Primer probe group and kit for identifying cassava variety Nanshan 199 based on MNP (Matrix Natriuretic Peptide) marker and application of primer probe group and kit

Abstract

The invention discloses a primer probe group for identifying a cassava variety Nanshan 199 based on an MNP marker, a kit and application. The primer probe group comprises a first primer pair, a first probe, a second primer pair, a second probe, a third primer pair and a third probe, and each primer pair comprises an upstream primer and a downstream primer; the kit comprises the primer probe set, the primer probe set for identifying the cassava variety Nanshan 199 based on the MNP marker, the kit and application, the SNP difference between varieties is analyzed based on the detection result of multiple TaqMan probe qPCR, and therefore rapid and accurate identification of the cassava variety Nanshan 199 is achieved.

Description

Technical Field

[0001] This disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a primer and probe set, kit, and application for identifying the cassava variety Nanzhi 199 based on MNP markers. Background Technology

[0002] The cassava variety Nanzhi 199 not only serves as an important raw material for starch processing and industrial ethanol production, directly driving the development of related industries, but also helps growers increase production and income, resulting in significant socio-economic benefits. In recent years, with the expansion of the cultivation area of ​​Nanzhi 199 and the acceleration of variety improvement, the importance of variety authenticity identification in production, seedling supervision, quality control, and intellectual property protection has significantly increased.

[0003] Traditional variety identification methods rely heavily on morphological characteristics or simple molecular markers, but these methods are slow, have low sensitivity to adulterated samples, and are difficult to implement quickly in the field. Therefore, there is an urgent need for a method that can rapidly identify samples with high sensitivity to adulteration.

[0004] Public content

[0005] To address the shortcomings of existing identification methods, such as slow speed, low sensitivity to adulterated samples, and difficulty in rapid on-site identification, this disclosure provides a primer-probe set, kit, and application for identifying the cassava variety Nanzhi 199 based on MNP markers. The technical solution is as follows:

[0006] On one hand, this disclosure provides a primer and probe set for identifying the cassava variety Nanzhi 199 based on MNP markers. The primer and probe set includes a first primer pair, a first probe, a second primer pair, a second probe, a third primer pair, and a third probe. Each primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO:1 of the sequence listing, the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO:2 of the sequence listing, the nucleotide sequence of the first probe is shown in SEQ ID NO:3 of the sequence listing, the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO:4 of the sequence listing, the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO:5 of the sequence listing, the nucleotide sequence of the second probe is shown in SEQ ID NO:6 of the sequence listing, the nucleotide sequence of the upstream primer of the third primer pair is shown in SEQ ID NO:7 of the sequence listing, the nucleotide sequence of the downstream primer of the third primer pair is shown in SEQ ID NO:8 of the sequence listing, and the nucleotide sequence of the third probe is shown in SEQ ID NO:9 of the sequence listing.

[0007] On the other hand, this disclosure provides a kit for identifying the cassava variety Nanzhi 199 based on MNP markers, the kit comprising the aforementioned primer and probe set.

[0008] On the other hand, this disclosure provides an application of a primer and probe set for identifying the cassava variety Nanzhi 199 based on MNP markers. The application includes using the above primer and probe set for qPCR amplification, and then analyzing the SNP differences among cassava varieties based on the amplification results to determine whether the cassava variety is Nanzhi 199.

[0009] Specifically, the thermal cycling program for qPCR amplification includes: 95℃ for 2 min; followed by 40 cycles, each consisting of: 95℃ for 15 s and 60℃ for 60 s.

[0010] Specifically, each 20 μL qPCR amplification program includes: 10 μL of 2×qPCR Master Mix, 300 nM each of the upstream and downstream primers of the first primer pair, the second primer pair, and the third primer pair, 150 nM each of the first probe, the second probe, and the third probe, 2 μL of template DNA from the sample to be tested, and RNase-free water to make up the difference.

[0011] The technical solution provided in this disclosure has the following beneficial effects: This invention provides a primer and probe set, kit, and application for identifying the cassava variety Nanzhi 199 based on MNP markers. This primer and probe set can accurately distinguish varieties based on qPCR results, thereby enabling efficient, rapid, and high-throughput identification of the cassava variety Nanzhi 199. Specifically, to meet the needs of rapid, sensitive, and industrially scalable variety identification, this disclosure utilizes the cassava multiple nucleotide polymorphism (MNP) database. Based on fluorescent probes at target sites, one-step identification of specific single nucleotide polymorphisms (SNPs) can be achieved. That is, by using site-specific oligonucleotide probes combined with fluorescent reporters, the allele status can be directly determined through fluorescence signals during amplification, and multi-channel multiplex detection can be achieved, making it suitable for high-throughput scenarios and scenarios involving mixed sample detection. A three-channel TaqMan qPCR detection method based on two specific SNP loci (AMPL4069360 and AMPL4070569) of Nanzhi 199 from the cassava MNP database and one internal control locus is employed, combined with a specific interpretation algorithm to improve the detection capability of adulterated samples, counterfeit seedlings, and low-abundance mixed samples. Utilizing the good expression stability of the cassava UBQ10 gene (Polyubiquitin 10) under various tissue and treatment conditions, this invention selects the UBQ10 gene as a qPCR internal control gene and uses it as a positive amplification control to provide internal verification of amplification success and sample quality, thereby improving the reliability of the identification results. Using site-specific oligonucleotide probes combined with fluorescent reporters, allele status can be directly interpreted through fluorescence signals during amplification, enabling multi-channel multiplex detection, thus suitable for high-throughput scenarios and detecting mixed samples. This invention employs a probe-based qPCR multiplex detection method targeting pre-selected MNP loci. This method eliminates the need for library construction, sequencing, and complex bioinformatics analysis, enabling the processing, amplification, and interpretation of test samples within hours, significantly shortening the detection cycle. Furthermore, it relies on common quantitative PCR instruments, making it easy to operate, lower in cost, and readily applicable in breeding fields or grassroots testing laboratories. The Ct values ​​generated by qPCR can be directly used for automated result interpretation, simplifying the data processing workflow and facilitating reagent-based and large-scale applications. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0013] Figure 1 The sequence alignment results of the AMPL4069360 site in the cassava MNP database provided in Embodiment 3 of this disclosure among different cassava varieties are shown, with the specific SNP site of Nanzhi 199 marked.

[0014] Figure 2 The sequence alignment results of the AMPL4070569 site in the cassava MNP database provided in Embodiment 3 of this disclosure among different cassava varieties are shown, with the specific SNP site of Nanzhi 199 marked. Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below.

[0016] Example 1

[0017] This disclosure provides a primer-probe set for identifying the cassava variety Nanzhi 199 based on MNP markers. The primer-probe set includes a first primer pair, a first probe, a second primer pair, a second probe, a third primer pair, and a third probe. Each primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO:1 of the sequence listing, the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO:2 of the sequence listing, the nucleotide sequence of the first probe is shown in SEQ ID NO:3 of the sequence listing, the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO:4 of the sequence listing, the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO:5 of the sequence listing, the nucleotide sequence of the second probe is shown in SEQ ID NO:6 of the sequence listing, the nucleotide sequence of the upstream primer of the third primer pair is shown in SEQ ID NO:7 of the sequence listing, the nucleotide sequence of the downstream primer of the third primer pair is shown in SEQ ID NO:8 of the sequence listing, and the nucleotide sequence of the third probe is shown in SEQ ID NO:9 of the sequence listing.

[0018] Specifically, the sequence of the upstream primer (5'→3') of the first primer pair is: TACATAACCCCAACTCGAGGAGA, the sequence of the downstream primer (5'→3') of the first primer pair is: TTCATGGAATATATATTCAGCC, the sequence of the first probe (5'→3') is: GACCAAATTCTTTAACTGTAAGTGACT, and the fluorescence channel of the first probe is FAM; the sequence of the upstream primer (5'→3') of the second primer pair is: GAAATATCATTCTCAATGCATATTA, and the sequence of the downstream primer (5'→3') of the second primer pair is: The sequence of the second probe (5'→3') is CAGTTGATGACTTGGACTGAAT, and the fluorescence channel of the second probe is HEX. The sequence of the upstream primer (5'→3') of the third primer pair is CCGATTGAGGGGGAGGTATGC, the sequence of the downstream primer (5'→3') of the third primer pair is CAACCTCTGCTGGTCAGGAG, and the sequence of the third probe (5'→3') is GGCCAAGATTCAGGACAAGGAAGGCA. The fluorescence channel of the third probe is CY5.

[0019] Example 2

[0020] This disclosure provides a kit for identifying the cassava variety Nanzhi 199 based on MNP markers. The kit includes the primer and probe set provided in Example 1.

[0021] Example 3

[0022] This disclosure provides an application of a primer and probe set for identifying the cassava variety Nanzhi 199 based on MNP markers. The application includes: using the primer and probe set provided in Example 1 for qPCR amplification, analyzing the SNP differences among cassava varieties based on the amplification results, and determining whether the cassava variety to be tested is Nanzhi 199.

[0023] This primer-probe set can stably and efficiently amplify in a single channel and has allele discrimination ability. In order to verify the sensitivity and specificity of the TaqMan probe under single-channel conditions, the following experimental procedure and judgment criteria were adopted in this embodiment: The test samples included positive samples that were confirmed as the target variety "Nanzhi 199", representative negative samples from 10 non-target cassava varieties, and template-free control (NTC). The negative sample varieties were named as follows: SC5, SC6, SC11, Xinxuan 048, Guire 4, Guire 5, Malai 4, Nanzhi 188, Nuomi cassava, and Guizhou 1.

[0024] DNA (positive and negative samples) was extracted from the 11 samples to be tested. In practice, the DNA was extracted from the samples using a novel plant genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. The specific operation was performed according to the instructions of the novel plant genomic DNA extraction kit. The primer and probe set provided in Example 1 of this invention was used to amplify 12 samples to be tested (positive, negative, and NTC). Specifically, the amplification system included: 20 μL (10 μL of 2×qPCRMaster Mix, 300 nM each of upstream and downstream primers, 150 nM each of probes, 2 μL of template, and RNase-free water to make up the difference). The thermal cycling program included: 95℃ for 2 min; followed by 40 cycles, each cycle consisting of: 95℃ for 15 s, 60℃ for 60 s. Each sample was tested in triplicate. The threshold for judgment is the threshold agreed upon in the embodiments of the present invention: if the target SNP probe (FAM or HEX channel) Ct of the first probe or the second probe is ≤35, it is considered positive; if Ct 35~38 is a gray area, it needs to be retested for confirmation; if Ct≥38 or there is no amplification, it is considered negative; if the internal reference of the third probe (CY5 channel) Ct≤32, it is considered that the amplification is qualified.

[0025] The experimental results of the 12 samples to be tested in this embodiment are shown in Table 1.

[0026] Table 1 shows the single-channel experimental results.

[0027]

[0028] Table 1 shows that in the positive sample Nanzhi 199, the average Ct value of FAM (site 1) was 20.3, the average Ct value of HEX (site 2) was 21.1, and the average Ct value of CY5 (internal control) was 20.8, with small variation among technical replicates. In the 10 negative samples (SC5, SC6, SC11, Xinxuan 048, Guire 4, Guire 5, Malai 4, Nanzhi 188, Nuomi cassava, and Guizhou 1), no amplification was detected by the first and second probes (Ct>38), but the internal control (CY5) amplified normally within the Ct value range of 16.5~23.5, indicating that template quality and amplification system did not inhibit amplification. No channel amplification was observed in NTC. Figure 1 and Figure 2 It can be seen that the first and second probes and the selected NTC can achieve stable amplification under single-channel conditions and achieve specific recognition of Nanzhi 199. That is, the positive sample shows obvious signals in all three channels at the same time and the Ct value is far below the threshold. The non-target sample only amplifies the internal reference and the target probe has no significant signal.

[0029] This embodiment uses a full matrix consisting of three primer pair concentrations (200nM / 300nM / 400nM) and three probe concentrations (100nM / 150nM / 200nM) for screening, and performs detection on a real-time quantitative PCR instrument equipped with FAM / HEX / CY5 three channels. The DNA extraction method is the same as described above. Each reaction volume is 20 μL (10 μL of 2×qPCR MasterMix, 300 nM each of upstream and downstream primers, 150 nM each of probes, 2 μL of template DNA, and RNase-free water to make up the difference), and the thermal cycling program is 95°C for 2 min; then 40 cycles are performed, each cycle consisting of 95°C for 15 s and 60°C for 60 s. Each sample is technically replicated three times to evaluate reproducibility.

[0030] The optimal formulation was screened using ΔCt (multiplex Ct − singleplex Ct) ≤ 1.0 as an acceptable criterion. After comparing nine concentration combinations, the recommended multiplex formulation was finally selected with 300 nM upstream and downstream primers and 150 nM probes, as detailed in Table 2.

[0031] Table 2 shows the results of the multi-channel experiment.

[0032]

[0033] Under this formulation, the average Ct values ​​of positive samples in the three channels are: FAM (site1) = 20.3, HEX (site2) = 21.1, and CY5 (internal reference) = 20.8, while the corresponding average Ct values ​​of singleplex are FAM = 19.9, HEX = 20.8, and CY5 = 20.6 (corresponding to ΔCt_FAM = 0.4, ΔCt_HEX = 0.3, and ΔCt_CY5 = 0.2, all ≤ 1.0), showing that multiplex has a very small impact on sensitivity.

[0034] To verify the ability of the application provided by this invention to identify Nanzhi 199 under mixed / blended conditions, this embodiment incorporated genomic DNA of Nanzhi 199 into non-target sample DNA at different proportions (the same background mixture consisted of equal amounts of several non-Nanzhi 199 varieties), constructing incorporation gradients of 50%, 10%, 5%, 1%, and 0.1%. All sample and DNA extraction methods were consistent with those described above. The qPCR reaction used the optimized multiplex starter formulation (300 nM each for upstream and downstream primers, and 150 nM each for probes), with a reaction volume of 20 μL. The thermal cycling program was 95℃ for 2 min; followed by 40 cycles, each consisting of 95℃ for 15 s and 60℃ for 60 s; each incorporation site was performed in triplicate. The judgment criteria are as described in this invention: an internal control (CY5) Ct value ≤ 32 is considered amplification qualified; a target probe (FAM / HEX) Ct value ≤ 35 is positive; Ct 35~38 is a gray area requiring retesting; Ct ≥ 38 or no amplification is negative. The experimental results are shown in Table 3.

[0035] Table 3 shows the pooled sample detection capability.

[0036]

[0037] Table 3 shows that at incorporation levels of 50%, 10%, and 5%, both target sites were stably detected in all three replicates (all positive). The Ct values ​​for FAM (site1) and HEX (site2) gradually decreased with decreasing target concentration. At an incorporation level of 1%, both sites were still detected in all replicates under the experimental conditions. However, at an incorporation level of 0.1%, detection became unstable, with only one positive result in three replicates; the other replicates showed no signal or gray areas, thus being judged as "unreliable / unstable." The internal control (CY5) amplified stably at all incorporation sites (average Ct value approximately 20.9–21.4), indicating no significant inhibition or error in the total DNA amount / amplification conditions. In summary, this example demonstrates that under the recommended multiplex conditions, the lowest reliable detection limit for "Nanzhi 199" is approximately 1% (mass ratio); trace incorporations below this level may result in unstable detection or poor repeatability.

[0038] To evaluate the reproducibility and long-term stability of this application, this embodiment conducted intra-run, inter-run, and reagent stability tests (stored at room temperature and 4°C). Specifically, the recommended multiplex starting formulation (300 nM each for upstream and downstream primers, and 150 nM each for probes) was used to perform eight technically repeated assays on the same plate to assess intra-run reproducibility. Inter-run reproducibility was assessed by having different operators perform the same assays on three different work days. To assess reagent stability, the prepared reaction mixture or reagent was placed at room temperature for 24 hours and then stored at 4°C for 6 months, with changes in Ct values ​​compared to the initial reagents. For freeze-thaw stability, Ct values ​​were measured after three freeze-thaw cycles. All experiments were performed according to the above thermal cycling procedures and criteria, and data are expressed as mean Ct values ​​and coefficient of variation (CV%).

[0039] Experimental results showed good repeatability on the same board (n=8): FAM (site1) average Ct value = 20.5, CV = 1.8%; HEX (site2) average Ct value = 21.0, CV = 2.1%; CY5 (internal control) average Ct value = 20.7, CV = 1.5%. Inter-run tests on different days / by different operators showed FAM (site1) average Ct value = 20.8 (CV = 2.9%), HEX (site2) average Ct value = 21.3 (CV = 3.4%), and CY5 (internal control) average Ct value = 21.0 (CV = 2.6%), indicating that the application maintained good stability under normal experimental conditions and operational variations. In stability testing, after the reaction system was placed at room temperature for 24 hours, the Ct value of FAM (site1) increased by an average of approximately 0.3 cycles; after storage at 4°C for 6 months, it increased by an average of approximately 0.2 cycles; and after 3 freeze-thaw cycles, it increased by an average of approximately 0.5 cycles. These changes were all within acceptable limits and could be eliminated by using fresh or quality-controlled reagent batches. This example demonstrates that the multiplex TaqMan system meets the basic requirements for kits and applications in terms of repeatability and long-term stability. Specific test results are shown in Table 4.

[0040] Table 4 shows the repeatability and stability test results.

[0041]

[0042] This invention provides a primer and probe set, kit, and application for identifying the cassava variety Nanzhi 199 based on MNP markers. Based on the detection results of multiplex TaqMan probe qPCR, the SNP differences among varieties are analyzed, thereby achieving accurate identification of the cassava variety Nanzhi 199. Reproducibility experiments further validate the accuracy and reliability of this technology.

[0043] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. A primer and probe set for identifying the cassava variety Nanzhi 199 based on MNP markers, characterized in that, The primer-probe set includes a first primer pair, a first probe, a second primer pair, a second probe, a third primer pair, and a third probe. Each primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO:1 of the sequence listing. The nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO:2 of the sequence listing. The nucleotide sequence of the first probe is shown in SEQ ID NO:3 of the sequence listing. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO:4 of the sequence listing. The nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO:5 of the sequence listing. The nucleotide sequence of the second probe is shown in SEQ ID NO:6 of the sequence listing. The nucleotide sequence of the upstream primer of the third primer pair is shown in SEQ ID NO:7 of the sequence listing. The nucleotide sequence of the downstream primer of the third primer pair is shown in SEQ ID NO:8 of the sequence listing. The nucleotide sequence of the third probe is shown in SEQ ID NO:9 of the sequence listing.

2. A kit for identifying the cassava variety Nanzhi 199 based on MNP markers, characterized in that, The kit includes the primer and probe set as described in claim 1.

3. An application of a primer and probe set for identifying the cassava variety Nanzhi 199 based on MNP markers, characterized in that, The application includes using the primer and probe set as described in claim 1 for qPCR amplification, and then analyzing the SNP differences among cassava varieties based on the amplification results to determine whether the cassava variety is Nanzhi 199.

4. The application according to claim 3, characterized in that, The application further includes: when the Ct value obtained by the third probe amplification is ≤32, the amplification is considered qualified; when the Ct value obtained by the first probe and the second probe amplification is ≤35, the sample to be tested is Nanzhi 199.

5. The application according to claim 3, characterized in that, The thermal cycling program for qPCR amplification includes: 95℃ for 2 min; followed by 40 cycles, each consisting of: 95℃ for 15 s and 60℃ for 60 s.

6. The application according to claim 3, characterized in that, Each 20 μL qPCR amplification program includes: 10 μL of 2×qPCR Master Mix, 300 nM each of the upstream and downstream primers of the first primer pair, the second primer pair, and the third primer pair, 150 nM each of the first probe, the second probe, and the third probe, 2 μL of template DNA from the sample to be tested, and RNase-free water to make up the difference.

Images