Molecular marker primer closely linked with brown planthopper resistant major gene Bph48 of rice as well as marking method and application of molecular marker primer

By developing molecular marker primers tightly linked to the major gene Bph48 for rice resistance to brown planthopper, PCR technology was used to rapidly identify rice resistance, solving the problems of complexity and high cost of traditional breeding methods and achieving efficient screening and breeding of insect-resistant varieties.

CN122012791APending Publication Date: 2026-05-12GUANGXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGXI UNIV
Filing Date
2026-03-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively introduce and aggregate different brown planthopper resistance genes, causing insect-resistant rice varieties to gradually lose their resistance after long-term planting. Furthermore, traditional breeding methods are complex, costly, and highly susceptible to environmental influences.

Method used

By developing molecular marker primers tightly linked to the major gene Bph48 for resistance to brown planthopper in rice, and using PCR amplification technology to detect molecular markers tightly linked to this gene, rapid identification and screening of rice varieties resistant to brown planthopper can be achieved.

Benefits of technology

It enables rapid and accurate identification of the resistance level of rice plants, improves the efficiency of insect-resistant variety selection, shortens the breeding cycle, reduces costs, and avoids environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012791A_ABST
    Figure CN122012791A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker primer closely linked with a brown planthopper resistant major gene Bph48 of rice as well as a marking method and application of the molecular marker primer. A rice insect-resistant variety 75-9-3 (called C268 for short) and Yangdao 9 (called 9311 for short) are hybridized to obtain genotypes of F2 individual plants, genetic linkage analysis is performed in combination with the brown planthopper resistance level of an F3 family, a resistance major gene Bph48 carried by the insect-resistant variety C268 is identified, a Bph48 positioning region is reduced to a 370kb fragment limited by markers 1M30.093 and 1M30.471 on the two sides, and the Bph48 gene is identified to be a Bph48 gene. And the molecular marker is closely linked with the molecular marker 1M30.471. The molecular marker 1M30.471 disclosed by the invention can be used for effectively detecting whether an insect-resistant variety C268 and derived varieties (lines) thereof contain the major resistance gene locus or not, so that the selection efficiency of the brown planthopper resistant character is greatly improved, and the brown planthopper resistant rice variety (line) containing Bph48 is obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and relates to a molecular marker primer tightly linked to the major gene Bph48 for resistance to brown planthopper in rice, as well as its marking method and application. This invention also relates to the application of this molecular marker in the breeding of brown planthopper-resistant rice varieties. Background Technology

[0002] Rice planthoppers are among the most serious field pests in rice-producing areas. The main types of rice planthoppers include the brown planthopper, gray planthopper, and white-backed planthopper, with the brown planthopper causing the most damage. The brown planthopper is a monophagous pest, typically laying eggs, reproducing, and feeding only on rice and common wild rice. Adults and nymphs suck sap from the phloem of the rice plant at the base of the stem using their stylets, causing yellowing leaves or death of the rice plant. As vectors for rice viral diseases, brown planthoppers can cause rice to become infected, ultimately leading to reduced yields or crop failure. Since brown planthopper damage mainly occurs during the rice ripening and grain-filling stage, the extensive use of insecticides at this time poses a serious problem of environmental and rice pollution. Developing insect-resistant rice varieties using brown planthopper-resistant genes is the most economical and effective method for the integrated management of brown planthoppers.

[0003] Since the 1970s, nearly 50 major genes for resistance to brown planthoppers have been reported, of which 17 have been cloned, including Bph1, Bph2, Bph3, Bph6, Bph9, and Bph14. Some of these major genes have been used for variety genetic improvement in domestic and international brown planthopper-resistant rice breeding. However, due to the emergence of new biotypes of brown planthoppers, resistant varieties are gradually losing their resistance or facing the risk of losing their resistance altogether. A single resistance gene can gradually lose its effectiveness under long-term cultivation. For example, insect-resistant varieties carrying Bph1 quickly lose their resistance after a few years of widespread cultivation, while varieties carrying both Bph1 and Bph2 exhibit stronger and more durable resistance. Therefore, there is an urgent need in rice production for insect-resistant varieties carrying new and multiple resistance genes.

[0004] Conventional breeding methods often struggle to effectively introduce and aggregate different insect-resistant genes. This invention, based on the identification of molecular markers closely linked to or co-segregating with insect-resistant genes, utilizes marker-assisted selection technology to purposefully introduce and aggregate these genes, thereby breeding durable resistant varieties, delaying the degradation of insect-resistant varieties, and preventing the emergence of new biotypes of brown planthoppers. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker primer tightly linked to the major gene Bph48 for resistance to brown planthopper in rice, as well as its marking method and application. By detecting molecular markers tightly linked to the major gene for resistance to brown planthopper, the resistance of rice plants to brown planthopper can be predicted, thereby accelerating the breeding progress of brown planthopper-resistant rice varieties.

[0006] The molecular marker for Bph48, the major gene for resistance to brown planthopper in rice, was obtained by PCR amplification using the following primer pairs:

[0007] Labeled primers: 1M30.471

[0008] Left primer sequence: CAATACCACACATCTGGCCC

[0009] Right-end primer sequence: CAGCAACTGTCAAAACTAGAGAG.

[0010] The present invention also provides a molecular marker method for the major gene Bph48 for resistance to brown planthopper in rice. The method involves amplifying the genomic DNA of rice leaves to be tested using the above primer pair. If primer 1M30.471 can amplify a fragment of 100 bp in size that is the same as that in resistant varieties, it indicates that the rice to be tested contains the major gene Bph48 for resistance to brown planthopper.

[0011] The process of screening the above-mentioned marker primers is as follows:

[0012] (1) Rice variety C268 is a local Guangxi variety with high resistance to brown planthopper. Based on the localization process of the resistance gene, this invention develops molecular markers closely linked to the resistance gene. On the one hand, a certain number of molecular markers are selected according to existing InDel molecular markers at relatively uniform genetic distances. On the other hand, based on the localization region of the resistance gene, and referring to the corresponding genome sequences of rice varieties (lines) Nipponbare and 9311, InDel markers are designed in the regions where the two differ for fine localization.

[0013] (2) Using the brown planthopper-susceptible indica rice line 9311 as the female parent and the brown planthopper-resistant variety C268 as the male parent, hybrid offspring were obtained and a 9311 / C268 F2 segregating population was constructed. Each F2 single plant obtained the corresponding F3 family through self-pollination, which was used for seedling insect resistance identification.

[0014] (3) Genomic DNA was extracted from the leaves of the parents C268 and 9311 and individual plants of the F2 population using the CTAB method (Murray & Thompson, 1980 Rapid isolation of high-molecular-weight plant DNA. Nucleic Acids Res 8: 4321-4325). The two parents were screened for polymorphism using the candidate markers developed in method (1). PCR reactions were performed on a Biometra Tone amplification instrument, and the amplification products were analyzed by electrophoresis on a 10% non-denaturing polyacrylamide gel. InDel molecular markers with polymorphism between the parents were recorded and selected for subsequent genotyping analysis.

[0015] (4) The seedling bulk test was used to identify plant resistance. The brown planthopper source used in the experiment was a population collected in 2022 from the experimental field of Guangxi University Farm in Nanning, Guangxi, and reproduced on susceptible cultivar 9311. When the rice reached the two-leaf-one-heart stage (about 11 days), 2nd-3rd instar brown planthopper nymphs were inoculated at a ratio of 8 nymphs / seedling. When the survival rate of the susceptible control cultivar 9311 was less than 10%, the survival rate of each family was evaluated according to the method introduced by Huang et al. (Huang et al, 2025 Exploring resistance mechanisms and identifying QTLs for brown planthopper in tropical and subtropical rice (Oryza sativa L.) germplasm. Theoretical and Applied Genetics 138(3): 1-16).

[0016] (5) Based on the average insect resistance level of the F3 family, leaf genomic DNA from 10 extremely insect-resistant individuals and 10 extremely insect-susceptible individuals were mixed at the same concentration to construct resistance and susceptibility DNA pools. Simultaneously, polymorphic InDel primers were used to screen the resistance and susceptibility DNA pools and obtain polymorphic molecular markers, which are linked to the resistance trait. Then, based on the chromosome where the linkage marker is located, primers on that chromosome that are polymorphic among the parents were selected to amplify each individual plant of the F2 segregating population. The PCR procedure was the same as above, and population genotype data was obtained. According to the linkage recombination law, a partial genetic linkage map of rice was constructed using JoinMap 3.0 software, and the genetic distance between each molecular marker was obtained. Finally, combining the molecular marker genotype data of each individual plant in the F2 population and the corresponding seedling survival rate for brown planthopper resistance identification, QTL site scanning of the target chromosome was performed using the composite interval mapping method of QTL IciMapping Version 4.2 software.

[0017] (6) Based on the preliminary mapping results, F3 single plants were screened using the two molecular markers 1M28.256 and 1M32.256, which are closest to each other at both ends of the resistance gene locus, in order to obtain recombinant single plants between the two markers. At the same time, four molecular markers 1M30.093, 1M30.471, 1M30.929 and 1M32.044, which are polymorphic between the two parents, were developed between the two markers. Based on the genotypic and phenotypic analysis of the recombinant single plants, the mapping region of the resistance gene was narrowed down to between molecular markers 1M30.093 and 1M30.471, corresponding to about 370kb in the Nipponbare genome. Since no major gene for resistance to brown planthopper was reported in this region, the resistance gene locus we mapped was named Bph48.

[0018] The beneficial effects of this invention are:

[0019] (1) The present invention was the first to finely locate the major gene Bph48 for resistance to brown planthopper carried by rice variety C268 using InDel molecular markers.

[0020] (2) The major gene loci located by the molecular markers of this invention are clearly defined and easy to identify. By detecting molecular markers closely linked to the gene locus, the resistance level of rice plants to brown planthoppers can be predicted. This can be used for genotyping of rice varieties or lines to determine whether the variety or line has resistance to brown planthoppers, thereby quickly screening insect-resistant varieties or lines for rice breeding. The detection is convenient and rapid, and is not affected by the environment.

[0021] (3) Assisted breeding has a clear selection objective and saves costs. In traditional breeding methods, it is necessary to first collect parents with insect-resistant genes and conduct a series of hybridizations with cultivated varieties. Moreover, it is necessary to identify and select rice varieties with brown planthopper resistance traits. The operation is very complicated and is also affected by the environment. In addition, before conducting insect resistance identification, it is necessary to obtain insect sources and raise and breed brown planthopper populations. At the same time, it is also required that the inoculation of insect sources and rice seedlings be relatively synchronized. This also brings trouble to the breeding work. If the relationship between insect sources, seedlings and environment cannot be effectively handled, the reliability of the phenotypic identification results of brown planthopper resistance will be very low. Therefore, insect-resistant breeding is not only time-consuming, but also difficult and costly. However, by using molecular markers to assist in the detection of major gene loci for brown planthopper resistance, highly resistant individual plants can be identified at the seedling stage, eliminating other plants. This not only saves production costs but also greatly improves the selection efficiency of brown planthopper-resistant rice and greatly shortens the breeding cycle of insect-resistant varieties. Attached Figure Description

[0022] Figure 1 Preliminary localization of Bph48, the major gene for resistance to brown planthopper in rice germplasm C268. A, Phenotypic diagram of the F3 population constructed using 9311 / C268; B, Localization diagram of resistance genes in the F3 population constructed using 9311 / C268.

[0023] Figure 2 Phenotypic and genotypic characteristics of recombinant plants used for fine mapping of the major gene Bph48 for resistance to brown planthopper. Bph48 is located in a 370 kb region between 1M30.093 and 1M30.471, and the molecular marker 1M30.471 is closely linked to the resistance gene. n represents the total number of F3 plants used for screening recombinants. Black, gray, and white represent resistant, moderately resistant, and susceptible genotypes, respectively.

[0024] Figure 3 The banding patterns of the amplified products of molecular marker 1M30.471 in different rice materials were detected by 10% non-denaturing PAGE electrophoresis. M: DNA marker; lanes 1-6 represent NY50, NY66, NY04, NY08, NIP, and ZH11; lanes 7-22 represent the hybrid offspring families of C268 and 9311; lanes 23-24 represent C268 and 9311; R and S represent the corresponding resistance and susceptibility banding patterns, respectively. Detailed Implementation

[0025] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention.

[0026] Example 1: Acquisition of Molecular Markers

[0027] (I) Construction and phenotypic identification of the 9311 / C268 F3 population

[0028] (1) In previous studies, insect resistance identification experiments based on cultivated rice germplasm resources collected in our laboratory showed that germplasm C268 has high resistance to brown planthopper populations collected from the experimental field of Guangxi University Farm. In order to find simple and effective molecular markers that are closely linked to Bph48, this invention uses the susceptible line 9311 as the female parent and the brown planthopper-resistant rice germplasm C268 as the male parent for hybridization to obtain F1, which is then self-crossed to construct F2 segregating populations; each F2 single plant obtains the corresponding F3 family through self-crossing.

[0029] (2) The insect resistance of the parents and F3 families was identified using the seedling group method. To ensure consistent growth among the families in the parents and F3 population, all tested materials were soaked and germinated separately before sowing. Forty normally germinated seeds from each family (variety) were sown in a 56cm × 37cm × 8cm plastic tray filled with 5cm of paddy soil. Two replicates were sown for each material in each tray, and two replicates were randomly sown for each parent. Seven days after sowing, seedlings were thinned, and diseased and weak seedlings were removed. When rice plants reach the two-leaf stage (approximately 11 days), 2nd-3rd instar brown planthopper nymphs are inoculated at a ratio of 8 nymphs per seedling. When the survival rate of the susceptible variety 9311 is less than 10%, the survival rate of each family is evaluated according to the method described by Huang et al. (Huang et al., 2025 Exploring resistance mechanisms and identifying QTLs for brown planthopper in tropical and subtropical rice (Oryza sativa L.) germplasm. Theoretical and Applied Genetics 138(3): 1-16) (Table 1).

[0030] Table 1: Grading Standards for Rice Resistance to Brown Planthopper

[0031] Survival rate (examined when the survival rate of 9311 is less than 10%) resistance level 0~30% High Sensitivity (HS) 31%~50% Feeling (S) 51%~70% MR (metastatic antimicrobial) 71%~90% Anti(R) 91%~100% High resistance (HR)

[0032] (II) Molecular marker analysis of the 9311 / C268 population

[0033] (1) Genomic DNA was extracted from the leaves of all individual plants of the parental line and F2 population using the CTAB method (Murray & Thompson, 1980, Rapid isolation of high-molecular-weight plant DNA. Nucleic Acids Res 8: 4321-4325).

[0034] (2) Based on the insect resistance level of F2 individual plants, leaf genomic DNA from 10 extremely insect-resistant plants and 10 extremely insect-susceptible plants were mixed to construct resistance and susceptibility pools. Approximately 1800 pairs of molecular markers preserved in our laboratory were screened, covering all 12 rice chromosomes. The screening results showed that molecular markers 1M27.812 and 1M28.256, located on the long arm of rice chromosome 1, exhibited consistent polymorphism between the parents and the resistance / susceptibility pools. Therefore, it was preliminarily identified that a resistance gene locus might exist on this long arm of the chromosome. Subsequently, more polymorphic markers were searched in the target region. Using the same strategy, resequencing-assisted molecular marker development was employed. C268 was resequencing to detect its variations across all 12 chromosomes. After alignment with the reference genome ZS97RS3, SNPs and InDel mutations in the target region, along with their corresponding physical distances on the chromosomes (ZS97RS3 was converted to NIP), were obtained. InDels >10 bp were selected as targets, resulting in four polymorphic molecular markers: 1M30.093, 1M30.471, 1M30.929, and 1M32.044. Primers for these polymorphisms were then used to screen all individual plants in the F2 segregating population, obtaining population genotypic data. Based on linkage and recombination, JoinMap 3.0 software was used to construct a partial genetic map of rice from the population genotypic data, and the genetic distances of each molecular marker were obtained. Finally, combining the molecular marker genotypes of each individual plant in the F2 population with the corresponding seedling survival rate of brown planthopper resistance identification, QTL site scanning of the target chromosome was performed using the composite interval mapping method of IciMapping Version 4.2 software.

[0035] (3) The PCR reaction system components are as follows: DNA template, 1 μl; 10 μM primer, 0.5 μl; 2×PCR Mix, 5 μl; ddH2O, to make up to 10 μl.

[0036] The amplification products of the InDel primers used in this experiment are generally between 100-300 bp in length, and the PCR reaction program used is: 95 o C, 5 min; (95) o C, 30 sec; 54 o C, 30 sec; 72 o C, 45 sec) × 33cycles; 72 o C, 5 min.

[0037] The conditions used for different primers may vary, mainly in terms of annealing temperature. Sometimes it is necessary to adjust the appropriate annealing temperature for each primer pair. The specific temperature can be set by referring to the values ​​given by the Primer-BLAST program on the NCBI website.

[0038] The amplified products were separated using 10% non-denaturing PAGE gels, and the amplified DNA bands were recorded by silver staining (Zhu et al, 2004 Identification and characterization of a new blast resistance gene located on rice chromosome 1 through linkage and differential analyses. Phytipathology 94:515-519). Polymorphic primers were used to analyze individual F2 plants to obtain the population genotype.

[0039] The results of the seedling group method for insect resistance identification showed that the average seedling survival rates of C268 and 9311 were 91% and 0%, respectively, indicating that C268 was highly resistant to brown planthoppers while 9311 was highly susceptible. The survival rates of 147 F3 families in the field population against brown planthoppers showed a continuous distribution, with a minimum of 0% and a maximum of 100%. Figure 1 A).

[0040] Genotypes of F2 plants were analyzed using polymorphic molecular markers among the previously screened parents, and QTL scanning was performed in conjunction with the resistance values ​​of each plant. The results showed a significant QTL locus between molecular markers 1M28.256 and 1M32.256 on the long arm of chromosome 1, with a LOD value of 23 and a contribution rate of 52% to the resistance phenotype. Figure 1 B).

[0041] Example 2: Fine mapping of the resistance gene Bph48

[0042] (a) Screening for fine mapping of the gene Bph48 in 9311 / C268 F3 recombinant single plants using molecular markers.

[0043] Based on the preliminary mapping results of the resistance gene Bph48, 3500 F3 single plants were screened using molecular markers 1M28.256 and 1M32.256 flanking the preliminary mapping, obtaining single plants in which recombination exchanged between the two markers. Genotyping of the recombinant single plants was performed using the previously developed molecular markers. Combining the genotype and phenotype of the recombinant single plants, the co-segregation of markers and the resistance phenotype was examined, and the resistance gene was finely mapped.

[0044] (II) Results and Analysis

[0045] Using molecular markers 1M28.256 and 1M32.256, which were initially located on both sides, a total of 3500 F3 single plants were screened, resulting in 320 recombinant single plants. Due to the large physical distance between the two markers, two molecular markers with smaller segments, 1M30.093 and 1M30.929, were used to further test the 320 screened recombinant single plants, ultimately obtaining 34 recombinant single plants, which were then propagated. Next, insect resistance was identified in the recombinant single plants. Based on the genotype of the recombinant single plants and their insect resistance phenotype, Bph48 was located between 1M30.093 and 1M30.471, and was closely linked to marker 1M30.471. According to the Nipponbare genome sequence, the physical distance between 1M30.093 and 1M30.471 is about 370 kb. Therefore, using the molecular marker 1M30.471 to identify the presence of Bph48 is highly efficient, which greatly improves the breeding progress of brown planthopper-resistant rice varieties.

[0046] Example 3: Validation of Molecular Markers

[0047] (I) Materials and Methods

[0048] (1) Materials

[0049] Negative varieties: 15, offspring of the hybrid combinations of susceptible strains (species) 9311, ZH11, NIP, NY08, NY66, and 9311 / C268.

[0050] Positive varieties: 9 copies, offspring of the C268, NY50, NY04, and 9311 / C268 hybrid combinations.

[0051] Molecular marker primer: 1M30.471

[0052] (2) Method

[0053] Genomic DNA was extracted from rice leaf samples using the CTAB extraction method. The sample DNA was amplified using primer 1M30.471. The amplified products were separated using a 10% non-denaturing PAGE gel, and the amplified DNA bands were recorded by silver staining (the method is the same as in Example 1).

[0054] (II) Results

[0055] The genomic DNA of 24 different samples from rice varieties C268, 9311, NY50, and NY66 was amplified by PCR using the method described above. The results showed that the corresponding resistance fragments were amplified in all positive samples, while susceptible fragments were amplified in the negative samples. This indicates that the molecular marker method provided by this invention can accurately screen samples containing the major gene Bph48 for resistance to brown planthopper, thereby greatly improving the selection efficiency of insect-resistant rice materials.

[0056] like Figure 3As shown, the non-denaturing PAGE electrophoresis band patterns of the amplified products of molecular marker 1M30.471 in different rice materials are illustrated. M is a 2000bp marker; the bottom band is 100bp long, and the second-to-last band is 250bp long. S represents 9311 (susceptible varieties, i.e., negative varieties); R represents C268 (insect-resistant varieties, i.e., positive varieties). The arrows indicate the difference bands between resistant and susceptible varieties. In positive samples, an R band (R for the highly insect-resistant variety C268, a positive variety) was present at the same level; however, this band was absent in negative samples.

[0057] In summary, the molecular marker 1M30.471 of this invention can effectively detect whether the insect-resistant variety C268 and its derivative varieties (lines) contain this major resistance gene locus, greatly improving the selection efficiency of brown planthopper-resistant rice plants and obtaining brown planthopper-resistant rice varieties (lines) containing Bph48.

[0058] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A molecular marker primer tightly linked to the major gene Bph48 for resistance to brown planthopper in rice, its marking method, and its application, which is obtained by PCR amplification using the following primer pair: Labeled primers: 1M30.471 Left primer sequence: CAATACCACACATCTGGCCC Right-end primer sequence: CAGCAACTGTCAAAACTAGAGAG.

2. The molecular marker primers for tightly linked major gene Bph48 in rice brown planthopper, as described in claim 1, and their marking method and application, characterized in that... Application of molecular markers in breeding rice varieties resistant to brown planthopper.

3. As described in claim 1, the above primers can be used to amplify the genomic DNA of the rice leaves to be tested and detect the amplification products. If primer 1M30.471 can amplify the corresponding 100bp fragment in the resistant variety, it indicates that the rice to be tested has the major gene Bph48 for resistance to brown planthopper.

4. A method for screening rice resistant to brown planthopper, wherein the genomic DNA of the leaves of the rice to be tested is amplified using the primer pair described in claim 1, and if a 100bp fragment is amplified using primer 1M30.471, the rice to be tested is identified as a resistant rice material carrying the major gene Bph48 for resistance to brown planthopper.