-4 days. Compared with conventional morphological testing, antagonism test (at least 2 weeks) and fruiting test (at least 3 months), it greatly shortens the identification cycle and provides an efficient tool for variety rights protection, market supervision and breeding screening.

[0031] (3) Good reproducibility and simple operation: InDel labeling is a codominant labeling agent with high stability and good reproducibility. The PCR and electrophoresis methods provided by this invention are both routine molecular biology techniques and are easy to promote and apply in ordinary laboratories.

[0032] (4) Systematic solution: The innovative integration of “special liquid culture medium - optimized liquid culture preparation process - molecular identification” forms a complete technical system from production to quality inspection, ensuring the purity and quality control of the final liquid culture product. Attached Figure Description

[0033] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0034] Figure 1 This is the InDel marker standard fingerprint spectrum of the *Shenxun* strain 1 of *Pleurotus ostreatus* provided in this embodiment of the invention.

[0035] In this figure, lane M represents the DNA molecular weight standard (D500 bp DNA Ladder), and lanes 1 to 7 correspond to the PCR amplification results using InDel-labeled primer pairs Lefp_id001 to Lefp_id007, respectively. This figure illustrates the characteristic banding pattern of strain Shenxun No. 1, serving as a standard for identification and comparison.

[0036] Figure 2 This is the InDel marker standard fingerprint spectrum of the *Schefflera spp.* strain 2 provided in this embodiment of the invention.

[0037] In this figure, lane M represents the DNA molecular weight standard (D500 bp DNA Ladder), and lanes 1 to 7 correspond to the PCR amplification results using InDel-labeled primer pairs Lefp_id001 to Lefp_id007, respectively. This figure illustrates the characteristic banding pattern of strain Shenxun No. 2, serving as a standard for identification and comparison.

[0038] Figure 3 This is the amplification electrophoresis pattern of primer Lefp_id001 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0039] The figure shows the polymorphism of the Lefp_id001 marker in different strains, where strains Shenxun 1 and Shenxun 2 both show (1+2) type heterozygous bands.

[0040] Figure 4 This is the amplification electrophoresis pattern of the primer Lefp_id002 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0041] The figure shows the polymorphism of the Lefp_id002 marker in different strains, with strain Shenxun 1 showing a (1+2) type, while strain Shenxun 2 shows a homozygous type 2 band.

[0042] Figure 5 This is the amplification electrophoresis pattern of the primer Lefp_id003 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0043] The figure shows the polymorphism of the Lefp_id003 marker in different strains, where strains Shenxun 1 and Shenxun 2 both show homozygous type 2 bands.

[0044] Figure 6 This is the amplification electrophoresis pattern of the primer Lefp_id004 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0045] The figure shows the polymorphism of the Lefp_id004 marker in different strains, with strain Shenxun 1 showing a (1+2) type, while strain Shenxun 2 shows a homozygous type 1 band.

[0046] Figure 7 This is the amplification electrophoresis pattern of the primer Lefp_id005 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0047] The figure shows the polymorphism of the Lefp_id005 marker in different strains, where strain Shenxun 1 shows a homozygous type 2 band, while strain Shenxun 2 shows a homozygous type 1 band.

[0048] Figure 8 This is the amplification electrophoresis pattern of the primer Lefp_id006 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0049] The figure shows the polymorphism of the Lefp_id006 marker in different strains, with strain Shenxun 1 showing a homozygous type 1 band and strain Shenxun 2 showing a homozygous type 2 band.

[0050] Figure 9 This is the amplification electrophoresis pattern of the primer Lefp_id007 used in the embodiments of the present invention in 17 strains of *Pleurotus ostreatus*.

[0051] The figure shows the polymorphism of the Lefp_id007 marker in different strains, with both Shenxun 1 and Shenxun 2 strains showing (1+2) type heterozygous bands.

[0052] Figure 10 It's a flat-panel photo of a pig's stomach mushroom.

[0053] Figure 11 This is a photo of the liquid seed of *Pleurotus ostreatus*.

[0054] Figure 12 It is a photo of a liquid fermenter.

[0055] Figure 13 This is a photo of the liquid microbial culture in the fermenter.

[0056] Figure 14 This is a photo of liquid bacterial inoculation.

[0057] Figure 15 These are photos of the germination of liquid mycelium from *Pleurotus ostreatus*.

[0058] Figure 16 These are photos of the growth of liquid mycelium from the pig stomach mushroom.

[0059] Figure 17 This is a photo of a pig stomach mushroom spawn culture bag.

[0060] Figure 18 These are photos of pig stomach mushrooms growing. Detailed Implementation

[0061] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0062] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.

[0063] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0064] Marker purchased from: Sangon Biotech Co., Ltd.; Premix Taq™ purchased from: Takara Biotech Co., Ltd.; Genomic DNA Extraction Kit purchased from: Nanjing Novizan Biotechnology Co., Ltd.

[0065] All other materials and reagents are commercially available products.

[0066] Source of strain: Nos. 1-5 are from Zhangzhou, wild Zhangzhou, wild Zhejiang, wild Hainan, and wild Qingyuan, respectively. Nos. 6-14 and 17 are hybrid varieties of Shenxun No. 1 and No. 2. Nos. 15 and 16 are Shenxun No. 1 and Shenxun No. 2, respectively, varieties recognized by the Shanghai Academy of Agricultural Sciences. The classification number of Shenxun No. 1 is... Pleurotus giganteus Its accession number is GDMCC NO:64471, and it was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 29, 2024. The aforementioned Shenxun No. 2 has the following classification number: Pleurotus giganteus Its accession number is GDMCC NO:64472, and it was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 29, 2024.

[0067] The 7 pairs of InDel-labeled primer sequences are as follows: Table 1 List of InDel-labeled primers

[0068] Example 1: Extraction of genomic DNA from *Pleurotus ostreatus* strains Genomic DNA was extracted from the tested *Pleurotus ostreatus* strains using a kit: 20 mg of dried mycelium (including Shenxun No. 1, Shenxun No. 2, and other control strains) was ground into powder using liquid nitrogen. Immediately, 400 μl of Buffer A1 and 4 μl of RNase A (10 mg / ml) were added to the ground sample powder. The mixture was incubated in a 65°C water bath for 10 min. During the water bath, the centrifuge tube was inverted 2-3 times to mix the sample. 130 μl of Buffer A2 was added to the mixture, and it was thoroughly mixed. The mixture was placed on ice for 5 min, centrifuged at 14,000 rpm (18,400 × g) for 5-10 min, and the supernatant was carefully transferred to a new 1.5 ml centrifuge tube. The supernatant volume was calculated, and 1.5 times the supernatant volume of Buffer A3 was added, and the mixture was immediately refluxed and mixed. Transfer the mixture obtained in the previous step (including the precipitate) to FastPure gDNAColumns IV, centrifuge at 12,000 rpm (13,400 ×g) for 30–60 sec, and discard the filtrate. Add 600 μl of Buffer AW, centrifuge at 12,000 rpm (13,400 ×g) for 30 sec, and discard the filtrate. Repeat the previous step. Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm (13,400 ×g) for 2 min, and remove as much wash buffer as possible. Place the adsorption column in a new 1.5 ml centrifuge tube, add 50–100 μl of preheated Elution Buffer (65–70 °C) to the center of the membrane of the adsorption column, incubate at room temperature for 3–5 min, and centrifuge at 12,000 rpm (13,400 ×g) for 1 min. Store at -20 °C for later use.

[0069] Example 2: InDel-labeled PCR amplification and fingerprinting construction PCR amplification was performed using a 7-pair primer combination: the amplification system consisted of 10 μl of 2×Premix Taq, 1 μl of each of the 7 pairs of forward and reverse primers, 0.5-2 μl of DNA extracted in Example 1, and ddH2O added to a final volume of 20 μl. The reaction was carried out under the following conditions: 95℃ for 5 min; 95℃ for 30 s, 57℃ for 45 s, 72℃ for 30 s, for 35 cycles; 72℃ for 7 min.

[0070] Preparation of agarose gel: Weigh 4.0 g of agarose powder, add it to 100 mL of 1×TBE electrophoresis buffer, microwave it to dissolve, cool it to about 60°C, add nucleic acid dye (such as GelRed), mix well, pour it into the gel casting tank, insert the comb, and solidify at room temperature.

[0071] Electrophoresis: After the gel has completely solidified, place it in the electrophoresis tank and add sufficient 1×TBE buffer (the liquid level should cover the gel). Mix 5-7 μL of PCR amplification product with 1 μL of 6×Loading Buffer and spot the mixture into the gel wells. At the same time, add 5 μL of D500 bp DNA ladder to the adjacent wells as a molecular weight standard.

[0072] Electrophoresis conditions: constant voltage 90 V, electrophoresis for about 3-4 hours, until the bromophenol blue indicator migrates to about 3 / 4 of the gel front.

[0073] Imaging and Analysis: After electrophoresis, the gel was placed in a gel imaging system for imaging. The size of the amplified bands at the 7 labeled sites for each sample was recorded.

[0074] Constructing a standard fingerprint map: The amplification results of strain Shenxun No. 1 were interpreted, and the banding pattern combination of its seven loci (Lefp_id001 to id007) was determined to be: (1+2), (1+2), 2, (1+2), 2, 1, (1+2). This is the standard InDel marker fingerprint of Shenxun No. 1. Figure 1 As shown in the figure, M is the marker, and lanes 1-7 correspond to 7 pairs of primers.

[0075] The amplification results of strain Shenxun 2 were interpreted, and its banding pattern was determined to be: (1+2), 2, 2, 1, 1,2, (1+2). This is the standard InDel marker fingerprint of Shenxun 2. Figure 2 .

[0076] Table 2 Summary of allelic fragment information amplified by InDel primers

[0077] Example 3: Standard fingerprint spectra of *Stachys aegyptii* (Shenxun No. 1 and Shenxun No. 2) In this embodiment, standard fingerprint maps of Shenxun No. 1 and Shenxun No. 2 are established using the above method.

[0078] Standard strains: The *Pleurotus ostreatus* strain Shenxun No. 1 (GDMCC NO:64471) and strain Shenxun No. 2 (GDMCC NO:64472) were used.

[0079] Standard fingerprint pattern: Shenxun No. 1: The banding patterns of its 7 InDel markers are (1+2), (1+2), 2, (1+2), 2,1, (1+2). The standard spectrum is as follows: Figure 1 As shown.

[0080] Shenxun No. 2: The banding pattern of its 7 InDel markers is (1+2), 2, 2, 1, 1, 2, (1+2). The standard fingerprint spectrum is as follows: Figure 2 As shown.

[0081] Example 4: Screening and optimization of liquid microbial culture medium formulation After obtaining and verifying the specific molecular identification methods for Shenxun No. 1 and Shenxun No. 2, in order to further promote their industrial application, this invention developed a liquid strain preparation technology suitable for this strain.

[0082] (1) Activation of strain: Inoculate either Shenxun No. 1 or Shenxun No. 2 strain of pig belly mushroom on PDA plate medium (potato 200g / L, glucose 20 g / L, agar 20 g / L, pH natural) and incubate at 25℃ until the mycelium covers the plate.

[0083] (2) Preparation of primary seed liquid: ① Carbon source screening: Potato juice (200 g / L) was used as the basal culture medium. Glucose, fructose, maltose, sucrose, lactose, poplar sawdust extract, and any combination of two or three of these were added at a total concentration of 20 g / L as carbon sources. Nitrogen sources (peptone 5 g / L) and inorganic salts (MgSO4·7H2O 1.5 g / L, KH2PO4 3 g / L) were fixed. Vigorously growing mycelial blocks were inoculated into 500 mL Erlenmeyer flasks, each containing 250 mL of liquid. After inoculation, the flasks were placed in a constant temperature shaker and cultured in the dark at 25℃ and 120 r / min for 5 days. The mycelial biomass to fermentation solids volume ratio was measured. The results showed that the mycelial biomass was highest when sucrose, glucose and poplar wood chip extract were used as carbon sources (Shenmun No. 1: 0.56 g / 100 mL, Shenmun No. 2: 0.58 g / 100 mL), and the fermentation solids volume ratio was the largest (99.5% and 99.8%), which determined it to be the optimal carbon source combination.

[0084] ② Nitrogen source screening: Based on a carbon source of 20 g / L sucrose, peptone, oat extract, yeast powder, ammonium sulfate, soybean flour, or any two or three other nitrogen sources with a total nitrogen content equivalent to 5 g / L were added as nitrogen sources, while keeping other components constant, and the mixtures were cultured in shake flasks. The results showed that when yeast extract and oat extract were used as nitrogen sources, the mycelial biomass of Shenxun No. 1 reached 0.89 g / 100 mL, and that of Shenxun No. 2 reached 0.90 g / 100 mL, with fermentation solids volume ratios of 98.4% and 99.1%, respectively, showing the best overall effect.

[0085] ③ Screening of inorganic salts: Based on a carbon source of 20 g / L sucrose and a nitrogen source of 5 g / L yeast extract, the effects of inorganic salts such as MgSO4, KH2PO4, CaCl2, FeSO4, MnSO4, and ZnSO4 were investigated. The results showed that MgSO4 had the most significant promoting effect on mycelial growth, followed by KH2PO4 and MnSO4.

[0086] (6) Orthogonal experiment for formula optimization: Mycelial biomass was used as the main evaluation index, and a comprehensive analysis was conducted in combination with the volume ratio of fermented solids. The optimal formula combination was obtained as follows: sucrose 17.5 g / L, glucose 7.5 g / L, poplar wood chip extract 25 g / L, yeast extract 5 g / L, oat extract 7.5 g / L, MgSO4 1.5 g / L, KH2PO4 4.0 g / L, and MnSO4 0.015 g / L.

[0087] (7) Verification test: Liquid culture medium was prepared according to the above optimal formula and shake-flask verification was performed. The results showed that the mycelial biomass of Shenxun No. 1 reached 12.28 g / L and the mycelial biomass of Shenxun No. 2 reached 12.30 g / L, and the fermentation solids volume ratios were 99.71% and 99.86%, respectively, which were significantly better than other combinations.

[0088] In summary, through systematic single-factor screening and orthogonal optimization, a universal and efficient culture medium formula suitable for the preparation of liquid spawn of *Pleurotus ostreatus* var. *shen* No. 1 and No. 2 was finally obtained: sucrose 17.5 g / L, glucose 7.5 g / L, poplar sawdust extract 25 g / L, yeast extract 5 g / L, oat extract 7.5 g / L, MgSO4 1.5 g / L, KH2PO4 4.0 g / L, and MnSO4 0.015 g / L. This formula has a clear composition, reasonable cost, and good reproducibility, laying a solid foundation for the large-scale preparation of liquid spawn.

[0089] Example 5: Optimized cultivation method of liquid strain of *Pleurotus ostreatus* var. *shenxun* No. 1 or No. 2. (1) Inoculate the strain onto a PDA plate (PDA medium (g / L): 200 g potato, 20 g glucose, 20 g agar, pH natural, 1 L water), and culture until the mycelium covers the plate. Figure 10 ; (2) Seed liquid preparation: such as Figure 14 The activated mycelial blocks were inoculated into 500 mL Erlenmeyer flasks containing the liquid culture medium from Example 4, with a filling volume of 250 mL / 500 mL Erlenmeyer flask. The pH was left at rest, and the flasks were incubated on a shaker at 25°C for 5 days at a shaking speed of 120 r / min to obtain the primary seed culture. Figure 11 ; (3) Fermentation in a fermenter: One 500 mL Erlenmeyer flask was inoculated into one 800 L fermenter (600 L of liquid). The fermenter pressure was 0.03 MPa~0.05 MPa, and the aeration ratio was 0.2 vvm~0.3 vvm. The primary seed culture was inoculated into the fermenter. The fermentation medium was the liquid medium from Example 4. Fermentation was carried out at 25°C for 5 days to obtain the liquid inoculum for the fermenter. Figure 12 .

[0090] Under the above optimized conditions, the liquid microbial inoculum in the fermenter exhibits uniform size, high density, and strong activity, such as... Figure 13 .

[0091] When this liquid inoculum is inoculated into the culture medium, it can germinate successfully. Figure 15 ), mycelial growth is vigorous ( Figure 16 ), complete the culture of the spawn bags ( Figure 17 ), and eventually form sub-entities ( Figure 18 This result verifies that the liquid spawn prepared by the method of the present invention has excellent inoculation adaptability and fruiting ability.

[0092] Example 6: Molecular Authentication and Product Quality Control of Liquid Microbial Strains This embodiment demonstrates how to integrate molecular identification technology into the production process of liquid microbial strains to achieve closed-loop management from "production" to "quality control," thereby defining the final qualified product.

[0093] (1) Sampling: Aseptically take 1 mL of bacterial solution from the primary seed liquid or liquid strain prepared according to the method of Example 4, centrifuge at 12,000 rpm for 2 minutes, discard the supernatant, and collect the mycelium.

[0094] (2) DNA extraction and identification: Genomic DNA of the mycelium was extracted according to the method in Example 1, and then PCR amplification and electrophoresis analysis of 7 InDel markers were performed strictly according to the procedure in Example 2 to construct its DNA fingerprint.

[0095] (3) Product identity verification: The fingerprint spectrum obtained in step (2) is compared with the standard fingerprint spectrum established in Example 3. Figure 1 , Figure 2 ) for comparison.

[0096] Judgment rules: If the fingerprint spectrum of this batch of liquid spawn is completely consistent with the standard spectrum of Shenxun No. 1, then the product is determined to be a qualified "Shenxun No. 1 liquid spawn of pig belly mushroom".

[0097] If it is completely consistent with the standard pattern of Shenxun No. 2, it is judged as a qualified "Shenxun No. 2 liquid strain of pig stomach mushroom".

[0098] If it does not match either of the two criteria, it is considered a defective product and will be rejected.

[0099] Conclusion: Through this embodiment, the liquid microbial strain confirmed has a clear genetic identity and reliable quality, and constitutes the liquid microbial strain product claimed by this invention.

[0100] Example 7: Identification and application of *Pleurotus ostreatus* strains To verify the specificity and practicality of the method of the present invention, we identified 17 different strains of *Pleurotus ostreatus* (including wild strains 1-5, hybrid offspring 6-14 and 17, and standard strains 15 'Shenmun No. 1' and 16 'Shenmun No. 2') collected from different sources.

[0101] Following the methods in Examples 1 and 2, DNA extraction, PCR amplification, and electrophoresis were performed on all 17 strains.

[0102] Figures 3 to 9 The amplification patterns of the seven primer pairs in all 17 strains are shown. It can be seen that different strains exhibit rich polymorphism at different sites.

[0103] The banding patterns of 7 sites for each unknown strain were compared one by one with the standard fingerprint pattern established in Example 3.

[0104] Test results: Of all the tested strains, only strain number 15 showed a band pattern at all seven loci that was completely consistent with the standard fingerprint pattern of Shenxun No. 1.

[0105] Only strain number 16 showed a banding pattern at all seven loci that was completely consistent with the standard fingerprint of Shenxun No. 2.

[0106] The banding patterns of the remaining strains are different from the two standard patterns mentioned above.

[0107] Conclusion: This method can rapidly, accurately, and uniquely identify Shenxun No. 1 and Shenxun No. 2 strains from multiple *Pleurotus ostreatus* strains, with good repeatability and high specificity.

[0108] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An InDel-marked primer combination for identifying *Pleurotus ostreatus* strains Shenxun 1 and Shenxun 2, characterized in that, The primer combination consists of 7 pairs of InDel-labeled primers, and their nucleotide sequences are as follows: The forward primer for Lefp_id001 is shown in SEQ ID NO:1, and the reverse primer is shown in SEQ ID NO:2; The forward primer for Lefp_id002 is shown in SEQ ID NO:3, and the reverse primer is shown in SEQ ID NO:4; The forward primer for Lefp_id003 is shown in SEQ ID NO: 5, and the reverse primer is shown in SEQ ID NO: 6; The forward primer for Lefp_id004 is shown in SEQ ID NO: 7, and the reverse primer is shown in SEQ ID NO: 8; The forward primer for Lefp_id005 is shown in SEQ ID NO: 9, and the reverse primer is shown in SEQ ID NO: 10; The forward primer for Lefp_id006 is shown in SEQ ID NO: 11, and the reverse primer is shown in SEQ ID NO: 12; The forward primer for Lefp_id007 is shown in SEQ ID NO: 13, and the reverse primer is shown in SEQ ID NO:

14.

2. A kit for identifying *Pleurotus ostreatus* strains Shenxun 1 and Shenxun 2, characterized in that, It includes the 7 pairs of InDel-tagged primers as described in claim 1.

3. A method for constructing an InDel-labeled fingerprint of a *Pleurotus ostreatus* strain, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the *Pleurotus ostreatus* strain to be tested; (2) Using the InDel-labeled primer combination as described in claim 1, the DNA to be tested is amplified by PCR reaction; (3) Electrophoresis detection and analysis of PCR amplification products to obtain a DNA fingerprint composed of 7 InDel-labeled allele fragments.

4. A standard InDel-labeled fingerprint of a *Pleurotus ostreatus* strain, Shenxun No. 1, characterized in that... The fingerprint pattern consists of allelic fragment bands at 7 loci amplified using the primer combination described in claim 1, wherein the band combination is: (1+2), (1+2), 2, (1+2), 2, 1, (1+2); wherein the fragment lengths corresponding to the allelic fragment numbers are as follows: Lefp_id001: Segment 1 is 234 bp, segment 2 is 217 bp; Lefp_id002: Segment 1 is 239 bp, segment 2 is 212 bp; Lefp_id003: Segment 1 is 285 bp, segment 2 is 264 bp; Lefp_id004: Segment 1 is 154 bp, segment 2 is 127 bp; Lefp_id005: Segment 1 is 134 bp, segment 2 is 109 bp; Lefp_id006: Segment 1 is 180 bp, segment 2 is 161 bp; Lefp_id007: Segment 1 is 208 bp, segment 2 is 191 bp.

5. A standard InDel-labeled fingerprint of a *Pleurotus ostreatus* strain, Shenxun No. 2, characterized in that... The fingerprint pattern consists of allelic fragment bands at 7 loci obtained by amplification using the primer combination described in claim 1, wherein the band combination is: (1+2), 2, 2, 1, 1, 2, (1+2), and the allelic fragment numbers are the same as those in claim 4.

6. A method for identifying *Pleurotus ostreatus* strain Shenxun 1 or Shenxun 2, characterized in that, (1) Using the method described in claim 3, construct the fingerprint spectrum of the *Pleurotus ostreatus* strain to be tested; (2) Compare the fingerprint spectrum obtained in step (1) with the fingerprint spectrum described in claim 4 or 5; If the fingerprint spectrum of the test strain is consistent with the fingerprint spectrum described in claim 4, it is identified as *Syngonium spp.* strain 1; if it is consistent with the fingerprint spectrum described in claim 5, it is identified as *Syngonium spp.* strain 2.

7. A special culture medium for fermentation of *Pleurotus ostreatus* liquid spawn (Shenxun No. 1 or Shenxun No. 2), characterized in that, The culture medium contains the following components at the following concentrations: Sucrose 15 ~ 20 g / L, glucose 5 ~ 10 g / L, poplar sawdust extract 20 ~ 30 g / L, yeast extract 4 ~ 7 g / L, oat extract 5 ~ 10 g / L, MgSO4 1.0 ~ 2.0 g / L, KH2PO4 3.0 ~ 5.0 g / L, MnSO4 0.01 ~ 0.02 g / L.

8. A method for cultivating liquid spawn of *Pleurotus ostreatus* var. *shenxun* No. 1 or No. 2, characterized in that, Includes the following steps: Strain activation: Inoculate the strain onto a PDA plate and culture until the mycelium has completely covered the plate; Seed culture preparation: The activated mycelial blocks are inoculated into an Erlenmeyer flask containing the liquid culture medium described in claim 7 and cultured in a shaker to obtain a primary seed culture. Fermentation in fermenter: Inoculate the primary seed culture into the fermenter at an inoculation rate of 0.05 v / v% to 1 v / v% and carry out fermentation culture. The fermentation culture medium is the liquid culture medium mentioned above. The conditions for primary seed culture are: Filling volume: 250 ~ 300 mL / 500 mL Erlenmeyer flask; Initial pH: Natural pH; Incubation temperature: 24 ~ 26℃; Shaking table speed: 100 ~ 120 r / min; Culture time: 5-6 days; The key culture parameters for liquid fermenters are: Can pressure: 0.03 MPa ~ 0.05 MPa; Ventilation ratio: 0.2 vvm ~ 0.3 vvm; Incubation temperature: 24℃~26℃; Culture time: 5 to 6 days.

9. A liquid spawn product of *Pleurotus ostreatus* with molecularly verified characteristics, characterized in that: This includes liquid spawn of *Pleurotus ostreatus* var. *sinensis*, either Shenxun No. 1 or Shenxun No. 2, which is produced and validated through a method comprising the following steps: (a) Culturing using the special culture medium of claim 7 and the culture method of claim 8; (b) PCR amplification and fingerprinting of the obtained mycelium were performed using the InDel-labeled primer combination described in claim 1; (c) When the constructed fingerprint spectrum is completely consistent with the fingerprint spectrum described in claim 4 or 5, the liquid bacterial strain is confirmed to be the corresponding real bacterial strain.

10. The application of the InDel-labeled primer combination of claim 1 and / or the kit of claim 3 and / or the fingerprint spectrum of claim 4 or 5 and / or the special culture medium of claim 7 and / or the culture method of claim 8 and / or the liquid spawn product of claim 9 in the process of identifying the authenticity of *Pleurotus ostreatus* strains, protecting variety rights, or breeding.